A snp molecular marker related to left chela thickness of eriocheir sinensis, detection primer pair, kit and use

Abstract

The application discloses a SNP molecular marker related to the thickness of a left chelae of Scylla paramamosain, a detection primer pair, a kit and purposes. The SNP molecular marker is that the 184th base from the 5' end of the nucleotide sequence shown in SEQ ID NO:1 is C or T. The SNP molecular marker can be used for predicting the left chelae thickness of an individual in early breeding, and is used for molecular marker assisted selection breeding (MAS), so that the breeding efficiency and precision of the Scylla paramamosain are improved, the breeding period is shortened, the breeding cost is reduced, and the economic benefits are improved.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, and relates to an SNP molecular marker, detection primer pair, kit, and application of mud crab with thickness of left claw. Background Technology

[0002] Mud crabs, an important aquaculture species in my country, are beloved by consumers for their delicious taste and rich nutrition. The genus *Scylla* comprises four species, among which *Scylla paramamosain* is the dominant species in my country, widely distributed along the southeastern coast. It is characterized by high economic value and rapid growth, and has become the most produced aquaculture crab species in my country. With the increasing market demand for high-quality mud crabs, consumers are paying more attention to traits such as body shape and appearance (e.g., claws). Claws are important organs of mud crabs; their width directly affects not only their visual appeal but also the plumpness of their meat and their market value. Therefore, improving the claw width trait of *Scylla paramamosain* is of great significance in genetic breeding and production.

[0003] In traditional breeding, phenotypic data is often only available after an individual reaches adulthood, making it difficult to assess and select individuals for phenotypic traits at an early stage. With the rapid development of science and technology, the genetic analysis and improvement of important economic traits in farmed animals have evolved from traditional phenotypic selection to marker-assisted selection and genome-wide selection. In the analysis of the genetic mechanisms of phenotypic traits, genome-wide association studies (GWAS) have proven highly effective. By performing high-throughput sequencing on the target population, developing genome-wide molecular markers, and combining this with phenotypic data for GWAS analysis, all collected traits can be simultaneously analyzed for localization. This method is highly efficient and practical, and its application in the genetic breeding and trait improvement of economically important species is becoming increasingly widespread.

[0004] Among numerous molecular marker technologies, single nucleotide polymorphism (SNP) markers have become the preferred choice for assisted breeding due to their high abundance, automated detection capabilities, low cost, and rapid application. Currently, there are no publicly reported SNP markers for identifying the left claw thickness trait in *Scylla scutellaria* using GWAS analysis. Therefore, developing SNP markers for identifying the left claw thickness trait in *Scylla scutellaria* and applying positively effective molecular markers to genomic selection in *Scylla scutellaria* to establish an efficient and accurate gene breeding technology will greatly accelerate the genetic progress of the quantitative trait of left claw thickness in *Scylla scutellaria*, thereby improving the economic benefits of *Scylla scutellaria* aquaculture. Summary of the Invention

[0005] The primary objective of this invention is to overcome the shortcomings and disadvantages of the prior art and provide an SNP molecular marker located on chromosome 40 of the mud crab that is related to the thickness of the left claw.

[0006] To achieve the above objectives, this invention provides a SNP molecular marker related to the thickness of the left claw of the mud crab, characterized in that the SNP molecular marker is a T or C nucleotide at position 184 from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1. Specifically, it represents a C>T mutation at nucleotide position 6278173 (6278173 bp) on chromosome 40 of the mud crab reference genome (National Center for Biotechnology Information Database Retrieval No.: GCA_035594125.1).

[0007] Furthermore, the left cheliped thickness of individuals with the TT and CT genotypes of the SNP molecular marker was significantly higher than that of individuals with the CC genotype.

[0008] Furthermore, the burrowing mud crab includes the burrowing mud crab and its hybrid varieties or strains.

[0009] The present invention also provides a primer pair for detecting the SNP molecular marker, characterized in that the primer pair has the nucleotide sequence shown in SEQ ID NO: 2-3.

[0010] The present invention also provides a kit for detecting the SNP molecular marker, characterized in that it contains the primer pair.

[0011] The use of the SNP molecular marker, the primer pair, or the kit in the breeding of mud crabs and their hybrid varieties (strains).

[0012] The present invention also provides a method for detecting the thickness of the left claw of *Scylla scutellaria*, characterized in that the thickness of the left claw of *Scylla scutellaria* is determined by detecting the SNP molecular marker in the *Scylla scutellaria* to be tested; preferably, the *Scylla scutellaria* includes *Scylla scutellaria* and its hybrid varieties or strains.

[0013] Furthermore, the left claw thickness trait of the tested *Scylla scutellaria* is determined by detecting the SNP molecular marker, including: extracting genomic DNA from the tested *Scylla scutellaria*; performing PCR amplification on the genomic DNA of the tested *Scylla scutellaria* using the primer pair to obtain PCR amplification products; sequencing the PCR amplification products to obtain sequencing results; determining the genotype of the SNP molecular marker of the tested *Scylla scutellaria* based on the sequencing results; and determining the left claw thickness trait of the tested *Scylla scutellaria* based on the genotype of the SNP molecular marker of the tested *Scylla scutellaria*.

[0014] Furthermore, the left cheliped thickness of individuals with the TT and CT genotypes of the SNP molecular marker was significantly higher than that of individuals with the CC genotype.

[0015] This invention also protects a method for genetic improvement of *Scylla scutellaria*, characterized in that the method comprises: selecting parental *Scylla scutellaria* individuals with the genotype TT or TC of the SNP molecular marker in the parental *Scylla scutellaria* population, and culling parental *Scylla scutellaria* individuals with the genotype CC of the SNP molecular marker, so as to increase the frequency of the allele T at this locus generation by generation, thereby improving the left claw thickness-related trait of offspring *Scylla scutellaria*; wherein the SNP molecular marker is the nucleotide sequence shown in SEQ ID NO: 1, with the 184th base from the 5' end being C or T.

[0016] The mud crabs described in this invention include mud crabs and their hybrid varieties or strains.

[0017] This invention relates to a molecular marker-assisted breeding technique for the left claw thickness trait in *Scylla scutellaria*. Research has revealed a key single nucleotide polymorphism (SNP) site at locus 6278173 on chromosome 40 of *Scylla scutellaria*, where a C>T mutation is closely associated with the left claw thickness trait. By verifying the impact of this SNP, we have successfully developed an efficient molecular marker-assisted selection method that can be precisely applied to the genetic improvement of parent *Scylla scutellaria*. This technique, by screening and preferentially selecting individuals carrying dominant alleles, can gradually increase the frequency of these dominant alleles in the population. As the frequency of dominant alleles increases, the left claw thickness trait of *Scylla scutellaria* will be significantly improved, thereby optimizing the individual phenotype. The application of this molecular marker-assisted breeding technique not only improves the genetic quality of *Scylla scutellaria* but also significantly enhances the economic benefits of parent breeding, bringing an innovative genetic improvement strategy to the *Scylla scutellaria* aquaculture industry.

[0018] This invention provides a primer pair for identifying the SNP molecular marker of the C>T mutation at position 6278173 on chromosome 40 of the mud crab, which is related to the thickness of the left claw. This primer pair can be used to establish an efficient and accurate molecular marker-assisted breeding technology, and to quickly and accurately select and improve the parent mud crab, thereby accelerating the breeding progress. Attached Figure Description

[0019] Figure 1 This is a Manhattan plot of genome-wide association analysis (GWAS) results for the C>T genotype at position 6278173 on chromosome 40 of the mud crab, obtained through GWAS, and its relationship to the thickness of the left claw. The x-axis represents the chromosome number of the mud crab, and the y-axis represents the -log10(P) value. Detailed Implementation

[0020] The embodiments of the present invention are described in detail below. Examples of these embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially.

[0021] Example 1: Determination of SNP molecular markers related to left chelicerae thickness trait

[0022] (1) Experimental animals: The mud crab samples were obtained from a farmed mud crab population of 356 individuals in Fuzhou, Fujian Province. Phenotypic data of the thickness of the left claw of each individual were measured and recorded using vernier calipers. The muscle tissue of the mud crabs was collected in cryovials, temporarily stored in liquid nitrogen, and then stored at -80°C for later use.

[0023] (2) DNA Extraction: Genomic DNA was extracted from the muscle tissue of each individual. The Takara Genomic DNA Extraction Kit was used to extract genomic DNA from the population samples; specific procedures were described in the instruction manual. DNA quality and concentration were measured using a spectrophotometer, and DNA samples were stored at -80°C for later use.

[0024] (3) Whole genome resequencing of mud crab (Scylla serrata):

[0025] DNA samples were sent to Beijing Novogene Technology Co., Ltd., where the whole genome of *Scylla serrata* was sequenced at 9× depth on the Illumina platform according to the company's standard paired-end sequencing method. The sequencing data were aligned using BWA software, and high-density SNP markers and short insertion / deletion mutations (Indels) were mined using GATK software, yielding 42,715,727 SNPs. The obtained SNP data were then quality controlled using Plink software with the following settings: mind 0.1, geno 0.1, maf 0.05, hwe 0.000001. The number of SNPs after quality control was 2,051,575.

[0026] (4) Genome-wide association (GWAS) analysis: To eliminate population stratification effects, this invention uses linear mixed model single-point regression analysis in GCTA software to perform GWAS analysis on the above-mentioned quality-controlled data. The Bonferroni method was used to determine the significance threshold of the association between SNPs and the left cheliped thickness trait. The genomic significance threshold was 0.05 divided by the number of effective SNP sites (the number of SNPs after filtering by the indep-pairwise parameter 50 10 0.2 in Plink software), that is, the genomic significance threshold was 5.58e-8, or 0.05 / 896055 (number of effective SNPs); the chromosome significance threshold was 1 divided by the number of effective SNP sites, that is, the chromosome significance threshold was 1.12e-6, or 1 / 896055 (number of effective SNPs). The GWAS analysis results are shown in the attached figure. There is a site on chromosome 40 of the mud crab that significantly affects the left claw thickness-related trait. The strongest associated SNP is the C>T mutation at position 6278173 on chromosome 40.

[0027] (5) Association analysis between different genotypes and the trait of left claw thickness: Results are shown in Figure 1 See Table 1. Figure 1 This is a Manhattan plot of genome-wide association analysis (GWIA) results for the C>T genotype at position 6278173 on chromosome 40 of the mud crab, obtained through genome-wide association analysis, and its relationship to left claw thickness. The Manhattan plot of the GWIA analysis shows the significance of the association between the SNP and the corresponding phenotype. The horizontal axis represents the chromosome number of the mud crab, and the vertical axis represents the -log10(P) value.

[0028] Table 1. Correlation between the C>T mutant genotype at position 6278173 on chromosome 40 and the thickness of the left cheliped.

[0029]

[0030] according to Figure 1 As shown in Table 1, the C>T mutation at position 6278173 on chromosome 40 was highly significantly correlated with the left claw thickness trait (P<0.001), indicating that this molecular marker can significantly affect the left claw thickness trait of *Scylla serrata*. Therefore, by selecting the C>T mutation site at position 6278173 on chromosome 40 of *Scylla serrata*, the left claw thickness trait in this population can be gradually improved, thereby accelerating the breeding process.

[0031] In addition, according to Figure 1 As shown in Table 1, the TT and CT genotypes exhibit greater left claw thickness than the CC genotype, indicating that TT and CT are advantageous for these traits. Eliminating CC genotype mud crab individuals to gradually increase the proportion of TT and CT genotype individuals in the population can bring greater economic benefits.

[0032] Example 2: A detailed description of the process of amplifying and sequencing the obtained target DNA sequence.

[0033] (1) The primer DNA sequences are designed as follows:

[0034] P001-F: 5'-AGCCTTGCGGTTGGTTTCCTTC-3' SEQ ID NO: 2;

[0035] P002-R: 5'-TGTTGATTCGTGTGTTGGTGTGTTTC-3' SEQ ID NO: 3.

[0036] (2) PCR amplification

[0037] To a 25 μL reaction mixture, add 1 μL of DNA template, 10.5 μL of double-distilled water, 12.5 μL of 2×Dream Taq Green PCR kit and Master mix (Thermofisher), and 0.5 μL each of primers P001-F and P002-R. The PCR reaction conditions were: 225℃ pre-denaturation for 5 min; 30 cycles of denaturation at 225℃ for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 30 s; and a final extension at 72℃ for 10 min.

[0038] (3) DNA sequencing

[0039] DNA sequence sequencing identification: Performed at Sangon Biotech Co., Ltd., the gene fragments were sequenced using a forward single reaction. The sequenced data were compared with the genomic sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:

[0040] AGCCTTGCGGTTGGTTTCCTTC TCGTGTCTAGAGTGTCGCCGCCAGCACAGCGCGAGTCGCCGCTCACCGTTGCACAAACAAAGGGAACAACACACCGGACACCTCATAAAGCATGGTCTTTTTATGCCCCAAGACTCAGGCAATGAGTGGCGGGTGCTGCGGCGGCGGGTAGCGGTGGAGTTY(C / T)GCGT GAAACACACCAACACACGAATCAACA SEQ ID NO:1.

[0041] Note: Y marked in the sequence listing represents the mutation site (C>T), and the underline at the beginning and end of the sequence indicates the location of the designed primer sequence.

[0042] Example 3: Verification of Farming Population

[0043] Using the aforementioned primer pairs P001-F and P002-R, molecular marker-based genotyping was performed on 46 six-month-old mud crabs farmed in Fuzhou, Fujian Province, at the SNP site g.6278173, where C>T was detected. The results showed that 22 cases were CT type and 24 cases were CC type. The left claw thickness of the CT type individuals was 2.62 mm greater than that of the CC type individuals, a result completely consistent with actual findings.

[0044] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention without departing from the principles and spirit of the present invention.

Claims

1. A SNP molecular marker related to the thickness of the left claw of the mud crab, characterized in that, The SNP molecular marker is shown in SEQ ID NO: 1, where the Y at position 184 from the 5' end is C or T.

2. The SNP molecular marker according to claim 1, characterized in that, The left claw thickness of individuals with the TT and CT genotypes of the SNP molecular markers was significantly higher than that of individuals with the CC genotype.

3. The SNP molecular marker according to claim 1 or 2, characterized in that, The term "pseudo-burrowing mud crab" includes pseudo-burrowing mud crab and its hybrid varieties or strains.

4. The use of the SNP molecular markers described in any one of claims 1-3 in the breeding of mud crabs and their hybrid varieties or strains.

5. A method for detecting the thickness of the left claw of the mud crab, characterized in that, The thickness of the left claw of the mud crab was determined by detecting any of the SNP molecular markers described in claims 1-3.

6. The method according to claim 5, characterized in that, The term "pseudo-burrowing mud crab" includes pseudo-burrowing mud crab and its hybrid varieties or strains.

7. The method according to claim 5, characterized in that, include: Genomic DNA was extracted from the mud crab to be tested; the extracted genomic DNA was amplified by PCR using primer pairs with the sequences shown in SEQ ID NO:2-3 to obtain PCR amplification products; The PCR amplification products were sequenced to obtain sequencing results; Based on the sequencing results, the genotype of the SNP molecular marker in the tested mud crab was determined; and based on the genotype of the SNP molecular marker in the tested mud crab, the left claw thickness trait of the tested mud crab was determined.

8. The method according to claim 5, characterized in that, The left claw thickness of individuals with the TT and CT genotypes of the SNP molecular markers was significantly higher than that of individuals with the CC genotype.

9. A method for genetic improvement of the mud crab *Scylla serrata*, characterized in that, The method includes: selecting parental mud crabs with genotypes TT and CT for the SNP molecular marker in a parental mud crab population, and culling parental mud crabs with genotype CC for the SNP molecular marker, in order to increase the frequency of the allele T at this locus generation by generation, thereby improving the left claw thickness-related trait of offspring mud crabs; the SNP molecular marker is shown in SEQ ID NO: 1, wherein the Y at position 184 from the 5' end is C or T.

Images