Primer and probe combination for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3 as well as detection method and application of primer and probe combination

Abstract

The invention provides a primer and probe combination for simultaneously detecting bovine adenovirus 3 and bovine parainfluenza virus 3 as well as a detection method and application of the primer and probe combination, and belongs to the technical field of fluorescent quantitative PCR (polymerase chain reaction) detection. Specific primers and probes are designed according to the Hexon gene sequence of the bovine adenovirus 3 and the N gene sequence of the bovine parainfluenza virus 3, whether infection of two viruses exists in a sample or not is identified at the same time through multiple fluorescent quantitative PCR, the detection time is shortened, and the primer and the probe have important significance on prevention of bovine epidemic viruses. Meanwhile, the multiple primer probe group and the detection method disclosed by the invention are high in sensitivity and good in specificity, have the characteristics of rapidness, practicability, low cost and simplicity and convenience in operation, and can meet the detection requirements on the two bovine susceptible viruses, namely the bovine adenovirus type 3 and the bovine parainfluenza virus type 3.

Description

Technical Field

[0001] The present invention relates to the technical field of fluorescence quantitative PCR detection, and in particular to a primer and probe combination for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3, and a detection method and application thereof. Background Art

[0002] Bovine adenovirus type 3 (BAdV-3) belongs to the family Adenoviridae and the genus Adenovirus of mammals. Epidemiological surveys have found that BAdV-3 is very common in cattle herds at home and abroad, and the positive rate of cattle in some pastures is as high as over 90%. BAdV-3 is mainly transmitted through the respiratory tract or digestive tract, and the virus mainly attacks blood vessels, especially capillaries, venous endothelial cells and epithelial cells. Calves aged 1 to 4 weeks are susceptible to this disease, which manifests as pneumonia, diarrhea, pneumoenteritis, conjunctivitis and polyarthritis, usually with fever, and the incidence rate is as high as 70% to 80%. Bovine parainfluenza virus type 3 (BPIV-3) can cause bovine parainfluenza and acute respiratory disease. Infected animals show characteristics such as high fever, dyspnea and cough, and severe cases can lead to death of cattle. In cattle production practice, BAdV-3 is often co-infected with BPIV3, which together constitute the bovine respiratory disease complex (BRDC). And because the symptoms of infection are similar, it increases the difficulty of accurate diagnosis. In order to prevent and control the diseases caused by these two viruses in a timely manner, rapid and accurate detection methods are particularly important.

[0003] However, currently the detection of these two pathogens is usually carried out separately. The existing detection technology requires complex conditions and a high level of professional skills from the technicians, and it takes a long time, which makes it difficult to meet the detection needs under farm conditions. Summary of the invention

[0004] In view of this, the present invention provides a primer and probe combination for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3, and a detection method and application thereof, so as to solve the problem of long time required for separate detection of the two pathogens.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a primer and probe combination for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3, and the primer and probe combination is as follows:

[0007] Primer and probe combination for detecting bovine adenovirus type 3, including:

[0008] A forward primer of the nucleic acid sequence shown in SEQ ID NO: 1;

[0009] A reverse primer of the nucleic acid sequence shown in SEQ ID NO:2;

[0010] A probe of the nucleic acid sequence shown in SEQ ID NO:3;

[0011] Primer and probe combination for detecting bovine parainfluenza virus type 3, including:

[0012] A forward primer of the nucleic acid sequence shown in SEQ ID NO:4;

[0013] A reverse primer of the nucleic acid sequence shown in SEQ ID NO:5;

[0014] A probe for the nucleic acid sequence shown in SEQ ID NO:6.

[0015] Preferably, the 5' end of the nucleic acid sequence shown in SEQ ID NO:3 is connected to the CY5 fluorescent gene, and the 3' end is connected to the BHQ1 quenching group; the 5' end of the nucleic acid sequence shown in SEQ ID NO:6 is connected to the Texas Red fluorescent gene, and the 3' end is connected to the BHQ1 quenching group.

[0016] The present invention provides the use of the primer-probe combination in at least one of the following:

[0017] (1) Detecting whether the virus to be tested is bovine adenovirus type 3 or bovine parainfluenza virus type 3;

[0018] (2) preparing a kit for detecting whether the virus to be tested is bovine adenovirus type 3 or bovine parainfluenza virus type 3;

[0019] (3) detecting whether the sample to be tested contains bovine adenovirus type 3 and / or bovine parainfluenza virus type 3;

[0020] (4) preparing a kit for detecting whether a sample to be tested contains bovine adenovirus type 3 and / or bovine parainfluenza virus type 3;

[0021] The application is for non-disease diagnosis purposes.

[0022] The present invention also provides a kit for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3, comprising the primer-probe combination.

[0023] The present invention also provides a multiplex fluorescence quantitative PCR method for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3, comprising the following steps:

[0024] Using the cDNA of the virus in the sample to be tested as a template, the primer-probe combination is used for amplification. If the primer-probe combination for detecting bovine adenovirus type 3 shows positive amplification, the sample to be tested contains bovine adenovirus type 3; if the primer-probe combination for detecting bovine parainfluenza virus type 3 shows positive amplification, the sample to be tested contains bovine parainfluenza virus type 3;

[0025] The detection is for non-disease diagnosis purposes.

[0026] Preferably, the reaction system of multiplex fluorescence quantitative PCR is: 2×All-Powerful qPCRPreMix 10 μL, upstream and downstream primers for detecting bovine adenovirus type 3 0.4 μL, probe 0.4 μL; upstream and downstream primers for detecting bovine parainfluenza virus type 3 0.8 μL, probe 0.4 μL, DNA template 2 μL, ddH2O supplemented to 20 μL.

[0027] Preferably, the reaction procedure of the multiplex fluorescence quantitative PCR is: contamination digestion at 37°C for 2 min; pre-denaturation at 95°C for 30 s; denaturation at 95°C for 10 s, annealing at 56°C for 30 s, and 40 cycles.

[0028] In the present invention, during the qPCR reaction, the qPCR instrument monitors the changes in the fluorescence signal in real time. After the qPCR reaction is completed, the fluorescence signal data is analyzed according to the software analysis software provided by the qPCR instrument to obtain the Ct value of each reaction well. A standard curve of bovine adenovirus type 3 and bovine parainfluenza virus type 3 is constructed according to the Ct value. The smaller the Ct value, the higher the content of viral nucleic acid in the sample, and the greater the possibility of viral infection. The amplification curve CT value less than 35 is judged as positive, and the CT value greater than 35 and less than 40 is judged as negative, and the test needs to be repeated. If the second test is still in this interval, it is judged as positive.

[0029] By adopting the above technical solution, the present invention has the following beneficial effects:

[0030] 1. High efficiency: One reaction can detect two viruses at the same time, greatly shortening the detection time and reducing the detection cost. Compared with traditional multiple single tests, it can save time and cost.

[0031] 2. High sensitivity and accuracy: By optimizing the design of primers and probes, the detection ability of low viral load samples has been improved. It has been experimentally verified that it can detect samples as low as 10 3 The virus can be detected at a rate of 99.99% copies / μL with an accuracy of over 99.99%, which effectively reduces missed detections and is beneficial to disease prevention and control.

[0032] 3. Easy to operate: The operating procedures are standardized, and the technical requirements for operators are relatively low, which makes it easy to promote and use at the grassroots level. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the melting curve of the first pair of primers for BAdV-3.

[0034] Figure 2 This is the melting curve of the second pair of primers for BAdV-3.

[0035] Figure 3 This is the melting curve of the first pair of primers for BPIV-3.

[0036] Figure 4 This is the melting curve of the first pair of primers for BPIV-3.

[0037] Figure 5 This is the amplification curve of BAdV-3 in the single-plex fluorescence quantitative PCR experiment.

[0038] Figure 6 This is the amplification curve of BPIV-3 in the quantitative PCR experiment.

[0039] Figure 7 This is the standard curve of BAdV-3 in single-plex fluorescence quantitative PCR experiment.

[0040] Figure 8 This is the standard curve of BPIV-3 in single-plex fluorescence quantitative PCR experiment.

[0041] Fig. 9 Figure 2 shows the amplification curves of BAdV-3 and BPIV-3 at different concentrations of BAdV-3 and BPIV-3 standards. From left to right, 10 8 -10 3 copies / μL.

[0042] Fig.10 This is the amplification curve of BAdV-3 in the multiplex fluorescence quantitative PCR experiment.

[0043] Fig.11 This is the amplification curve of BPIV-3 in the multiplex fluorescence quantitative PCR experiment.

[0044] Fig.12 This is the standard curve of BAdV-3 in multiplex fluorescence quantitative PCR experiments.

[0045] Fig.13 This is the standard curve of BPIV-3 in multiplex fluorescence quantitative PCR experiments.

[0046] Fig.14 The concentrations of BAdV-3 and BPIV-3 standards were 1.0×10 8 copies / μL~1.0×10 1 Standard curve at 100 copies / μL.

[0047] Fig.15 The concentrations of BAdV-3 and BPIV-3 standards were 1.0×10 8 copies / μL~1.0×10 2 Standard curve at 100 copies / μL.

[0048] Fig.16 The concentrations of BAdV-3 and BPIV-3 standards were 1.0×10 8 copies / μL~1.0×10 3 Standard curve at 100 copies / μL.

[0049] Fig.17 The concentrations of BAdV-3 and BPIV-3 standards were 1.0×10 8 copies / μL~1.0×10 3 Amplification curves at 10 copies / μL, red for BPIV-3, purple for BAdv-3, and from left to right for 10 8 -10 3 copies / μL.

[0050] Fig.18 This is the amplification curve of the specificity experiment. DETAILED DESCRIPTION

[0051] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0052] In the embodiments of the present invention, the TB Green Premix EX TaqvII (Tli RNaseHPlus) reagent used for the verification primer was purchased from Takara Company with the item number RR820; the single fluorescence quantitative Premix Ex Taq (Probe qPCR) reagent was purchased from Takara Company with the item number RR390; the multiple fluorescence quantitative BioSmartU + All-PowerfulMultiple ProbeqPCRPreMix (ONE TUBE) reagent was purchased from Nanjing Novezan Biotechnology Co., Ltd., with the catalog number QN222. The brands of fluorescent PCR instrument are LightCycler 96, a product of Roche, Switzerland; FX 96 Real-Time System, a product of Bio-Rad, USA.

[0053] Example 1. Primer and probe design

[0054] The gene sequences of BAdV-3 and BPIV3 viruses were downloaded from the GenBank website, and the sequences were aligned using molecular biology software. Based on the design principles of fluorescent quantitative PCR primers and probes, the Hexon gene of bovine adenovirus type 3 and the N gene of bovine parainfluenza virus type 3 were selected to design upstream and downstream primers and probes for BAdV-3 and BPIV3 viruses.

[0055] The first pair of primers and probes for detecting bovine adenovirus type 3 are as follows:

[0056] Upstream primer BAdV-3-F: CGGAGGAGACAACAATGATTTGC (SEQ ID NO. 7);

[0057] Downstream primer BAdV-3-R: GCTTGGACAATGGTTGCCATG (SEQ ID NO. 8);

[0058] Probe BAdV-3-P:

[0059] 5'-Texas Red-TGTGAATGAGCGCCAGCAACCCGTG-BHQ1-3' (SEQ ID NO. 9);

[0060] The second pair of primers and probes for detecting bovine adenovirus type 3 are as follows:

[0061] Upstream primer BAdV-3-F: TTGCAAATGGGTGTGAATGAG (SEQ ID NO. 1);

[0062] Downstream primer BAdV-3-R: GCCTTCAATGCCGAGTTGAGG (SEQ ID NO. 2);

[0063] Probe BAdV-3-P:

[0064] 5'-CY5-TGTGAATGAGCGCCAGCAACCCGTG-BHQ1-3' (SEQ ID NO. 3);

[0065] The first pair of primers and probes for detecting bovine parainfluenza virus type 3 are as follows:

[0066] Upstream primer BPIV-3-F: CTGGTGGAGCTGTTATTCCTGG (SEQ ID NO. 10);

[0067] Downstream primer BPIV-3-R: GTGCATGCTGCTTCTCATTATCT (SEQ ID NO. 11);

[0068] Probe BPIV-3-P:

[0069] 5'-CY5-CACAGTCTCTATATTTGCCCTTGGTCCC-BHQ1-3' (SEQ ID NO. 12);

[0070] The second pair of primers and probes for detecting bovine parainfluenza virus type 3 are as follows:

[0071] Upstream primer BPIV-3-F: ACAAGACGGGACAGTCAAAT (SEQ ID NO. 4);

[0072] Downstream primer BPIV-3-R: GTCTCGACCATAAGCGTAACC (SEQ ID NO. 5);

[0073] Probe BPIV-3-P:

[0074] 5'-Texas Red-CACAGTCTCTATATTTGCCCTTGGTCCC-BHQ1-3' (SEQ ID NO. 6).

[0075] The two pairs of primers were subjected to SBRY fluorescence quantitative PCR to observe the melting curve. The reaction system was: 10 μL of TB Green Premix Ex Taq II (Tli RNaseH Plus), 0.8 μL of upstream and downstream primers, 2 μL of template, and sterile enzyme-free water to 20 μL. The reaction procedure was: pre-denaturation at 95°C for 30 s; PCR quantitative analysis at 95°C for 5 s, 60°C for 30 s, 40 cycles; dissolution at 95°C for 5 s, 60°C for 1 min, 95°C for 0 s; cooling at 50°C for 30 s.

[0076] Curve like Figure 1 , Figure 2 , Figure 3 and Figure 4 As shown, the first pair of primers for both viruses had dimers, which did not meet the requirements, so the second pair of primers was used.

[0077] Example 2. Construction of standard plasmid

[0078] The Hexon gene of bovine adenovirus type 3 and the N gene sequence of bovine parainfluenza virus type 3 were synthesized by Qingke Biotechnology Co., Ltd. and used as the standard plasmid.

[0079] OQ594952.1 Bovine adenovirus type 3 Hexon gene, CDS sequence:

[0080] ATGGTCCTACTGCACATCGCCGGTCAGGACGCGTCCGAGTACCTGTCCCCCGGCTTGGTGCAATTCGCACAAGCCACCGAATCCTACTTTAACATTGGGAACAAGTTTAGAAACCCCACCGTCGCCCCGACGCACGATGTCACCACGGAGCGTTCGCAGCGTCTGCAGCTCCGCTTCGTGCCCGTAGACCGGGAGGACACACAGTACTCCTACAAAACCCGCTTCCAGCTAGCCGTGGGCGACAACCGGGTGCTGGACATGGCCAGCACGTATTTTGACATCCGCGGTACGCTGGACAGGGGTGCCAGTTTCAAGCCTTACAGCGGCACGGCCTACAACTCCTTTGCCCCCAAGAGTGCCCCTAATAACACTCAGTACAGGCAGGCCGACAACGGTCACCCGGCTCAGACGATAGCTCAAGCTTCTTACGTGGCTACCATCGGAGGAGACAACAATGATTTGCAAATGGGTGTGAATGAGCGCCAGCAACCCGTGTACGCCAATACTTCGTACCAGCCGGAACCTCAACTCGGCATTGAAGGCTGGACAGCTGGATCCATGGCAACCATTGTCCAAGCAGGAGGGCGAGTTCTTAAAAACACCACTCAAACTCCCTGCTACGGCTCGTACGCTAAGCCCACCAACGAACACGGGGGAATTACTAAAGCTGGCACTCAGGTGGAAAGGAAGTACTACAGGACAGGAGACAATGGCAACCCTGAAACAGTGTTTTATGCTGAAGAGGCGGACGTGCTAACTCCCGATACCCACTTAGTTCATGCGGTACCGGCTGCAGATAGGGCAAAGGTGGACGGCTTGTCACAGCATGCAGCTCCCAACAGGCCGAACTTCATCGGCTTTCGGGACTGCTTTGTGGGTTTGATGTATTA(SEQ ID NO.13).

[0081] OM621819.1 Bovine parainfluenza virus type 3 N gene, CDS sequence:

[0082] ATGTTGAGTCTGTTTGATACATTCAGTGCACGCAGGCAGGAAAACATAACCAAATCAGCTGGTGGAGCTGTTATTCCTGGGCAAAAGAACACAGTCTCTATATTTGCCCTTGGTCCCTCAATAACAGATGACAATGATAAAATGACATTAGCTCTCCTGTTCTTATCTCACTCACTAGATAATGAGAAGCAGCATGCACAAAGGGCTGGATTTTTAGTCTCCTTGCTATCCATGGCTTATGCTAACCCAGAATTATACCTAACATCAAATGGTAATAATGCAGATGTCAAGTATGTTATCTATATGATAGAAAAAGACTCAGGGAGACAAAAATACGGTGGCTTAGTTGTTAAGACTAGGGAAATGGTTTATGAGAAGACAACTGATTGGATGTTTGGAAGTGATCTTGAGTATGATCAAGATAATATGTTACAGAATGGTAGGAGCACCTCCACAATTGAAGATCTTGTTCACACATTTGGGTATCCAGCATGTCTTGGAGCTCTCATAATCCAGATTTGGATAATACTTGTTAAAGCTATAACCAGTATCTCAGGATTGAGAAAAGGTTTTTTTACCCGATTAGAGGCATTTAGACAAGACGGGACAGTCAAATCCAGTCTGGTATTAAGTGGAGATGCAGTAGAGCAGATCGGATCGATCATGAGGTCTCAGCAAAGTTTGGTTACGCTTATGGTCG9AGACACTGATAACAATGAACACAGGAAG GAATGATCTGACAACGATAGAGAAGAACATACAAATTGTAGGAAACTACATAAGAGATGCAGGCCTTGCTTCATTCTTTAATACAATCAGATATGGTATTGAAACCAGAATGGCAGCTCTAACATTGTCTACTCTTAGACCAGACATCAACAGACTCAAAGCATTAATAGAGTTATACCTATCAAAGGGGCCACGTGCCCCTTTTATATGTATTTTAAGGGATCCTATTCATGGCGAGTTTGCACCAGGTAATTATCCTGCT(SEQ IDNO.14).

[0083] According to the instructions of the gel recovery kit (Nanjing Novozyme Biotechnology Co., Ltd.), the cut target band was gel recovered, and the recovered target fragment was connected to the pMD-19T (purchased from Takara's official website) vector to prepare the plasmid, and the plasmid was transformed into the competent Escherichia coli DH5α, and the single colonies with successful transfection were coated and screened. The colonies were picked and shaken for PCR identification of the bacterial solution. The plasmid was extracted according to the instructions of the plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd.) to extract the plasmid from the positive bacterial solution. The plasmids were sequenced and aligned, and they could be used after verification, and were named pMD-19T-BAdV-3 and pMD-19T-BPIV-3 respectively.

[0084] The circular plasmid was digested, the concentration of the linear plasmid was determined, and the initial plasmid copy number was calculated and used as the standard. The concentrations of the bovine adenovirus type 3 standard and the bovine parainfluenza virus type 3 standard were 1×10 9 copies / μL.

[0085] Example 3. Single-plex PCR experiment

[0086] In order to verify whether there is non-specific amplification of primers, optimize the reaction conditions, and determine the optimal primer and probe concentrations, six groups of single-plex PCR experiments were designed using bovine adenovirus type 3 standard plasmid and bovine parainfluenza virus type 3 standard plasmid as templates. The reaction systems are shown in Group A to Group F in Table 1. The concentration gradient of the DNA template is 1×10 8 -10 1 copies / μL, and a standard curve was drawn based on 8 concentration gradients in each group.

[0087] Table 1 Original reaction system of single-plex real-time fluorescence quantitative PCR method

[0088]

[0089] The single-plex fluorescence quantitative PCR reaction program is: 95°C for 30s; 95°C for 5s, 60°C for 30s, 45 cycles; 50°C for 30s.

[0090] After amplification, the amplification curves of BAdV-3 and BPIV-3 were obtained, respectively. Figure 5 , Figure 6 The standard curve is drawn with the logarithmic value of the starting copy number of the standard as the horizontal axis and the corresponding Ct value as the vertical axis, as shown in Figure 7 , Figure 8 shown.

[0091] The results showed that when the final concentration of the primers and probes was 0.2 μM, the single fluorescence quantitative R2 When the final concentration of the BSV primer was 0.4 μM and the probe was 0.2 μM, the single fluorescence quantitative R 2 It is 0.9722, indicating that when bovine adenovirus type 3 plasmid is used as template for amplification, the reaction system shown in group B is the best amplification system; when bovine parainfluenza virus type 3 plasmid is used as template for amplification, the reaction system shown in group A is the best amplification system.

[0092] Example 4. Multiplex qPCR Experiment

[0093] Mix the bovine adenovirus type 3 standard plasmid and the bovine parainfluenza virus type 3 standard plasmid in equal volumes, and then dilute the mixed plasmids to 1×10 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL and 1×10 1 copies / μL (the above concentration is the mixed plasmid concentration), and then the mixed plasmids of the above concentrations are used as templates to amplify according to the reaction system in Table 2.

[0094] Table 2 Reaction system of multiplex real-time fluorescence quantitative PCR method

[0095]

[0096] After the amplification was completed, the dual amplification curve and the amplification curves of BAdV-3 and BPIV-3 were obtained, respectively. Fig. 9 , 10 , 11. The standard curve is drawn with the logarithmic value of the starting copy number of the standard as the horizontal axis and the corresponding Ct value as the vertical axis, as shown in Fig.12 and Fig.13 shown.

[0097] The results showed that the minimum detection template concentration (mixed plasmid concentration) was 1×10 3 copies / μL, when the annealing temperature was 56℃, dual fluorescence quantitative bovine adenovirus type 3 R 2 0.9965; bovine parainfluenza virus type 3 R 2 It is 09968.

[0098] Example 5. Sensitivity experiment

[0099] (1) Dilute the BAdV-3 and BPIV-3 standard plasmids to 1.0×10 8 copies / μL~1.0×10 1 copies / μL, multiple fluorescence quantitative PCR amplification was performed, and the reaction system and reaction procedure were the same as in Example 4. After the amplification was completed, a standard curve was drawn, such as Fig.14 The results showed that the BAd V-3 correlation coefficient (R 2 ) is 0.9113, and the linear relationship expression is y=2.3504x+14.227; BPI V-3 correlation coefficient (R 2 ) is 0.9414, and the linear relationship expression is y=2.3608x+14.145.

[0100] (2) Dilute the BAdV-3 and BPIV-3 standard plasmids to 1.0×10 8 copies / μL~1.0×10 2 copies / μL, multiple fluorescence quantitative PCR amplification was performed, and the reaction system and reaction procedure were the same as in Example 4. After the amplification was completed, a standard curve was drawn, such as Fig.15 The results showed that the BAd V-3 correlation coefficient (R 2 ) is 0.9633, and the linear relationship expression is y=2.7646x+12.984; BPI V-3 correlation coefficient (R 2 ) is 0.9802, and the linear relationship expression is y=2.7125x+13.09.

[0101] (3) Dilute the BAdV-3 and BPIV-3 standard plasmids to 1.0×10 8 copies / μL~1.0×10 3 copies / μL, multiple fluorescence quantitative PCR amplification was performed, and the reaction system and reaction procedure were the same as in Example 4. After the amplification was completed, a standard curve was drawn, such as Fig.16 The results showed that the BAd V-3 correlation coefficient (R 2 ) is 0.9972, and the linear relationship expression is y=3.17x+11.903; the BPIV-3 correlation coefficient (R 2 ) is 0.9963, and the linear relationship expression is y=2.99x+12.35.

[0102] The above sensitivity experiments showed that the standard plasmid concentration of BAdV-3 and BPIV-3 was 1.0×10 8 copi es / μL~1.0×10 3When the fluorescence quantitative PCR detection method of the present invention is between 0.01% and 0.02%, the amplification curve is as follows: Fig.17 shown.

[0103] Example 6. Specificity Experiment

[0104] The constructed BAdV-3 and BPIV-3 plasmid standards were diluted 10-fold and mixed in equal volumes, and then diluted to a mixed plasmid concentration of 1×10 6 The plasmid standard of 1000 copies / μL was used as the standard positive control, and sterile enzyme-free water was used as the negative control. Then, the standard plasmids of bovine rotavirus, bovine viral diarrhea virus, bovine enteropathogenic Escherichia coli, Salmonella and Staphylococcus aureus were used as templates. The plasmid standards containing BAdV-3 and BPIV-3 and the standard plasmids of five viruses, namely, bovine rotavirus, bovine viral diarrhea virus, bovine enteropathogenic Escherichia coli, Salmonella and Staphylococcus aureus, were used as templates, and the multiplex fluorescence quantitative PCR method established in Example 4 was used to perform fluorescence quantitative PCR amplification reaction, and its specific amplification curve and Ct value were observed. The results are shown in FIG. Fig.18 shown.

[0105] The results showed that only the reaction system containing samples, probes and primers containing BAdV-3 and BPIV-3 could produce amplification curves, while other samples did not show amplification curves, indicating that the established multiplex fluorescence quantitative PCR detection method has good specificity.

[0106] Example 7. Real sample detection

[0107] The samples were collected from cattle farms in Zhangjiachuan Hui Autonomous County, Baiyin City, Honggu District and other areas of Tianshui City, Gansu Province. The samples to be tested included 248 samples of bovine serum, nasopharyngeal swabs, fecal swabs and lymphatic tissue samples. The virus culture method was first used to detect 15 samples carrying bovine adenovirus type 3 and 9 samples carrying bovine parainfluenza virus type 3. At the same time, the detection primers and detection methods of the present invention were used to detect the above samples, and the detection results are shown in Table 3.

[0108] Table 3. Test results of real samples

[0109]

[0110] As can be seen from the above examples, the present invention provides primers, probe combinations and detection methods and applications thereof for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3. The multiplex fluorescence quantitative PCR detection method of the present invention can simultaneously identify whether bovine adenovirus type 3 and bovine parainfluenza virus type 3 are present in a sample, with a detection rate of more than 95%. It also has the characteristics of high sensitivity and strong specificity, and is of great significance for the prevention of bovine epidemic viruses.

[0111] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer and probe combination for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3, characterized in that: The primer-probe combination is as follows: Primer and probe combination for detecting bovine adenovirus type 3, including: A forward primer of the nucleic acid sequence shown in SEQ ID NO: 1; A reverse primer of the nucleic acid sequence shown in SEQ ID NO:2; A probe of the nucleic acid sequence shown in SEQ ID NO:3; Primer and probe combination for detecting bovine parainfluenza virus type 3, including: A forward primer of the nucleic acid sequence shown in SEQ ID NO:4; A reverse primer of the nucleic acid sequence shown in SEQ ID NO:5; A probe for the nucleic acid sequence shown in SEQ ID NO:

6.

2. The primer-probe combination according to claim 1, characterized in that: The 5' end of the nucleic acid sequence shown in SEQ ID NO:3 is connected to the CY5 fluorescent gene, and the 3' end is connected to the BHQ1 quenching group; the 5' end of the nucleic acid sequence shown in SEQ ID NO:6 is connected to the TexasRed fluorescent gene, and the 3' end is connected to the BHQ1 quenching group.

3. Use of the primer-probe combination according to claim 1 or 2 in at least one of the following: (1) Detecting whether the virus to be tested is bovine adenovirus type 3 or bovine parainfluenza virus type 3; (2) preparing a kit for detecting whether the virus to be tested is bovine adenovirus type 3 or bovine parainfluenza virus type 3; (3) detecting whether the sample to be tested contains bovine adenovirus type 3 and / or bovine parainfluenza virus type 3; (4) preparing a kit for detecting whether a sample to be tested contains bovine adenovirus type 3 and / or bovine parainfluenza virus type 3; The application is for non-disease diagnosis purposes.

4. A kit for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3, characterized in that: Comprising the primer-probe combination of claim 1 or 2.

5. A multiplex fluorescence quantitative PCR method for simultaneously detecting bovine adenovirus type 3 and bovine parainfluenza virus type 3, characterized in that: The following steps are involved: Using the cDNA of the virus in the sample to be tested as a template, amplification is performed using the primer-probe combination of claim 1 or 2. If the primer-probe combination for detecting bovine adenovirus type 3 shows positive amplification, the sample to be tested contains bovine adenovirus type 3; if the primer-probe combination for detecting bovine parainfluenza virus type 3 shows positive amplification, the sample to be tested contains bovine parainfluenza virus type 3; The detection is for non-disease diagnosis purposes.

6. The multiplex fluorescence quantitative PCR method according to claim 5, characterized in that: The reaction system of the multiplex fluorescence quantitative PCR is: 10 μL of 2×All-Powerful qPCRPreMix, 0.4 μL of upstream and downstream primers for detecting bovine adenovirus type 3, and 0.4 μL of probe; 0.8 μL of upstream and downstream primers for detecting bovine parainfluenza virus type 3, and 0.4 μL of probe, 2 μL of DNA template, and ddH2O supplemented to 20 μL.

7. The multiplex fluorescence quantitative PCR method according to claim 5, characterized in that: The reaction procedure of the multiplex fluorescence quantitative PCR is: contamination digestion at 37°C for 2 min; pre-denaturation at 95°C for 30 s; denaturation at 95°C for 10 s, annealing at 56°C for 30 s, and 40 cycles.

Images