An InDel marker Pmct1 for cold tolerance at the bud stage of rice, and its identification method and application

By using the InDel marker Pmct1 for cold tolerance traits in rice budding stage and its identification method, PCR amplification and electrophoresis detection were employed to solve the problems of cumbersome and time-consuming identification process for cold tolerance traits in rice budding stage, achieving rapid and accurate detection results.

CN119799959BActive Publication Date: 2025-10-28CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510166379.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-14
Publication Date
2025-10-28
Estimated Expiration
2045-02-14

AI Technical Summary

Technical Problem

In the existing technology, the process of identifying the cold tolerance trait of rice during the bud stage is cumbersome and time-consuming, making it difficult to identify quickly and accurately in breeding practice.

Method used

The InDel marker Pmct1, representing the cold tolerance trait in rice germination, and its identification method were used. Specific primer sets (SEQ ID NO.3 and SEQ ID NO.4) were designed for PCR amplification and electrophoresis detection to distinguish between 143bp and 103bp bands to differentiate between cold-tolerant and cold-sensitive varieties.

Benefits of technology

It enables rapid and accurate identification of cold tolerance traits in rice buds within 2-3 hours, reducing costs and increasing detection throughput and specificity, making it suitable for rice breeding and production practices.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119799959B_ABST
    Figure CN119799959B_ABST
Patent Text Reader

Abstract

This invention discloses an InDel marker, Pmct1, for cold tolerance during rice budding, along with its identification method and applications, belonging to the field of molecular marker technology. This invention develops an InDel molecular marker by combining the insertion / deletion sequences of the Dongxiang wild rice introgression line D2 (background of the cold-tolerant rice 9311) and the cold-sensitive rice 9311 at the Chr1:32106831..32106871 locus in the O. sativa reference genome. Primers are then developed based on this molecular marker for identifying cold tolerance during rice budding. The detection cycle of this invention is only 2-3 hours, does not rely on subjective experience in traditional detection methods, and can obtain accurate and objective detection and identification results in a short time. It is low-cost, high-throughput, and highly specific, making it suitable for rice breeding and production practices.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to an InDel marker Pmct1 for cold tolerance during rice budding stage, its identification method, and its application. Background Technology

[0002] Chilling injury is a common abiotic stress in rice production, seriously affecting its stability and development. Therefore, solving the problem of chilling injury in rice is of great practical significance for global food security and promoting economic development in rice-producing areas. Studying the mechanisms of rice's cold tolerance and cultivating cold-resistant rice varieties are fundamental ways to solve the problem of low-temperature chilling injury in rice. With global climate change and the promotion of direct seeding technology, chilling injury during the germination stage has become a major stress restricting rice emergence rate. Therefore, predicting the cold tolerance traits during the germination stage in rice is crucial during variety breeding.

[0003] Currently, there are few reports on molecular markers for cold tolerance during the germination stage in rice. Determining this trait in a breeding material requires a lengthy and complex cultivation experiment, followed by phenotypic identification after harvest. This process takes at least 6-7 months and necessitates professional technical personnel for field propagation and laboratory phenotypic assessment, making it cumbersome and time-consuming. Therefore, in breeding practice, it is necessary to find a rapid method for identifying cold tolerance during the germination stage in rice. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide an InDel marker Pmct1 for cold tolerance traits in rice budding stage, as well as its identification method and application, so as to solve the technical problem of cumbersome and time-consuming process of identifying cold tolerance traits in rice budding stage.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is: to provide an InDel marker Pmct1 for cold tolerance during rice budding stage, characterized in that the primer sequence corresponding to Pmct1 is shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0006] This invention also discloses a method for identifying cold tolerance traits in rice during the germination stage, comprising the following steps:

[0007] S1. Extract genomic DNA from the sample to be tested;

[0008] S2. Use the primer set corresponding to Pmct1 to perform PCR amplification on genomic DNA and obtain PCR amplification products;

[0009] S3. Detect the PCR amplification products. If there is a band of 143bp in the amplification products, it indicates that the sample is a cold-resistant rice variety in the bud stage; if there is a band of 103bp in the amplification products, it indicates that the sample is a cold-sensitive rice variety in the bud stage.

[0010] Based on the above technical solution, the present invention can be further improved as follows:

[0011] Furthermore, the PCR amplification system consisted of: 5 μL of 2×Mix, 1 μL of F primer, 1 μL of R primer, 2 μL of template DNA, and 1 μL of double-distilled water.

[0012] Furthermore, the PCR amplification program was as follows: preheating at 95℃ for 5 min; 35 cycles: 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s; and a final extension at 72℃ for 5 min.

[0013] Furthermore, the detection steps in S3 are as follows: electrophoresis is performed using a 3-7% agarose gel at a constant voltage of 250V and 200A for 30 minutes.

[0014] This invention also discloses the application of the InDel marker Pmct1, representing the cold tolerance trait during the germination stage of rice, in the breeding of rice varieties with cold tolerance during the germination stage.

[0015] The beneficial effects of this invention are as follows:

[0016] 1. The detection cycle of the method of the present invention only requires 2-3 hours. It does not rely on the subjective experience of people in traditional detection. It can obtain accurate and objective detection and identification results in a short time. It is low in cost, high in throughput and high in specificity, and is suitable for rice breeding and production practice.

[0017] 2. The primers provided by this invention were used to identify rice varieties with different cold tolerance during the germination stage. The results showed that the PCR amplification product of rice with strong cold tolerance during the germination stage yielded a 143bp band after electrophoresis, while the PCR amplification product of cold-sensitive rice yielded a 103bp band after electrophoresis. This indicates that the primers designed in this invention can distinguish between rice varieties with different cold tolerance during the germination stage. Attached Figure Description

[0018] Figure 1 This is a graph showing the electrophoresis results of the PCR amplification products. Detailed Implementation

[0019] The specific embodiments of the present invention are described below to facilitate understanding of the invention by those skilled in the art. Unless otherwise specified, specific conditions are applied according to conventional conditions or the manufacturer's recommendations. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various modifications are obvious as long as they fall within the spirit and scope of the invention as defined and determined by the appended claims. All inventions utilizing the concept of this invention are protected.

[0020] Example 1: Development of the InDel marker Pmct1 and primers for identifying cold tolerance traits during rice germination.

[0021] Genomic DNA from materials such as Dongxiang wild rice and 9311 was resequencing using the Illumina platform to obtain raw sequencing data. Trimmomatic software was used for quality control of the raw sequencing data, removing low-quality data. BWA software was used to align the high-quality, valid data with a reference genome, detecting a large number of InDel sites. Based on the detected InDel sites, specific primers were designed, located flanking the insertion or deletion sites, and PCR amplification was used to demonstrate sequence length polymorphism.

[0022] Compared to the Dongxiang wild rice introgression line D2, which is based on the cold-tolerant seedling 9311, the cold-sensitive seedling 9311 has a 40 bp deletion at the Chr1:32106831..32106871 site in the O. sativa reference genome. Primers were designed flanking this deletion site. The sequence of the cold-tolerant seedling D2 is shown in SEQ ID NO.1, with a length of 143 bp; the sequence of the cold-sensitive seedling 9311 is shown in SEQ ID NO.2, with a length of 103 bp. It is hypothesized that the above molecular markers can be used to identify cold-tolerant and cold-sensitive rice seedlings. Based on the above sequence information, the cold tolerance trait during the seedling stage can be determined by detecting the bands by electrophoresis.

[0023] The Pmct1 molecular marker has 143 bases in the Dongxiang wild rice introgression line D2 (SEQ ID NO.1) with the background of the cold-resistant material 9311 at the bud stage, and 103 bases in the cold-sensitive material 9311 at the bud stage (SEQ ID NO.2). The 40 bp deletion of this molecular marker in the cold-sensitive material 9311 at the bud stage corresponds to the Chr1:32106831..32106871 site in the O. sativa reference genome.

[0024] The nucleotide sequence of the cold-resistant bud-growing material D2 is shown below:

[0025] GCCACCGTATAAAGCAGCTAGCTAG GGAACATTGTTCTGATTTATGACATGCACCAG CTAGCTAG CTAGACTGATATTTACTCCATCCATATATGTTTTCTTCATCCATCCTAAGATATA AAGCTGCTCCCTCTATCCGTGAA (SEQ ID NO.1), the underlined part is the base deletion sequence of the cold-sensitive material 9311 during the budding stage.

[0026] The nucleotide sequence of the cold-sensitive material 9311 during the budding stage is shown below:

[0027] GCCACCGTATAAAGCAGCTAGCTAGCTAGACTGATATTTACTCCATCCATATATGTTT TCTTCATCCATCCTAAGATATAAAGCTGCTCCCTCTATCCGTGAA (SEQ ID NO. 2).

[0028] Example 2: Identification of cold tolerance traits in rice during germination stage using Pmct1

[0029] Specifically, the following steps are included:

[0030] 1. Extracting genomic DNA from the rice samples to be tested

[0031] After rice seeds were cultured for 8 days until they showed signs of sprouting, leaves were collected and genomic DNA was extracted using a modified CTAB method.

[0032] 2. PCR amplification

[0033] Using the rice genomic DNA to be tested as a template, PCR amplification was performed using the following primer pairs to obtain the amplification products.

[0034] The primer sequences are as follows:

[0035] Forward primer: 5'-GCCACCGTATAAAGCAGCTAG-3' (SEQ ID NO.3);

[0036] Reverse primer: 5'-TTCACGGATAGAGGGAGCAG-3' (SEQ ID NO.4).

[0037] The PCR amplification system consisted of: 5 μL of 2×Mix, 1 μL of F primer, 1 μL of R primer, 2 μL of template DNA, and 1 μL of double-distilled water.

[0038] The PCR amplification program was as follows: preheating at 95℃ for 5 min; 35 cycles: 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s; and a final extension at 72℃ for 5 min.

[0039] 3. Electrophoretic identification

[0040] Add 5 μL of denaturing agent to the above PCR product, mix well, and then perform electrophoresis. The electrophoresis program is as follows: use a 5% agarose gel for electrophoresis at a constant voltage of 250 V and 200 A for 30 min. Detect the results using a gel imaging system. The electrophoresis results are shown below. Figure 1 As shown in Table 1, the sample information corresponding to the electrophoresis results is as follows.

[0041] Table 1 Sample Sources

[0042]

[0043] Depend on Figure 1 As can be seen from gel electrophoresis, two bands were observed at 143bp and 103bp. Cold-tolerant plants at the bud stage showed a 143bp band, while cold-sensitive plants at the bud stage showed a 103bp band. The band lengths were used to identify the cold tolerance and plant type of rice at the bud stage. The final identification results were: Pmct1-001, Pmct1-003, Pmct1-004, Pmct1-005, and Pmct1-007 were cold-tolerant rice varieties at the bud stage, while Pmct1-002 and Pmct1-006 were cold-sensitive rice varieties at the bud stage.

[0044] Example 3

[0045] To verify the accuracy of the identification results in Example 2, the cold tolerance of the germination period of the test samples Pmct1-001 to Pmct1-007 was identified. After drying, soaking, and germination treatment, seeds with consistent germination levels were selected and cold-treated in a 4℃ low-temperature incubator for 4 days, followed by 7 days of recovery growth. The survival rate was then calculated, and the identification results are shown in Table 2.

[0046] Table 2 Survival rate of the samples to be tested

[0047]

[0048] Table 2 shows that the survival rates of Pmct1-001, Pmct1-003, Pmct1-004, Pmct1-005, and Pmct1-007 were all above 50.0%, indicating that they are cold-resistant plants during the budding stage; the survival rates of Pmct1-002 and Pmct1-006 were below 30.0%, indicating that they are cold-sensitive plants during the budding stage. These results are consistent with the molecular marker identification results in Example 2, demonstrating that the molecular markers, primers, and identification methods disclosed in this invention can specifically identify the cold-resistant budding trait in rice, providing practical value for rice breeding.

Claims

1. A method for identifying cold tolerance traits in rice during the germination stage, characterized in that, Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Genomic DNA is amplified by PCR using the primer set corresponding to Pmct1 to obtain PCR amplification products; the primer set sequences corresponding to Pmct1 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; S3. Detect the PCR amplification products. If there is a band of 143bp in the amplification products, it indicates that the sample is a cold-resistant rice variety in the bud stage; if there is a band of 103bp in the amplification products, it indicates that the sample is a cold-sensitive rice variety in the bud stage.

2. The method for identifying cold tolerance traits in rice during the germination stage according to claim 1, characterized in that, The PCR amplification system consisted of: 5 μL of 2×Mix, 1 μL of F primer, 1 μL of R primer, 2 μL of template DNA, and 1 μL of double-distilled water.

3. The method for identifying cold tolerance traits in rice during the germination stage according to claim 1, characterized in that, The PCR amplification program was as follows: preheating at 95℃ for 5 min; 35 cycles: 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s; and a final extension at 72℃ for 5 min.

4. The method for identifying cold tolerance traits in rice during the germination stage according to claim 1, characterized in that, The detection steps in S3 are as follows: electrophoresis is performed using a 3-7% agarose gel at a constant voltage of 250V and 200A for 30 minutes.

Citation Information

Patent Citations

  • Primer combination for cold-tolerant genotyping of rice in whole growth period based on KASP technology and application

    CN112251534A

  • Stably expressed rice bud-stage cold-resistant QTL closely linked molecular markers and application thereof

    CN112410460A