An InDel marker Pmct3 for cold tolerance during rice germination, its identification method and application
By using the InDel marker Pmct3 for cold tolerance traits in rice budding stage and its identification method, PCR amplification and electrophoresis detection were employed to solve the problem of cumbersome and time-consuming identification process for cold tolerance traits in rice budding stage, achieving rapid and accurate identification results.
Patent Information
- Application Number
- CN202510166382.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-14
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2045-02-14
AI Technical Summary
The existing technology for identifying cold tolerance traits in rice bud stage is cumbersome and time-consuming, making it difficult to identify quickly and accurately in breeding practice.
The InDel marker Pmct3, representing the cold tolerance trait during rice germination, and its identification method were used. Specific primer sets were designed to amplify genomic DNA by PCR, and 88bp and 96bp bands were detected by agarose gel electrophoresis to distinguish between cold-tolerant and cold-sensitive rice varieties.
It enables rapid and accurate identification of cold tolerance traits in rice buds within 2-3 hours, reducing costs and increasing detection throughput, and is applicable to rice breeding and production practices.
Smart Images

Figure CN119799960B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker technology, specifically relating to an InDel marker Pmct3 for cold tolerance during rice budding stage, its identification method, and its application. Background Technology
[0002] Chilling injury is a common abiotic stress in rice production, seriously affecting its stability and development. Therefore, solving the problem of chilling injury in rice is of great practical significance for global food security and promoting economic development in rice-producing areas. Studying the mechanisms of rice's cold tolerance and cultivating cold-resistant rice varieties are fundamental ways to solve the problem of low-temperature chilling injury in rice. With global climate change and the promotion of direct seeding technology, chilling injury during the germination stage has become a major stress restricting rice emergence rate. Therefore, predicting the cold tolerance traits during the germination stage in rice is crucial during variety breeding.
[0003] Currently, there are few reports on molecular markers for cold tolerance during the germination stage in rice. Determining this trait in a breeding material requires a lengthy and complex cultivation experiment, followed by phenotypic identification after harvest. This process takes at least 6-7 months and necessitates professional technical personnel for field propagation and laboratory phenotypic assessment, making it cumbersome and time-consuming. Therefore, in breeding practice, it is necessary to find a rapid method for identifying cold tolerance during the germination stage in rice. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide an InDel marker Pmct3 for cold tolerance traits in rice budding stage, as well as its identification method and application, so as to solve the technical problem of cumbersome and time-consuming process of identifying cold tolerance traits in rice budding stage.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is: to provide an InDel marker Pmct3 for cold tolerance during rice germination, characterized in that the primer sequence corresponding to Pmct3 is shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0006] This invention also discloses a method for identifying cold tolerance traits in rice during the germination stage, comprising the following steps:
[0007] S1. Extract genomic DNA from the sample to be tested;
[0008] S2. Use the primer set corresponding to Pmct3 to perform PCR amplification of genomic DNA and obtain PCR amplification products;
[0009] S3. Detect the PCR amplification products. If there is an 88bp band in the amplification products, it indicates that the sample is a cold-resistant rice variety in the bud stage; if there is a 96bp band in the amplification products, it indicates that the sample is a cold-sensitive rice variety in the bud stage.
[0010] Based on the above technical solution, the present invention can be further improved as follows:
[0011] Furthermore, the PCR amplification system consisted of: 5 μL of 2×Mix, 1 μL of F primer, 1 μL of R primer, 2 μL of template DNA, and 1 μL of double-distilled water.
[0012] Furthermore, the PCR amplification program was as follows: preheating at 95℃ for 5 min; 35 cycles: 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s; and a final extension at 72℃ for 5 min.
[0013] Furthermore, the detection steps in S3 are as follows: electrophoresis is performed using a 3-7% agarose gel at a constant voltage of 250V and 200A for 30 minutes.
[0014] This invention also discloses the application of the InDel marker Pmct3, representing the cold tolerance trait during the germination stage of rice, in the breeding of rice varieties with cold tolerance during the germination stage.
[0015] The beneficial effects of this invention are as follows:
[0016] 1. The detection cycle of the method of the present invention only requires 2-3 hours. It does not rely on the subjective experience of people in traditional detection. It can obtain accurate and objective detection and identification results in a short time. It is low in cost, high in throughput and high in specificity, and is suitable for rice breeding and production practice.
[0017] 2. The primers provided in this invention were used to identify rice varieties with different cold tolerance during the germination stage. The results showed that the PCR amplification product of rice with strong cold tolerance during the germination stage yielded an 88bp band after electrophoresis, while the PCR amplification product of cold-sensitive rice yielded a 96bp band after electrophoresis. This indicates that the primers designed in this invention can distinguish between rice varieties with different cold tolerance during the germination stage. Attached Figure Description
[0018] Figure 1 This is a graph showing the electrophoresis results of the PCR amplification products. Detailed Implementation
[0019] The specific embodiments of the present invention are described below to facilitate understanding of the invention by those skilled in the art. Unless otherwise specified, specific conditions are applied according to conventional conditions or the manufacturer's recommendations. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various modifications are obvious as long as they fall within the spirit and scope of the invention as defined and determined by the appended claims. All inventions utilizing the concept of this invention are protected.
[0020] Example 1: Development of the InDel marker Pmct3 for identifying cold tolerance traits during rice germination stage
[0021] Genomic DNA from materials such as Dongxiang wild rice and 9311 was resequencing using the Illumina platform to obtain raw sequencing data. Trimmomatic software was used for quality control of the raw sequencing data, removing low-quality data. BWA software was used to align the high-quality, valid data with a reference genome, detecting a large number of InDel sites. Based on the detected InDel sites, specific primers were designed, located flanking the insertion or deletion sites, and PCR amplification was used to demonstrate sequence length polymorphism.
[0022] Compared to the Dongxiang wild rice introgression line D2, which is based on the cold-tolerant seedling 9311, the cold-sensitive seedling 9311 has an 8 bp base insertion between Chr1:28249918 and Chr1:28249919 sites in the O. sativa reference genome. Primers were designed on both sides of this deletion site. The sequence of the cold-tolerant seedling D2 is shown in SEQ ID NO.1, with a length of 88 bp; the sequence of the cold-sensitive seedling 9311 is shown in SEQ ID NO.2, with a length of 96 bp. It is hypothesized that these molecular markers can be used to identify cold-tolerant and cold-sensitive rice seedlings, and the cold tolerance trait during the seedling stage can be determined by detecting the bands via electrophoresis.
[0023] The Pmct3 molecular marker has 88 bases in the Dongxiang wild rice introgression line D2 (SEQ ID NO.1) with the background of the cold-resistant material 9311 during germination and 96 bases in the cold-sensitive material 9311 during germination. The molecular marker has an 8 bp insertion in the cold-sensitive material 9311 during germination between the Chr1:28249918 and Chr1:28249919 sites in the O. sativa reference genome.
[0024] The nucleotide sequence of the cold-resistant bud-growing material D2 is shown below:
[0025] CGAGGCTCTACACTACCATGAAAAAAACCAATACTTTTTTCGTAAGGACACCGCAC CCCGCGGCTCGGCCGGTCGAGTCGACTCGGAG (SEQ ID NO. 1).
[0026] The nucleotide sequence of the cold-sensitive material 9311 during the budding stage is shown below:
[0027] CGAGGCTCTACACTACCATGAAAAAAACCAATACTTTTTTCGTAAGG CGGGGCAC A CACCGCACCCCGCGGCTCGGCCGGTCGAGTCGACTCGGAG (SEQ ID NO.2), the underlined part is the base insertion sequence of the cold-sensitive material 9311 during the budding stage.
[0028] Example 2: Identification of cold tolerance traits in rice during germination stage using Pmct3
[0029] Specifically, the following steps are included:
[0030] 1. Extracting genomic DNA from the rice samples to be tested
[0031] After rice seeds were cultured for 8 days until they showed signs of sprouting, leaves were collected and genomic DNA was extracted using a modified CTAB method.
[0032] 2. PCR amplification
[0033] Using the rice genomic DNA to be tested as a template, PCR amplification was performed using the following primer pairs to obtain the amplification products.
[0034] The primer sequences are as follows:
[0035] Forward primer: 5'-CGAGGCTCTACACTACCATGAA-3' (SEQ ID NO.3);
[0036] Reverse primer: 5'-CTCCGAGTCGACTCGACCGGC-3' (SEQ ID NO.4).
[0037] The PCR amplification system consisted of: 5 μL of 2×Mix, 1 μL of F primer, 1 μL of R primer, 2 μL of template DNA, and 1 μL of double-distilled water.
[0038] The PCR amplification program was as follows: preheating at 95℃ for 5 min; 35 cycles: 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s; and a final extension at 72℃ for 5 min.
[0039] 3. Electrophoretic identification
[0040] Add 5 μL of denaturing agent to the above PCR product, mix well, and then perform electrophoresis. The electrophoresis program is as follows: use a 5% agarose gel for electrophoresis at a constant voltage of 250 V and 200 A for 30 min. Detect the results using a gel imaging system. The electrophoresis results are shown below. Figure 1 As shown in Table 1, the sample information corresponding to the electrophoresis results is as follows.
[0041] Table 1 Sample Sources
[0042]
[0043]
[0044] Depend on Figure 1 As can be seen from gel electrophoresis, two bands were observed at 88bp and 96bp. Cold-tolerant plants at the budding stage showed an 88bp band, while cold-sensitive plants at the budding stage showed a 96bp band. The band lengths were used to identify the cold tolerance and plant type of rice at the budding stage. The final identification results were: Pmct3-001, Pmct3-003, Pmct3-006, and Pmct3-007 were cold-tolerant rice varieties at the budding stage, while Pmct3-002, Pmct3-004, and Pmct3-005 were cold-sensitive rice varieties at the budding stage.
[0045] Example 3
[0046] To verify the accuracy of the identification results in Example 2, the cold tolerance of the germination period of the test samples Pmct3-001 to Pmct3-007 was identified. After drying, soaking, and germination treatment, seeds with consistent germination levels were selected and cold-treated in a 4℃ low-temperature incubator for 4 days, followed by 7 days of recovery growth. The survival rate was then calculated, and the identification results are shown in Table 2.
[0047] Table 2 Survival rate of the samples to be tested
[0048]
[0049] Table 2 shows that the survival rates of Pmct3-001, Pmct3-003, Pmct3-006, and Pmct3-007 were all above 50.0%, indicating that they are cold-resistant plants during the budding stage; the survival rates of Pmct3-002, Pmct3-004, and Pmct3-005 were below 30.0%, indicating that they are cold-sensitive plants during the budding stage. These results are consistent with the molecular marker identification results in Example 2, demonstrating that the molecular markers, primers, and identification methods disclosed in this invention can specifically identify the cold-resistant budding trait in rice, providing practical value for rice breeding.
Claims
1. A method for identifying cold tolerance traits in rice during the germination stage, characterized in that, Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Genomic DNA is amplified by PCR using the primer set corresponding to Pmct3 to obtain PCR amplification products; the primer set sequences corresponding to Pmct3 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; S3. Detect the PCR amplification products. If there is an 88bp band in the amplification products, it indicates that the sample is a cold-resistant rice variety in the bud stage; if there is a 96bp band in the amplification products, it indicates that the sample is a cold-sensitive rice variety in the bud stage.
2. The method for identifying cold tolerance traits in rice during the germination stage according to claim 1, characterized in that, The PCR amplification system consisted of: 5 μL of 2×Mix, 1 μL of F primer, 1 μL of R primer, 2 μL of template DNA, and 1 μL of double-distilled water.
3. The method for identifying cold tolerance traits in rice during the germination stage according to claim 1, characterized in that, The PCR amplification program was as follows: preheating at 95℃ for 5 min; 35 cycles: 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s; and a final extension at 72℃ for 5 min.
4. The method for identifying cold tolerance traits in rice during the germination stage according to claim 1, characterized in that, The detection steps in S3 are as follows: electrophoresis is performed using a 3-7% agarose gel at a constant voltage of 250V and 200A for 30 minutes.
Citation Information
Patent Citations
Molecular marker of cold-tolerant gene CTES11b in rice bud stage and application of molecular marker
CN115961078A
KR20240098236A