Bimetallic SERS (Surface Enhanced Raman Scattering) nanoprobe based on biological silence region as well as preparation method and application thereof

Abstract

The invention discloses a bimetal SERS (Surface Enhanced Raman Scattering) nano probe based on a biological silence region as well as a preparation method and application of the bimetal SERS nano probe. According to the sensor, AuNS (at) 4-MBN (at) Ag-aptamer is adopted as the nano probe, and Fe3O4 (at) AuNPs-cDNA (FA-cDNA) is adopted as a magnetic substrate. In the sensor, an FA-cDNA (complementary deoxyribonucleic acid) and AuNS (at) 4-MBN (at) Ag-aptamer form an FA-cDNA-aptamer-AuNS (at) 4-MBN (at) Ag magnetic complex through a base complementary pairing effect. The SERS sensor established by the bimetal nanoprobe in the'biological silence 'region has important practical application significance in trace CPF detection in a complex matrix environment.

Description

Technical Field

[0001] The present invention relates to the field of materials, and in particular to a bimetallic SERS nanoprobe based on a "biological silent" zone, and a preparation method and application thereof. Background Art

[0002] Chlorpyrifos (CPF) is an organophosphorus pesticide widely used in agricultural pest control. It can disrupt nerve conduction and effectively eliminate pests by inhibiting cholinesterase activity. However, the abuse of CPF has caused serious environmental and health problems, including harm to non-target organisms and human neurotoxicity and genotoxicity through ingestion. Various countries and regions have imposed strict regulations on CPF, setting maximum residue limits (MRLs) or prohibition regulations. Several analytical techniques have been applied for CPF detection, such as gas chromatography tandem mass spectrometry (GC-MS), high performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay, and fluorescence spectroscopy. Although traditional methods have excellent sensitivity and accuracy, they are limited by high cost, large equipment size, and low flexibility. Therefore, it is crucial to develop an economical, rapid, sensitive, and accurate method for on-site supervision of agricultural product safety.

[0003] SERS has been increasingly studied in the fields of food safety, environmental monitoring, plant physiology research, and biological cell imaging due to its advantages such as low reagent consumption, high cost performance, molecular fingerprint recognition characteristics, and high SERS signal response mediated by "hot spots". Through the combination of recognition elements such as nucleic acid aptamers, immune antibodies, and specific chemicals with various SERS substrates (nanospheres, nanoflowers, nanostars, and nanowires), its continuous improvement has significantly enhanced its ability to accurately identify and ultrasensitively detect trace substances. However, practical applications still face challenges, especially the interference of complex organic components on the detection of target substances. It is necessary to explore a SERS signal probe that takes into account both the sensitivity to the target substance and the interference with the organic background.

[0004] In recent years, indirect detection using SERS probes has gained favor in the analysis of ultra-trace substances. Sensitive and anti-interference SERS nanotags usually use noble metal nanomaterials with optimal surface plasmon properties, specific recognition elements and suitable signal molecules as tags. Attaching reporter molecules with large Raman scattering cross sections to the surface of SERS nanomaterials can significantly amplify the Raman signal response. The detection process relies on the signal response of the SERS tag to the target molecule, rather than the inherent fingerprint of the target molecule. "Molecular fingerprint" reporter molecules such as 4-MBA, DTNB and PMBA were selected because they have stable chemical structures, wide Raman scattering cross sections, and strong adhesion to the surface of nanoparticles through the interaction of thiol groups with Au and Ag. However, the Raman characteristic peaks of most reporter molecules are located in the range of 600 to 1800 cm -1Therefore, in the “biological silence” zone (1800-2800cm -1 ) The application of molecules such as 4-mercaptobenzonitrile (4-MBN), Prussian blue, and 4-ethylbenzenethiol derivatives with Raman characteristic signal peaks is favored, which is conducive to avoiding complex organic background interference. Among them, 4-MBN can form stable covalent bonds with Au and Ag, and its nitrile group and benzene ring have a large Raman scattering cross section. In addition, it has a strong Raman scattering cross section at 2228cm -1 There is a stable Raman characteristic signal at the site. Although a series of label molecules with similar properties to 4-MBN have been developed and explored, the related applications are still very limited. Attaching "bio-silent" region Raman reporter labels on noble metal nanoparticles with high Raman enhancement activity is one of the promising and important strategies to reduce complex organic background interference. Summary of the invention

[0005] In view of the above-mentioned technical problems, the present invention provides a bimetallic SERS nanoprobe based on a "biological silent" zone and a preparation method and application thereof.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The preparation method of the bimetallic SERS nanoprobe based on the "biological silent" zone, the steps of the method are as follows:

[0008] (1) Preparation of bimetallic SERS nanoprobes in the “biologically silent” zone: 4-mercaptobenzonitrile (4-MBN) was loaded on the surface of gold nanostars (AuNSs) via Au-S bonds; AuNS@4-MBN@Ag was synthesized by ascorbic acid (AA) reduction method; and chlorpyrifos (CPF) aptamer was loaded on the surface of AuNS@4-MBN@Ag via Ag-S bonds to prepare AuNS@4-MBN@Ag-aptamer.

[0009] (2) Preparation of magnetic substrate: synthesizing magnetic Fe3O4 as the core material of the magnetic substrate; preparing Fe3O4@PEI and then Fe3O4@AuNPs (FA) by layer-by-layer electrostatic self-assembly method; loading aptamer complementary chain (cDNA) on the surface of AuNPs through Au-S bond to achieve the preparation of FA-cDNA;

[0010] (3) The "biologically silent" zone bimetallic SERS nanoprobe prepared in step (1) is mixed and incubated with the magnetic substrate FA-cDNA prepared in step (2) to obtain a SERS sensor based on the "biologically silent" zone reporter molecule.

[0011] In the above preparation method, the synthesis method of Au seeds is to heat the HAuCl4·3H2O solution to boiling, quickly add the sodium citrate solution to the boiling solution, continue heating and stirring for 10 to 30 minutes, and obtain the Au seeds solution;

[0012] The synthesis method of AuNSs is to heat the HAuCl4·3H2O solution to 20-40°C while stirring, then add the Auseeds solution, and then add the sodium citrate solution and the hydroquinone solution in sequence; after stirring, centrifuge and finally disperse in deionized water to obtain the AuNSs solution;

[0013] The synthesis method of AuNS@4-MBN@Ag-aptamer includes the following steps:

[0014] (1) Add 4-MBN solution to AuNSs solution and mix well, then add Triton-X-100 solution and mix well again before centrifugation;

[0015] (2) The precipitate obtained after centrifugation was dispersed in the AuNPs solution in deionized water, and ascorbic acid AA solution and AgNO3 solution were added in sequence under ultrasound, and then Tween-20 solution was added and stirred again and centrifuged, and the precipitate was dispersed in PBS solution to obtain AuNS@4-MBN@Ag solution;

[0016] (3) The AuNS@4-MBN@Ag solution was incubated with CPF aptamer, then centrifuged to remove unbound aptamer, and finally resuspended in PBS solution to obtain AuNS@4-MBN@Ag-aptamer solution.

[0017] In the technical solution of the present invention: the preparation method of FA-cDNA comprises the following steps:

[0018] The Fe3O4 nanoparticles are uniformly dispersed in the PEI solution by ultrasonication, and the Fe3O4@PEI nanoparticles obtained after washing are resuspended in deionized water to obtain a Fe3O4@PEI nanoparticle solution; the AuNPs solution and the Fe3O4@PEI nanoparticle solution are then mixed and washed and dried to obtain Fe3O4@AuNPs(FA);

[0019] The FA solution and cDNA solution were incubated in PBS for 3 to 5 hours, and the washed precipitate was resuspended to obtain a FA-cDNA solution with a concentration of 0.2 to 1 mg / mL.

[0020] In the above preparation method, in the synthesis method of Au seeds: the mass concentration of HAuCl4·3H2O solution is 0.01-0.03%, the mass concentration of sodium citrate solution is 0.5-1.5%, and the volume ratio of HAuCl4·3H2O solution to sodium citrate solution is 100:1-10;

[0021] In the method for synthesizing AuNSs: the mass concentration of HAuCl4·3H2O solution is 0.01-0.03%, the mass concentration of sodium citrate solution is 0.5-1.5%, and the concentration of hydroquinone solution is 20-50 mM;

[0022] The volume ratio of HAuCl4·3H2O solution, Au seeds solution, sodium citrate solution and hydroquinone solution is 95-105:1-5:1-5:10-30;

[0023] In the synthesis method of AuNS@4-MBN@Ag-aptamer:

[0024] In step (1), the concentration of 4-MBN solution is 1-10 mM, and the mass concentration of Triton-X-100 is 0.5-1.5%;

[0025] The volume ratio of 4-MBN solution, AuNSs solution and Triton-X-100 solution was 5-15:1000:5-15;

[0026] In step (2), the concentration of AA solution is 10-80 mM, the concentration of AgNO3 solution is 10-80 mM, the mass concentration of Tween-20 is 0.5-1.5%; the concentration of AuNPs solution is 50-150 μg / mL;

[0027] The volume ratio of AuNPs solution, AA solution, AgNO3 solution, Tween-20 solution and PBS solution was 1000:5-15:5-15:5-15:1000;

[0028] In step (3), the volume ratio of AuNS@4-MBN@Ag solution, CPF aptamer solution and PBS solution is 1000:30-80:1000;

[0029] The concentration of the CPF aptamer solution is 0.5 to 1.5 μM.

[0030] In the above preparation method: the mass ratio of Fe3O4 nanoparticles and PEI is 1:1-8; the concentration of Fe3O4@PEI nanoparticle solution is 2-3 mg / mL; the concentration of AuNPs solution is 50-150 μg / mL; the volume ratio of AuNPs solution and Fe3O4@PEI nanoparticle solution is 2-6:1.

[0031] In the above preparation method: the concentration of FA solution is 0.2-1 mg / mL, the concentration of cDNA is 0.5-5 μM, and the volume ratio of FA solution to cDNA solution is 5-15:1.

[0032] In the above preparation method: in step (3), the volume ratio of FA-cDNA solution to AuNS@4-MBN@Ag-aptamer solution is 1:1-5.

[0033] In the above preparation method: aptamer, 5′-SH-(CH2)6-CCTGCCACGCTCCGCAAGCTTAGGGTTA CGCCTGCAGCGATTCTTGATCGCGCTGCTGGTAATCCTTCTTTAAGCTTGGCACCCGC ATCGT-3′;

[0034] cDNA, 5′-SH-(CH2)6-ACGATGCGGGTGCCAAGCTTAAAGAAGGAT-3′.

[0035] A bimetallic SERS nanoprobe based on the "biological silent" zone is prepared by the method described above.

[0036] In the technical solution of the present invention, the bimetallic SERS nanoprobe based on the "biological silent" zone prepared by the method has good application prospects in the precise and rapid quantitative analysis of harmful substances in complex food and environmental matrices.

[0037] Establishment of the standard song

[0038] First, a 1 mg / mL CPF acetonitrile solution was diluted with a 10% ethanol solution to different concentrations. Subsequently, 20 μL CPF was added to 1 mL AuNS@4-MBN@Ag-aptamer and gently shaken for 30 min. Subsequently, 0.5 mL FA-cDNA was added to the mixture and shaken at 37 °C for 30 min. The magnetic hybrid was washed twice with deionized water by an external magnet and then dispersed in 0.5 mL deionized water. 2228 cm was recorded at a laser power of 264.5 mW and an integration time of 1 s. -1 The Raman signal intensity at .

[0039] Relative Raman intensity calculation formula: y = ΔI = (I 2228 cm -1 )0-(I 2228 cm -1 ), where (I 2228cm -1 )0 and (I2228cm -1 ) represents the blank group and the test group at 2228cm -1 Raman intensity.

[0040] According to the formula, C CPF Linear relationship with y: y = k LgC CPF +b, where k and b are the slope and intercept of the standard curve, respectively.

[0041] SERS detection of CPF in real samples

[0042] (1) Wheat analysis

[0043] 2 g of wheat was mixed with 5 mL of deionized water and 5 mL of acetonitrile, and then ground thoroughly in a mortar. The slurry was filtered through a double-layer gauze, centrifuged at 12000 rpm for 8 min, and then filtered through a 0.22 μm filter. Different concentrations of CPF were added to the wheat samples for SERS detection.

[0044] (2) Apple Analysis

[0045] 20 g of fresh tissue was chopped and homogenized in a fruit crusher. The obtained apple juice was centrifuged at 12000 rpm for 8 min and filtered using a 0.22 μm filter. Different concentrations of CPF were added to the apple juice samples for SERS detection.

[0046] Beneficial effects of the present invention:

[0047] (1) The present invention prepares a high-performance surface enhanced Raman scattering (SERS) nanoprobe (AuNS@4-MBN@Ag-aptamer), using a star-shaped bimetallic core-shell structure as the main Raman signal enhancement material and 4-mercaptobenzonitrile (4-MBN) as a reporter molecule in the "biological silent" zone (at 2228 cm -1(2) The present invention introduces the "biological silent" zone nanoprobe into the SERS aptamer sensor for ultra-sensitive and interference-free detection of chlorpyrifos (CPF). The sensor uses AuNS@4-MBN@Ag-aptamer as a nanoprobe and Fe3O4@AuNPs-cDNA (FA-cDNA) as a magnetic substrate. In the sensor, FA-cDNA and AuNS@4-MBN@Ag-aptamer form a FA-cDNA-aptamer-AuNS@4-MBN@Ag magnetic complex through base complementary pairing. When CPF is present in the mixed system, CPF preferentially binds to the nanoprobe, thereby hindering the binding of the nanoprobe to the magnetic substrate, which causes the Raman signal intensity of the magnetic complex to decrease with the increase of CPF concentration. Under the optimal SERS detection parameters, the sensor has good selectivity and repeatability, and its linear detection range is 2.5×10 2 to 5.0×10 4 pg / mL, LOD was 220.35 pg / mL (S / N=3).

[0048] (3) The present invention uses the aptamer sensor to detect actual samples, and the results show that the spiked recoveries of wheat and apple are 89.61% to 107.33% (RSD ≤ 14.55%). Therefore, the SERS sensor based on the "biological silent" zone bimetallic nanoprobe has important practical application significance in the detection of trace CPF in complex matrix environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The present invention is based on the detection principle diagram of the ultra-sensitive, non-interference detection sensor of the "biological silent" zone bimetallic SERS nanoprobe.

[0050] Figure 2 This is the TEM image of AuNS@4-MBN@Ag prepared in Example 1 of the present invention.

[0051] Figure 3 This is the SERS effect evaluation of the AuNS@4-MBN@Ag nanoprobe in Example 1 of the present invention.

[0052] Figure 4 The establishment of the standard curve. (a) 2228cm corresponding to different CPF concentrations -1 SERS signal intensity at (b) 2228cm -1 Linear calibration curve of Raman signal intensity and CPF concentration at .

[0053] Figure 5Evaluation of the anti-interference properties of 4-MBN. (a) Raman spectra of AuNS@4-MBN and 4-NBT@AuNS@4-MBN; (b) Raman spectra of AuNSs@4-MBN and 4-NBT@AuNSs@4-MBN at 2228 cm -1 The Raman signal intensity at .

[0054] Figure 6 Selective evaluation of CPF detection method based on bimetallic SERS nanoprobe in the “bio-silent” zone.

[0055] Figure 7 Reproducibility evaluation of CPF detection method based on bimetallic SERS nanoprobe in “biological silent” zone. DETAILED DESCRIPTION

[0056] The present invention is further described below in conjunction with embodiments, but the protection scope of the present invention is not limited thereto:

[0057] The chlorpyrifos (CPF) aptamer and complementary strand (cDNA) were synthesized and purified by Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China), and the sequences are as follows:

[0058] Aptamer, 5′-SH-(CH2)6-CCTGCCACGCTCCGCAAGCTTAGGGTTACGCCTGCAGCGA TTCTTGATCGCGCTGCTGGTAATCCTTCTTTAAGCTTGGCACCCGCATCGT-3′;

[0059] cDNA, 5′-SH-(CH2)6-ACGATGCGGGTGCCAAGCTTAAAGAAGGAT-3′.

[0060] Example 1: Preparation of ultrasensitive, non-interference detection sensor based on bimetallic SERS nanoprobes in the “biological silent” zone

[0061] 1. Preparation of bimetallic SERS nanoprobes in the “biologically silent” zone

[0062] (1) Synthesis of gold seeds

[0063] Take 100 mL of HAuCl4·3H2O solution (0.01%, w / v), stir vigorously and heat to boiling at 120°C. Then, quickly add 3 mL of 1% (w / v) sodium citrate solution to the boiling solution. After continuous heating and stirring for 20 min, a gold seed solution is obtained.

[0064] (2) Synthesis of gold nanostars (AuNSs)

[0065] AuNSs were synthesized by seed-mediated growth method. 98 mL of HAuCl4·3H2O (0.01%, w / v) was heated to 30°C while gently stirring. Then 2 mL of the prepared gold seed solution was added. Subsequently, 3 mL of 1% (w / v) sodium citrate was added. After 30 seconds, 20 mL of 30 mM hydroquinone solution was quickly added. After vigorous stirring for 30 minutes, centrifugation was performed at 8000 rpm for 20 minutes, repeated twice, and finally dispersed in 50 mL of deionized water to obtain AuNSs solution.

[0066] (3) Synthesis of AuNS@4-MBN@Ag

[0067] 10 μL of 6 mM 4-MBN solution was added to 1 mL of AuNSs solution. After vortex mixing at room temperature for 2 h, 10 μL of 1% (w / v) Triton-X-100 was added, mixed for 5 min, and centrifuged at 8000 rpm for 15 min, repeated twice. The precipitate was then resuspended in 1 mL of deionized water to obtain an AuNPs solution. Then, 10 μL of 50 mM ascorbic acid (AA) solution and 50 mM AgNO3 solution were added sequentially under ultrasound. After stirring for 5 min, 10 μL of 1% (w / v) Tween-20 was added, stirred for 10 min, and centrifuged at 7500 rpm for 10 min. The precipitate was dispersed in 1 mL of PBS solution (10 mM, pH = 7.2) to obtain a highly SERS active AuNS@4-MBN@Ag solution ( Figure 2 is the TEM image; Figure 3 is the SERS activity evaluation result).

[0068] (4) Preparation of AuNS@4-MBN@Ag-aptamer

[0069] 1 mL of AuNS@4-MBN@Ag solution was incubated with 50 μL of 0.8 μM aptamer for 4 h, centrifuged at 7000 rpm for 10 min to remove unbound aptamer, and finally resuspended in 1 mL of PBS solution to obtain AuNS@4-MBN@Ag-aptamer.

[0070] 2. Preparation of Magnetic Substrate

[0071] (1) Synthesis of Fe3O4

[0072] 335 mg FeCl3·6H2O was dissolved in 10 mL (CH2OH)2 and stirred for 30 min, then 250 mg PEG6000 and 675 mg NaOAc were added. After sufficient dissolution, the mixture was transferred to a high-pressure reactor and heated at 210°C for 12 h. The reaction product was washed three times with ethanol and deionized water respectively, and then vacuum dried at 60°C overnight to obtain Fe3O4.

[0073] (2) Preparation of Fe3O4@AuNPs (FA)

[0074] First, 20 mg of Fe3O4 nanoparticles were ultrasonically dispersed in 40 mL of 2 mg / mL PEI solution for 2 h, and then washed with deionized water 4 times. The obtained Fe3O4@PEI nanoparticles were resuspended in 40 mL of deionized water. Then, the AuNPs solution (same as the synthesis method of uNS@4-MBN@Ag-aptamer) was mixed with the Fe3O4@PEI solution at a volume ratio of 4:1 under ultrasound for 30 min. After washing with deionized water 3 times, it was vacuum dried at 60 °C for 6 h.

[0075] (3) Preparation of FA-cDNA

[0076] 0.5 mL FA (0.4 mg / mL) and 50 μL 1.5 μM cDNA were incubated in PBS for 4 h. After washing three times, the precipitate was resuspended in 0.5 mL PBS to obtain a FA-cDNA solution (0.4 mg / mL).

[0077] 3. Construction of ultra-sensitive, non-interference detection sensor based on bimetallic SERS nanoprobes in the “biological silent” zone

[0078] 0.5 mL FA-cDNA (0.4 mg / mL) was added to 1 mL AuNS@4-MBN@Ag-aptamer solution and mixed and incubated at 37 °C for 30 min. The magnetic hybrid was washed twice with deionized water by an external magnet and dispersed in 0.5 mL deionized water. The 2228 cm -1 The Raman signal intensity of the blank group at .

[0079] Example 2: Establishment of an ultrasensitive, non-interference detection method for CPF based on a bimetallic SERS nanoprobe in the “biologically silent” zone

[0080] (1) A 1 mg / mL CPF acetonitrile solution was diluted with a 10% ethanol solution to different concentrations. Subsequently, 20 μL CPF was added to 1 mL AuNS@4-MBN@Ag-aptamer and gently shaken for 30 min. 0.5 mL FA-cDNA was added to the mixture and shaken at 37 °C for 30 min. The magnetic hybrid was washed twice with deionized water by an external magnet and then dispersed in 0.5 mL deionized water. The wavelength of 2228 cm was recorded at a laser power of 264.5 mW and an integration time of 1 s. -1 The Raman signal intensity at .

[0081] (2) 2228cm -1 The relative Raman signal intensity at the position is taken as the ordinate, and the logarithmic value of the CPF concentration is taken as the abscissa, and a working curve is drawn; the CPF content in the test solution is detected according to the working curve.

[0082] Relative signal strength calculation formula: y = ΔI = (I 2228 cm -1 )0-(I 2228 cm -1 ), where (I 2228 cm -1 )0 and (I 2228 cm -1 ) represents the blank group and the test group at 2228cm -1 Raman intensity.

[0083] According to the formula, C CPF Linear relationship with y: Y = 3727.70Lg C CPF -7555.29(R 2 =0.986)( Figure 4 ). The linear range is 2.5×10 2 to 5.0×10 4 pg / mL, and the minimum detection limit was 220.35 pg / mL.

[0084] Example 3: Evaluation of the anti-interference performance of the CPF detection method based on the “biologically silent” zone bimetallic SERS nanoprobe (1) SERS detection was performed using AuNS@4-NBT / 4-MBN mixture and AuNS@4-MBN to compare the 2228 cm -1 The Raman signal intensity at .

[0085] (2) Although in the “molecular fingerprint” region (800-1800 cm -1), the Raman spectrum characteristic peaks of 4-MBN and organic reagent 4-NBT overlap, but the peak at 2228 cm -1 The signal strength at the Figure 5 ). The results show that the SERS nanoprobe based on 4-MBN as the signal source is at 2228 cm -1 The Raman signal at the location has good anti-interference ability.

[0086] Example 4: Evaluation of the selectivity and reproducibility of the CPF detection method based on the “biologically silent” zone bimetallic SERS nanoprobe

[0087] (1) Selectivity tests were performed using 50 ng / mL glyphosate, imidacloprid, acetamiprid, clothianidin and dinotefuran, as well as a variety of pesticide mixtures containing 10 ng / mL CPF, instead of 10 ng / mL CPF. Reproducibility was evaluated by analyzing 10 independent FA / AuNS@4-MBN@Ag hybrids and preparing 20 independent test solutions containing 10 ng / mL CPF.

[0088] (2) Figure 6 As shown in the figure, the aptamer sensor exhibits significant specificity, with significant signal responses to CPF and mixtures containing CPF, while the responses to other pesticides are still small even at high concentrations. Therefore, the CPF detection method based on the "biological silent" zone bimetallic SERS nanoprobe has good selectivity.

[0089] (3) Figure 7 As shown, the FA / AuNS@4MBN@Ag hybrid has a -1 The RSD of the signal intensity at the "biological silent" zone was 3.84%, and the detection result of the CPF test solution showed an RSD of 5.61%. Therefore, the CPF detection method based on the "biological silent" zone bimetallic SERS nanoprobe has good reproducibility.

[0090] Application examples:

[0091] (1) Wheat and apple were selected as actual samples for CPF detection. For wheat samples, 2 g of wheat was mixed with 5 mL of deionized water and 5 mL of acetonitrile, and then ground thoroughly with a mortar. The slurry was filtered with double-layer gauze, centrifuged at 12,000 rpm for 8 min, and then filtered with a 0.22 μm filter. Different concentrations of CPF were added to the wheat samples for SERS detection. For apple samples, 20 g of fresh tissue was chopped and homogenized in a fruit crusher. The obtained apple juice was centrifuged at 12,000 rpm for 8 min and filtered with a 0.22 μm filter. Different concentrations of CPF were added to the apple juice samples for SERS detection. The 2228 cm -1The Raman signal intensity at the location is measured and the relative Raman signal intensity is calculated.

[0092] (2) According to the standard working curve drawn in Example 2, the spiked recoveries of CPF detection results in wheat and apple samples were calculated to be 89.61% to 107.33% and 91.62% to 102.35% (RSD≤14.55%), respectively.

Claims

1. A method for preparing a bimetallic SERS nanoprobe based on the "biological silent" zone, characterized in that: The steps of this method are as follows: (1) Preparation of bimetallic SERS nanoprobes in the "biologically silent" zone: 4-mercaptobenzonitrile (4-MBN) was loaded on the surface of gold nanostars (AuNSs) via Au-S bonds; AuNS@4-MBN@Ag was synthesized by ascorbic acid (AA) reduction method; and chlorpyrifos (CPF) aptamer was loaded on the surface of AuNS@4-MBN@Ag via Ag-S bonds to prepare AuNS@4-MBN@Ag-aptamer. (2) Preparation of magnetic substrate: synthesizing magnetic Fe3O4 as the core material of the magnetic substrate; preparing Fe3O4@PEI and then Fe3O4@AuNPs (FA) by layer-by-layer electrostatic self-assembly method; loading aptamer complementary chain (cDNA) on the surface of AuNPs through Au-S bond to achieve the preparation of FA-cDNA; (3) The "biologically silent" zone bimetallic SERS nanoprobe prepared in step (1) is mixed and incubated with the magnetic substrate FA-cDNA prepared in step (2) to obtain a SERS sensor based on the "biologically silent" zone reporter molecule.

2. The preparation method according to claim 1, characterized in that: The synthesis method of Au seeds is to heat HAuCl4·3H2O solution to boiling, quickly add sodium citrate solution to the boiling solution, continue heating and stirring for 10 to 30 minutes, and obtain Au seeds solution; The synthesis method of AuNSs is to heat the HAuCl4·3H2O solution to 20-40°C while stirring, then add the Auseeds solution, and then add the sodium citrate solution and the hydroquinone solution in sequence; after stirring, centrifuge and finally disperse in deionized water to obtain the AuNSs solution; The synthesis method of AuNS@4-MBN@Ag-aptamer includes the following steps: (1) Add 4-MBN solution to AuNSs solution and mix well, then add Triton-X-100 solution and mix well again before centrifugation; (2) The precipitate obtained after centrifugation was dispersed in the AuNPs solution in deionized water, and ascorbic acid AA solution and AgNO3 solution were added in sequence under ultrasound, and then Tween-20 solution was added and stirred again and centrifuged, and the precipitate was dispersed in PBS solution to obtain AuNS@4-MBN@Ag solution; (3) The AuNS@4-MBN@Ag solution was incubated with CPF aptamer, then centrifuged to remove unbound aptamer, and finally resuspended in PBS solution to obtain AuNS@4-MBN@Ag-aptamer solution.

3. The preparation method according to claim 1, characterized in that: The preparation method of FA-cDNA comprises the following steps: The Fe3O4 nanoparticles are uniformly dispersed in the PEI solution by ultrasonication, and the Fe3O4@PEI nanoparticles obtained after washing are resuspended in deionized water to obtain a Fe3O4@PEI nanoparticle solution; the AuNPs solution and the Fe3O4@PEI nanoparticle solution are then mixed and washed and dried to obtain Fe3O4@AuNPs(FA); The FA solution and cDNA solution were incubated in PBS for 3-5 hours, and the washed precipitate was resuspended to obtain a FA-cDNA solution with a concentration of 0.2-1 mg / mL.

4. The preparation method according to claim 2, characterized in that: In the synthesis method of Au seeds: the mass concentration of HAuCl4·3H2O solution is 0.01-0.03%, the mass concentration of sodium citrate solution is 0.5-1.5%, and the volume ratio of HAuCl4·3H2O solution to sodium citrate solution is 100:1-10; In the method for synthesizing AuNSs: the mass concentration of HAuCl4·3H2O solution is 0.01-0.03%, the mass concentration of sodium citrate solution is 0.5-1.5%, and the concentration of hydroquinone solution is 20-50 mM; The volume ratio of HAuCl4·3H2O solution, Au seeds solution, sodium citrate solution and hydroquinone solution is 95-105:1-5:1-5:10-30; In the synthesis method of AuNS@4-MBN@Ag-aptamer: In step (1), the concentration of 4-MBN solution is 1-10 mM, and the mass concentration of Triton-X-100 is 0.5-1.5%; The volume ratio of 4-MBN solution, AuNSs solution and Triton-X-100 solution was 5-15:1000:5-15; In step (2), the concentration of AA solution is 10-80 mM, the concentration of AgNO3 solution is 10-80 mM, the mass concentration of Tween-20 is 0.5-1.5%; the concentration of AuNPs solution is 50-150 μg / mL; The volume ratio of AuNPs solution, AA solution, AgNO3 solution, Tween-20 solution and PBS solution was 1000:5-15:5-15:5-15:1000; In step (3), the volume ratio of AuNS@4-MBN@Ag solution, CPF aptamer solution and PBS solution is 1000:30-80:1000; The concentration of the CPF aptamer solution is 0.5 to 1.5 μM.

5. The preparation method according to claim 3, characterized in that: The mass ratio of Fe3O4 nanoparticles and PEI is 1:1-8; the concentration of Fe3O4@PEI nanoparticle solution is 2-3 mg / mL; the concentration of AuNPs solution is 50-150 μg / mL; the volume ratio of AuNPs solution and Fe3O4@PEI nanoparticle solution is 2-6:

1.

6. The preparation method according to claim 3, characterized in that: The concentration of the FA solution is 0.2 to 1 mg / mL, the concentration of the cDNA is 0.5 to 5 μM, and the volume ratio of the FA solution to the cDNA solution is 5 to 15:

1.

7. The preparation method according to claim 1, characterized in that: In step (3), the volume ratio of FA-cDNA solution to AuNS@4-MBN@Ag-aptamer solution is 1:1-5.

8. The preparation method according to claim 1, characterized in that: Aptamer, 5′-SH-(CH2)6-CCTGCCACGCTCCGCAAGCTTAGGGTTACGCCTGCAGCGATTCTTGATCGCGCTGCTGGTAATCCTTCTTTAAGCTTGGCACCCGCATCGT-3′; cDNA, 5′-SH-(CH2)6-ACGATGCGGGTGCCAAGCTTAAAGAAGGAT-3′.

9. A bimetallic SERS nanoprobe based on the "biological silent" zone, characterized in that The probe is prepared by the method described in any one of claims 1 to 7.

10. The bimetallic SERS nanoprobe based on the "biological silent" zone prepared by the method of claim 1 has good application prospects in the accurate and rapid quantitative analysis of harmful substances in complex food and environmental matrices.

Images