A molecular marker closely linked to wheat scab resistance qtl-qfHB7a.1 and application thereof

By constructing natural wheat populations and designing PARMS marker primers, the problem of difficult analysis of wheat scab resistance genes was solved, enabling efficient and low-cost resistance screening and improving the selection efficiency and accuracy of breeding.

CN119799966BActive Publication Date: 2025-12-12INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510198627.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-23
Publication Date
2025-12-12
Estimated Expiration
2045-02-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently analyzing resistance genes in wheat scab, resulting in poor agronomic traits in resistant materials during breeding, making them difficult to utilize effectively.

Method used

By constructing 240 natural wheat populations, genotyping was performed using a 90K SNP chip, and association analysis was conducted using GEMMA v0.98 software. QTL sites located at bases 78, 665, and 700 on wheat chromosome 7A were identified, and PARMS marker primers were designed for detection, achieving efficient screening for wheat scab resistance.

Benefits of technology

This method enables efficient screening for resistance to wheat scab, improves selection efficiency and accuracy, explains 6.1%–7.0% of the phenotypic variation, simplifies the detection method, and reduces costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005282367250000041
    Figure BDA0005282367250000041
  • Figure BDA0005282367250000051
    Figure BDA0005282367250000051
  • Figure BDA0005282367250000061
    Figure BDA0005282367250000061
Patent Text Reader

Abstract

The application belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker closely linked with a wheat scab resistance QTL-qFHB7A.1 and application. qFHB7A.1 Further, the peak SNP closely linked with the scab resistance site is located at the 78,665,700th base of the 7A chromosome of the Chinese spring reference genome, and can explain 6.1%-7.0% of the phenotypic variation rate. The PARMS marker designed by using the SNP is used for genotype detection of 96 materials, and it is found that the operation is simple and the typing is clear, and the wheat scab has a good selection effect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology and genetic breeding, and particularly relates to a molecular marker closely linked to a wheat scab resistance QTL-qFHB7A.1 and application thereof. BACKGROUND

[0002] Wheat scab is a fungal disease of wheat caused by Fusarium graminearum, which often occurs in areas with warm and humid climates. In epidemic years, scab can cause severe yield reduction of wheat; meanwhile, the scab-affected wheat kernels contain deoxynivalenol (DON toxin), which not only endangers human and animal health, but also seriously affects the edible and feeding values. Therefore, the occurrence of scab can cause serious economic losses to wheat production. Although chemical control can play a certain role in years when the disease is not serious, it is easy to cause environmental pollution. Therefore, analyzing the genetic mechanism of scab resistance and breeding new wheat varieties resistant to scab is the most economical and effective means to prevent and control scab.

[0003] Studies have shown that wheat scab resistance is a quantitative trait controlled by multiple genes. Due to the complexity of resistance and the fact that its phenotypic identification is easily affected by environmental conditions, the research on wheat scab resistance gene mining and molecular mechanism has been slow. At present, wheat germplasm with good resistance to scab has been found in the United States, Japan, Brazil and Switzerland, and the scab resistance loci located based on these germplasms are almost distributed on each chromosome of wheat, but most of the gene loci have small effect values. Wheat landraces Su Mai 3 and Wangshuibai from Jiangsu Province of China are recognized as materials with high resistance to scab in the world so far; a major gene locus Fhb1 located on 3BS is located in both of the two materials. In 2019, Professor Ma Zhengqiang's team of Nanjing Agricultural University and Professor Bai Guihua's team of Kansas State University in the United States cloned the Fhb1 gene, which encodes a histidine-rich calcium-binding protein TaHRC.

[0004] Although Su Mai 3 and other landraces have strong resistance to scab, they are difficult to use in breeding due to the presence of unfavorable linkage, and other agronomic traits are poor. Therefore, mining new scab-resistant materials and resistance-related gene loci is an important aspect of wheat scab resistance breeding.

[0005] The present application uses a 240-portion wheat natural population to detect QTLs of scab in multiple environments, aiming to find new QTL loci with improvement effects on wheat scab, and to develop practical high-throughput and low-cost molecular markers accordingly, which are used for selecting wheat scab resistance. SUMMARY

[0006] The application aims to provide application of a reagent for detecting base 78,665,700 on chromosome 7A of wheat in screening and breeding of wheat scab resistance.

[0007] The application aims to provide application of a reagent for detecting base 78,665,700 on chromosome 7A of wheat in screening and breeding of wheat scab resistance.

[0008] The application aims to provide application of a reagent for detecting base 78,665,700 on chromosome 7A of wheat in screening and breeding of wheat scab resistance.

[0009] In order to achieve the above-mentioned purposes, the application adopts the following technical measures:

[0010] Obtaining of a molecular marker closely linked to wheat scab resistance QTL-qFHB7A.1

[0011] (1) A population of 240 wheat varieties (lines) at home and abroad was used to conduct scab inoculation identification in the South Lake test field of Hubei Academy of Agricultural Sciences from 2014 to 2016 for three consecutive years, and the pathogenic strain was Huanggang No. 1.

[0012] (2) The 240 wheat populations were subjected to genotype analysis by using a 90K SNP chip, and markers with a deletion rate of more than 20% and a minimum allele frequency of less than 5% were removed, and a total of 19,803 SNPs were used for GWAS.

[0013] (3) The genotype and phenotype data of the above-mentioned 240 populations were used to perform correlation analysis by using a mixed linear model of GEMMA v0.98 software. When P≤0.001, it was considered that the marker was significantly correlated with the trait.

[0014] (4) Correlation analysis found that the anti-scab locus located on chromosome 7A of wheat was significant under the BLUE environment in 2014, and explained 6.1%-7.0% of the phenotypic variation, and the representative correlation marker was RAC875_c28842_99. The physical position on the reference genome sequence of the wheat variety Zhongnongchun was 78.7 Mb. In three environments, the average FHB index of the material containing the disease-resistant allele was 13.2%-15.9% lower than that of the material containing the disease-susceptible allele.

[0015] (5) According to the principle of primer design, the sequences of the detection primers of the PARMS marker are obtained based on the nucleotide sequences of the positions before and after the peak SNP marker RAC875_c28842_99 closely linked to qFHB7A.1, and are as follows: PFHB7A-F: TGGATAAGATCTTTGAACTTCCCA; PFHB7A-Ra: GAAGGTGACCAAGTTCATGCTGAGATGCCATGCCCTCCA; and PFHB7A-Rc: GAAGGTCGGAGTCAACGGATTGAGATGCCATGCCCTCCC. The protection scope of the present application includes:

[0016] The reagent for detecting the base at position 78,665,700 on the 7A chromosome of wheat is applied in the screening breeding of the resistance to wheat scab.

[0017] The reagent for detecting the base at position 78,665,700 on the 7A chromosome of wheat is applied in the preparation of a kit for screening the resistance to wheat scab.

[0018] In the above-mentioned application, if the base at position 78,665,700 on the wheat is T, it is determined that the wheat is resistant to scab.

[0019] In the above-mentioned application, if the base at position 78,665,700 on the wheat is G, it is determined that the wheat is susceptible to scab.

[0020] In the above-mentioned application, the reagent is preferably a primer.

[0021] In the above-mentioned primer, the primer is preferably a PARMS detection primer, and more preferably the primer provided by the present application: PFHB7A-F: TGGATAAGATCTTTGAACTTCCCA; PFHB7A-Ra: GAAGGTGACCAAGTTCATGCTGAGATGCCATGCCCTCCA; and PFHB7A-Rc: GAAGGTCGGAGTCAACGGATTGAGATGCCATGCCCTCCC.

[0022] A method for screening and breeding the resistance to wheat scab, comprising detecting the base at position 78,665,700 on the 7A chromosome of wheat by using a conventional scheme in the art, wherein the conventional scheme includes but is not limited to sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0023] The version number of the wheat Chinese Spring genome used in the present application is IWGSC RefSeq v1.0, and the website is https: / / www.wheatgenome.org / .

[0024] Compared with the prior art, the present application has the following advantages:

[0025] (1) The present application obtains the wheat scab QTL site qFHB7A.1, which can be repeatedly detected, and can explain 6.1%-7.0% of the phenotypic variation rate.

[0026] (2) The present application obtains the PARMS marker closely linked to qFHB7A.1, which has a simple and low-cost detection method, and can improve the selection efficiency and accuracy of wheat scab resistance screening. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 Figure 1 is the frequency distribution of scab phenotypes of 240 wheat natural populations in three environments.

[0028] Figure 2 Figure 2 is the difference in scab phenotypes of qFHB7A.1 sites with different genotypes in three environments and BLUE.

[0029] Figure 3 Figure 3 is the genotyping results of the PARMS marker in 96 materials DETAILED DESCRIPTION

[0030] The technical solutions described in the present application are all conventional technologies in the art unless otherwise specified; the reagents or materials described are all from commercial channels unless otherwise specified. The version number of the wheat Chinese Spring genome used in the present application is IWGSC RefSeq v1.0, https: / / www.wheatgenome.org / .

[0031] Example 1:

[0032] SNP molecular marker closely linked to wheat scab resistance QTL-qFHB7A.1:

[0033] Test materials: WAPS (Wheat Association Panel for Scab research) population composed of 240 wheat varieties (lines) at home and abroad. The materials used are described in the literature: Zhu Zhanwang, Xu Deng'an, Cheng Shunhe, et al. Identification and tracing of Chinese wheat varieties resistant to stripe rust gene Fhb1 [J]. Acta Agronomica Sinica, 2018, 44(4): 473-482.

[0034] (1) Fusarium head blight resistance identification: The identification of Fusarium head blight resistance was conducted in the South Lake Experimental Field of Hubei Academy of Agricultural Sciences from 2014 to 2016. The pathogenic strain was Huanggang No. 1. The test was designed by complete randomized block design, 2-row plot, row length 1 m, row spacing 0.25 m, 2 times of repetition, and spray inoculation. Twenty days after inoculation, the number of diseased spikes, the number of spikelets per spike, and the number of diseased spikelets per spike were investigated. The FHB index was calculated by the formula: FHB index = incidence rate x severity, wherein the incidence rate was the ratio of the number of diseased spikes to the total number of spikes, and the severity was the average of the ratio of the number of diseased spikelets per spike to the number of spikelets per spike, both in percentage. Then the BLUE value of FHB index in three years was calculated. Figure 1 ).

[0035] (2) Genotype analysis: The 240 wheat populations were subjected to genotype analysis by 90K SNP chip, and 22922 SNPs with good typing results were selected for subsequent analysis. The markers with a missing rate of more than 20% and a minimum allele frequency of less than 5% were removed, and a total of 19803 SNPs were used for GWAS.

[0036] (3) GWAS analysis: The mixed linear model of GEMMA v0.98 software was used for association analysis. When P≤0.001, it was considered that the marker was significantly associated with the trait.

[0037] (4) Obtaining qFHB7A.1 and its associated SNP markers: The association analysis found that the Fusarium head blight resistance locus was located on chromosome 7A, which was significant in 2014 and BLUE, and explained 6.1%-7.0% of the phenotypic variation. The representative associated marker was RAC875_c28842_99, and its flanking sequence was: 5'- ATCCCCATGGTAAAATCCTGCGGCTTGGCCGTCGAGATGCCATGCCCTCC[A / C]GTCACTGACTATTGGGAAGTTCAAAGATCTTATCCACGCTT GCGTGCTGA-3'. The physical position on the wheat variety Chinese Spring reference genome sequence (IWGSC, http: / / www.wheatgenome.org) was 584.9 Mb (Table 1). In three environments, the average FHB index of the material containing the disease-resistant allele was 15.5%-35.7% lower than that of the material containing the disease-susceptible allele Figure 2 ).

[0038] Table 1 qFHB4A.1 and its associated SNP markers

[0039]

[0040] Example 2

[0041] Development of a PARMS marker tightly linked to scab disease in wheat

[0042] According to the principle of primer design, the detection primer sequence of the PARMS marker is obtained as follows based on the nucleotide sequences of the front and rear positions of the peak SNP marker RAC875_c28842_99 tightly linked to qFHB7A.1:

[0043] PFHB7A-F: TGGATAAGATCTTTGAACTTCCCA;

[0044] PFHB7A-Ra: GAAGGTGACCAAGTTCATGCT GAGATGCCATGCCCTCCA;

[0045] PFHB7A-Rc: GAAGGTCGGAGTCAACGGATT GAGATGCCATGCCCTCCC.

[0046] The method for detecting the genotype of the qFHB7A.1 locus in the wheat to be tested by using the above PARMS primer set is as follows:

[0047] (1) Extract the genomic DNA of the wheat to be tested.

[0048] (2) Prepare the reaction system. The reaction system is 5 μL, including 2.5 μL 2xPARMS PCR reaction mix (product of Wuhan Jingpeibiotech Co., Ltd.), primer PFHB7A-F, primer PFHB7A-Ra, primer PFHB7A-Rc aqueous solution, DNA and water. In the reaction system, the concentration of primer PFHB7A-Ra and primer PFHB7A-Rc is 150 nM, and the concentration of primer PFHB7A-F is 400 nM.

[0049] (3) Add 5 μL of mineral oil (to prevent sample evaporation) to the reaction system, and then perform PCR amplification.

[0050] The reaction program is as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, with a decrease of 0.8℃ per cycle until 57℃, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 32 cycles.

[0051] (4) After step (3) is completed, perform signal reading on TECAN Infinite M1000, and then make the following judgments: if blue is displayed, the corresponding wheat is or is suspected to be scab-susceptible; if green is displayed, the corresponding wheat is or is suspected to be scab-resistant.

[0052] Using the above primers, the genotypes of E' en 1 and Xining 9871 were detected. In the scab-resistant wheat E' en 1, the sequence amplified by the primer is:

[0053] TGGATAAGATCTTTGAACTTCCCAATAGTCAGTGACTGGAGGGCATGGCATCTC.

[0054] In the scab-sensitive wheat Xining 9871, the sequence amplified by the primer is:

[0055] TGGATAAGATCTTTGAACTTCCCAATAGTCAGTGACGGGAGGGCATGGCATCTC.

[0056] Example 3:

[0057] Universality of the PARMS marker in the selection of wheat scab resistance:

[0058] Using the PARMS primer set and experimental method designed in Example 2, the genotypes of 96 wheat varieties (collected by the applicant) were typed. The results showed that among the above 96 wheat varieties (lines), there were 76 materials with blue color, indicating that the genotype TT was detected; there were 15 materials with green color, indicating that the genotype GG was detected; if the color was red, it indicated that the genotype TG was detected, and there was 1 material; if the color was gray, it indicated that the genotype could not be detected, and there were 4 materials (Table 2, Figure 3 ).

[0059] According to the method described in Example 1, the scab inoculation identification was carried out in the South Lake test field of Hubei Academy of Agricultural Sciences from 2014 to 2016 for three consecutive years, and the FHB index was calculated, and then the BLUE value of FHB index of three years was calculated.

[0060] The results showed that the scab resistance of TT genotype wheat was higher than that of GG genotype, and the difference of FHB index was 13.6%, reaching a significant level (Table 2).

[0061] Table 2 Phenotypes of two genotypes of the PARMS marker qFHB7A.1 in 96 wheat varieties

[0062]

[0063]

Claims

1. The use of a reagent for detecting the 37th base of the polynucleotide shown in SEQ ID NO. 1 in the selection breeding of wheat scab resistance; if a homozygote of T is detected at the 37th base of the polynucleotide shown in SEQ ID NO. 1, the wheat is determined to be scab-resistant wheat; if a homozygote of G is detected at the 37th base of the polynucleotide shown in SEQ ID NO. 1, the wheat is determined to be scab-sensitive wheat.

2. The use of a reagent for detecting the 37th base of the polynucleotide shown in SEQ ID NO. 1 in the preparation of a wheat scab resistance screening kit; if a homozygote of T is detected at the 37th base of the polynucleotide shown in SEQ ID NO. 1, the wheat is determined to be scab-resistant wheat; if a homozygote of G is detected at the 37th base of the polynucleotide shown in SEQ ID NO. 1, the wheat is determined to be scab-sensitive wheat.

3. Use according to claim 1 or 2, characterized in that: The reagent is a primer.

4. The use according to claim 3, wherein the primer is PFHB7A-F: TGGATAAGATCTTTGAACTTCCCA, PFHB7A-Ra: GAAGGTGACCAAGTTCATGCTGAGATGCCATGCCCTCCA, and PFHB7A-Rc: GAAGGTCGGAGTCAACGGATTGAGATGCCATGCCCTCCC.

5. A method for screening and breeding wheat scab resistance, comprising detecting the 37th base of the polynucleotide shown in SEQ ID NO. 1, wherein the method is sequencing, TaqMan probe, AS-PCR, molecular beacon, high-resolution melting curve, CAPS, SNaPshot, KASP, PARMS, gene chip, or mass spectrometry; if a homozygote of T is detected at the 37th base of the polynucleotide shown in SEQ ID NO. 1, the wheat is determined to be scab-resistant wheat; if a homozygote of G is detected at the 37th base of the polynucleotide shown in SEQ ID NO. 1, the wheat is determined to be scab-sensitive wheat.

Citation Information

Patent Citations

  • Molecular marker for detecting anti-scab QTL (quantitative trait loci) Qfhb.hbaas-5AS and application method of molecular marker

    CN109797241A

  • Markers for fusarium head blight (FHB) disease resistance

    US6197518B1