Preparation method and application of chitosan nanoparticles loaded with recombinant bovine interferon alpha / gamma

Abstract

The invention provides a preparation method of chitosan nanoparticles (CS-TPP-rBoIFN alpha / gamma NPs) loaded with recombinant bovine interferon alpha / gamma. The preparation method comprises the following steps: expression and purification of recombinant bovine interferon alpha / gamma (rBoIFN alpha / gamma), renaturation of rBoIFN alpha / gamma, and preparation of CS-TPP-rBoIFN alpha / gamma NPs. The invention also provides an application for preparing a medicine for preventing and treating calf diarrhea caused by BVDV. The CS-TPP-rBoIFN alpha / gamma NPs prepared by the preparation method disclosed by the invention is relatively small in size, is uniformly distributed, and can be continuously released for 96 hours in biological fluid; the encapsulation effect of the CS-TPP-rBoIFN alpha / gamma NPs is relatively good, and the encapsulation efficiency and the load efficiency can reach 76.3% and 67.2%; when the CS-TPP-rBoIFN alpha / gamma NPs is applied in a mouse body, the CS-TPP-rBoIFN alpha / gamma NPs is found to be capable of remarkably improving the antiviral activity of the rBoIFN alpha / gamma.

Description

Technical Field

[0001] The invention belongs to the technical field of preparation of recombinant bovine interferon alpha / gamma loaded chitosan nanoparticles, and specifically relates to a preparation method and application of recombinant bovine interferon alpha / gamma loaded chitosan nanoparticles. Background Art

[0002] Bovine interferon (IFN) is a highly active, multifunctional glycoprotein with antiviral, anti-tumor and immunomodulatory effects, which can inhibit the replication of a variety of viruses. Among them, bovine interferon α has a broad-spectrum antiviral effect, and bovine interferon γ has an immunomodulatory function, which can promote the production of a variety of antiviral cytokines and put the body in the best immune response state. However, the monomeric bovine interferon protein has a single activity and has certain toxic effects. Monomeric bovine interferon has a short residence time in the body and a short medication interval. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide a preparation method and application of recombinant bovine interferon α / γ chitosan nanoparticles in view of the deficiencies of the above-mentioned prior art. The recombinant bovine interferon α / γ chitosan nanoparticles (CS-TPP-rBoIFNα / γNPs) are small in size and evenly distributed, and can be continuously released in biological fluids for 96 hours; and the CS-TPP-rBoIFNα / γNPs have a good encapsulation effect, and the encapsulation efficiency and loading efficiency can reach 76.3% and 67.2%. In mice, CS-TPP-rBoIFNα / γNPs can significantly improve the anti-BVDV activity of rBoIFNα / γ. CS-TPP-rBoIFNα / γNPs are effective nanomedicines for preventing and treating BVDV infection, and provide new ideas for the prevention and treatment of BVDV.

[0004] In order to solve the above technical problems, the technical solution adopted by the present invention is: a method for preparing chitosan nanoparticles loaded with recombinant bovine interferon α / γ, the method comprising:

[0005] S1. Expression and purification of recombinant bovine interferon α / γ:

[0006] S101, transform the pET28a empty plasmid into E.coil BL21 competent cells, pick single clones, perform PCR identification, select positive clones and expand them into LB medium containing Kan resistance at a ratio of 1:100, and culture at 37°C and 200 rpm until OD 600 When the value is 0.6-0.8, bacterial solution A is obtained;

[0007] 1 mL of the bacterial solution A was centrifuged at 4°C and 10,000 rpm for 1 min, the precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and the mixture was boiled in boiling water for 10 min to obtain the pET28a empty vector before induction;

[0008] IPTG with a final concentration of 1 mmol / L was added to the remaining bacterial solution A for induction for 4 h. After the induction, 1 mL was taken, and centrifuged at 4°C and 10,000 rpm for 1 min. The precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and boiled in boiling water for 10 min to obtain the induced pET28a empty vector;

[0009] S102, transform the pET28a-rBoIFNα / γ plasmid into E.coil BL21 competent cells, pick single clones, perform PCR identification, select positive clones and expand them into LB medium containing Kan resistance at a ratio of 1:100, and culture at 37°C and 200 rpm until OD 600 When the value is 0.6-0.8, bacterial solution B is obtained;

[0010] 1 mL of the bacterial solution B was centrifuged at 4°C and 10,000 rpm for 1 min, the precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and the mixture was boiled in boiling water for 10 min to obtain pre-induced rBoIFNα / γ;

[0011] IPTG with a final concentration of 1 mmol / L was added to the remaining bacterial solution B for induction for 4 hours. After the induction, the induced bacterial solution B was obtained. 1 mL of the induced bacterial solution B was taken, and centrifuged at 4°C and 10000 rpm for 1 min. The precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and boiled with boiling water for 10 min to obtain induced rBoIFNα / γ;

[0012] S103, centrifuging the induced rBoIFNα / γ obtained in S102 at 4°C and 10,000 rpm for 5 min, resuspending the precipitate with PBS, and performing ultrasound in an ice bath to obtain bacterial solution C;

[0013] Take 30 μL of the bacterial solution C, add 10 μL of 4× protein loading buffer, boil in boiling water for 10 min, and obtain the whole rBoIFNα / γ bacteria after ultrasonication;

[0014] Then the remaining bacterial solution C was centrifuged again at 4°C and 10000rpm, and 30 μL of the supernatant and the precipitate after centrifugation were taken, 10 μL of 4× protein loading buffer was added, and boiled in boiling water for 10 minutes to obtain the supernatant and precipitate after ultrasound, respectively;

[0015] S104, performing solubility identification on the pET28a empty load before induction, the pET28a empty load after induction obtained in S101, the rBoIFNα / γ before induction, the rBoIFNα / γ after induction obtained in S102, the whole rBoIFNα / γ after ultrasound, the supernatant after ultrasound, and the precipitate after ultrasound obtained in S103 to determine whether the rBoIFNα / γ protein is expressed in inclusion bodies or in a soluble manner;

[0016] S105. After identifying that rBoIFNα / γ is expressed in inclusion bodies, the induced bacterial solution B obtained in S102 is centrifuged at 4°C and 10,000 rpm for 15 min, the precipitate is resuspended in PBS, ultrasonicated in an ice bath, centrifuged, and the precipitate is resuspended in PBS, added with Binding Buffer for overnight denaturation, and centrifuged at 4°C and 10,000 rpm for 15 min the next day to obtain the denatured supernatant of the inclusion body protein, and the protein is purified using a His tag protein purification kit to obtain purified recombinant bovine interferon α / γ, i.e., purified rBoIFNα / γ;

[0017] S2. Renaturation of recombinant bovine interferon α / γ:

[0018] The purified rBoIFNα / γ obtained in S105 was added to a dialysis bag, placed in a renaturation solution at 4°C for 24 hours, and after renaturation, transferred to PBS and dialyzed for 24 hours to obtain renatured rBoIFNα / γ;

[0019] S3. Preparation of chitosan nanoparticles loaded with recombinant bovine interferon α / γ:

[0020] Dissolve chitosan powder in 2% acetic acid aqueous solution, stir magnetically for 2 hours to obtain a chitosan solution, filter with a 0.45 μm filter, dissolve the renatured rBoIFNα / γ obtained in S2 in the filtered chitosan solution, stir for 30 minutes, and obtain a chitosan solution containing rBoIFNα / γ;

[0021] A sodium tripolyphosphate aqueous solution with a concentration of 1.5 mg / mL was added dropwise to the chitosan solution containing rBoIFNα / γ at a dropping rate of 15 mL / h, and magnetic stirring was performed at a rotation speed of 700 rpm for 30 min to obtain a suspension of chitosan nanoparticles loaded with recombinant bovine interferon α / γ, which was named CS-TPP-rBoIFNα / γNPs suspension; after freeze-drying, chitosan nanoparticles loaded with recombinant bovine interferon α / γ were obtained, which were named CS-TPP-rBoIFNα / γNPs.

[0022] Preferably, the method for purifying protein in the His-tagged protein purification kit in S105 is: taking 3 mL of Ni-NTA and adding it to a 10 mL chromatography column, after the gel and the liquid are separated, opening the outlet to remove anhydrous ethanol, and then washing the column with distilled water and Binding Buffer in sequence; passing the supernatant after denaturation of the inclusion body protein through a 0.45 μm filter membrane, adding the filtered supernatant after denaturation of the inclusion body protein to the chromatography column at a rate of 15 mL / h, and then washing the protein purification column with 15 column volumes of Binding Buffer, and finally adding 1.5 column volumes of Elution Buffer to elute the protein, collecting the eluted protein solution, and obtaining purified recombinant bovine interferon α / γ.

[0023] Preferably, the refolding solution in S2 is prepared by adding 8.71 g arginine, 0.0612 g oxidized glutathione, and 0.09 g reduced glutathione to distilled water to a volume of 100 mL.

[0024] Preferably, the concentration of chitosan in the chitosan solution in S3 is 2 mg / mL.

[0025] Preferably, the concentration of rBoIFNα / γ in the chitosan solution containing rBoIFNα / γ in S3 is 1 mg / mL.

[0026] Preferably, the volume ratio of the 1.5 mg / mL sodium tripolyphosphate aqueous solution to the rBoIFNα / γ-containing chitosan solution in S3 is 1:5.

[0027] The present invention also provides the use of chitosan nanoparticles loaded with recombinant bovine interferon α / γ prepared by the above preparation method. The chitosan nanoparticles loaded with recombinant bovine interferon α / γ are used to prepare drugs for preventing and treating bovine viral diarrhea virus (BVDV).

[0028] Compared with the prior art, the present invention has the following advantages:

[0029] The chitosan nanoparticles CS-TPP-rBoIFNα / γNPs loaded with recombinant bovine interferon α / γ prepared by the present invention are small in size and evenly distributed, and can be continuously released in biological fluids for 96 hours; and the encapsulation effect of CS-TPP-rBoIFNα / γNPs is good, and the encapsulation efficiency and loading efficiency can reach 76.3% and 67.2% respectively; and CS-TPP-rBoIFNα / γNPs can significantly improve the antiviral activity of rBoIFNα / γ in mice.

[0030] The present invention is further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1This is a diagram showing the expression and purification of rBoIFNα / γ in Example 1 of the present invention.

[0032] Figure 2 This is an identification diagram of the renatured recombinant bovine interferon α / γ of Example 1 of the present invention.

[0033] Figure 3 This is a graph showing the in vitro antiviral activity of the recombinant bovine interferon α / γ of Example 1 of the present invention.

[0034] Figure 4 This is a graph of interferon-stimulated gene transcription levels in Example 1 of the present invention.

[0035] Figure 5 This is a characterization analysis diagram of chitosan nanoparticles loaded with recombinant bovine interferon α / γ according to Example 1 of the present invention.

[0036] Figure 6 This is an identification diagram of chitosan nanoparticles loaded with recombinant bovine interferon α / γ according to Example 1 of the present invention.

[0037] Figure 7 This is a graph showing the in vitro cell viability assay of the nanoparticles of Example 1 of the present invention.

[0038] Figure 8 This is an in vitro release curve of the polysaccharide nanoparticles of Example 1 of the present invention.

[0039] Fig. 9 This is a diagram of the autopsy of mice in Example 1 of the present invention.

[0040] Fig.10 This is a graph showing the blood routine test of mice in Example 1 of the present invention.

[0041] Fig.11 This is a graph showing the determination of inflammatory factor levels in Example 1 of the present invention.

[0042] Fig.12 This is a graph showing the viral load determination of various tissues and organs in Example 1 of the present invention.

[0043] Fig.13 This is a diagram of the histopathological changes of Example 1 of the present invention. DETAILED DESCRIPTION

[0044] Example 1

[0045] The preparation method of the chitosan nanoparticles loaded with recombinant bovine interferon α / γ in this embodiment is as follows:

[0046] 1.1 Expression and purification of recombinant bovine interferon α / γ:

[0047] S101, transform the pET28a empty plasmid into E.coil BL21 competent cells, pick single clones, perform PCR identification, select positive clones and expand them into LB medium containing Kan resistance at a ratio of 1:100, and culture at 37°C and 200 rpm until OD 600 When the value is 0.6-0.8, bacterial solution A is obtained;

[0048] 1 mL of the bacterial solution A was centrifuged at 4°C and 10,000 rpm for 1 min, the precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and the mixture was boiled in boiling water for 10 min to obtain the pET28a empty vector before induction;

[0049] IPTG with a final concentration of 1 mmol / L was added to the remaining bacterial solution A for induction for 4 h. After the induction, 1 mL was taken, and centrifuged at 4°C and 10,000 rpm for 1 min. The precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and boiled in boiling water for 10 min to obtain the induced pET28a empty vector;

[0050] S102, transform the pET28a-rBoIFNα / γ plasmid into E.coil BL21 competent cells, pick single clones, perform PCR identification, select positive clones and expand them into LB medium containing Kan resistance at a ratio of 1:100, and culture at 37°C and 200 rpm until OD 600 When the value is 0.6-0.8, bacterial solution B is obtained;

[0051] Wherein, the preparation method of pET28a-rBoIFNα / γ plasmid is:

[0052] According to the BoIFNα gene sequence with accession number Z46508.1 and the BoIFNγ gene sequence with accession number M29867.1 in GenBank, the signal peptide was removed and connected using a flexible linker (GGGGSGGGGSGGGGS) and cloned into the pET28a vector;

[0053] BoIFNα gene sequence:

[0054] TGCCACCTGCCTCACACCCACAGCCTGCCCAACAGGAGGGTCCTGATG

[0055] CTCCTGAGACAACTGAGGAGGGTCTCCCCTTCCTCCTGCCTGCAGGACAG

[0056] AAATGACTTTGCATTCCCCCAGGAGGCTCTGGGTGGCAGCCAGTTACAGA

[0057] AGGCTCAAGCCATCTCTGTGCTCCATGAGGTGACCCAGCACACCTTCCAG

[0058] CTCTTCAGCACAGAGGGCTCGCCCGCCACATGGGACAAGAGCCTCCTGGA

[0059] CAAGCTATGCGCTGCGCTGGATCAGCAGCTCACTGACCTGCAAGCCTGTC

[0060] TGAGGCAGGAGGAGGGGCTGCCAGGGGCTCCCCTGCTCAAGGAGGACGC

[0061] CAGCCTGGCTGTGAGGAAATACTTCCACAGACTCACTCTCTATCTGCAAG

[0062] AGAAGAGACACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAGTCATG

[0063] AGAGCCTTCTCTTCCTCAACAAACTTGCAGGAGAGTTTCAGGAGAAAGGAC;

[0064] BoIFNγ gene sequence:

[0065] CAGGGCCAATTTTTTAGAGAAATAGAAAACTTAAAGGAGTATTTTAATGCAAGTAGCCCAGATGTAGCTAAGGGTGGGCTCTCTCTCAGAAATTTTGAAGAATTGGAAAGATGAAAGTGACAAAAAAATTATTCAGAGCCAAATTGTCTCCTTCTACTTCAAAACTCTTTGAAAACCTCAAAGATAACCAGGTCATTCAAAGGAGCATGGATAT CATCAAGCAAGACATGTTTCAGAAGTTTCTTGAATGGCAGCTCTGAGAAACTGGAGGACTTCAAAAAGCTGATTCAAATTCCGGTGGATGATCTGCAGATCCAGCGCAAAGCCATAAATGAACTCATCAAAGTGATGAATGACCTGTCACCAAAATCTAACCTCAGAAAGCGGAAGAGAAGTCAGAATCTCTTTCGAGGCCGGAGAGCATCAACG;

[0066] 1 mL of the bacterial solution B was centrifuged at 4°C and 10,000 rpm for 1 min, the precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and the mixture was boiled in boiling water for 10 min to obtain pre-induced rBoIFNα / γ;

[0067] IPTG with a final concentration of 1 mmol / L was added to the remaining bacterial solution B for induction for 4 hours. After the induction, the induced bacterial solution B was obtained. 1 mL of the induced bacterial solution B was taken, and centrifuged at 4°C and 10000 rpm for 1 min. The precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and boiled with boiling water for 10 min to obtain induced rBoIFNα / γ;

[0068] S103, centrifuging the induced rBoIFNα / γ obtained in S102 at 4°C and 10,000 rpm for 5 min, resuspending the precipitate with PBS, and performing ultrasound in an ice bath to obtain bacterial solution C;

[0069] Take 30 μL of the bacterial solution C, add 10 μL of 4× protein loading buffer, boil in boiling water for 10 min, and obtain the whole rBoIFNα / γ bacteria after ultrasonication;

[0070] Then the remaining bacterial solution C was centrifuged again at 4°C and 10000rpm, and 30 μL of the supernatant and the precipitate after centrifugation were taken, 10 μL of 4× protein loading buffer was added, and boiled in boiling water for 10 minutes to obtain the supernatant and precipitate after ultrasound, respectively;

[0071] S104, performing solubility identification on the pET28a empty load before induction, the pET28a empty load after induction obtained in S101, the rBoIFNα / γ before induction, the rBoIFNα / γ after induction obtained in S102, the whole rBoIFNα / γ after ultrasound, the supernatant after ultrasound, and the precipitate after ultrasound obtained in S103 to determine whether the rBoIFNα / γ protein is expressed in inclusion bodies or in a soluble manner;

[0072] S105. After identifying that rBoIFNα / γ is expressed in inclusion bodies, the induced bacterial solution B obtained in S102 is centrifuged at 4°C and 10,000 rpm for 15 min, the precipitate is resuspended in PBS, ultrasonicated in an ice bath, centrifuged, and the precipitate is resuspended in PBS, added with Binding Buffer for overnight denaturation, and centrifuged at 4°C and 10,000 rpm for 15 min the next day to obtain the denatured supernatant of the inclusion body protein, and the protein is purified using a His tag protein purification kit to obtain purified recombinant bovine interferon α / γ, i.e., purified rBoIFNα / γ;

[0073] The method for purifying protein by the His-tag protein purification kit is as follows: 3 mL of Ni-NTA is added to a 10 mL chromatography column, after the gel and the liquid are separated, the outlet is opened to remove anhydrous ethanol, and then the column is washed with distilled water and Binding Buffer in sequence; the supernatant after the inclusion body protein is denatured is filtered through a 0.45 μm filter membrane, the supernatant after the inclusion body protein is denatured is added to the chromatography column at a rate of 15 mL / h, and then the protein purification column is washed with 15 times the column volume of Binding Buffer, and finally 1.5 times the column volume of Elution Buffer is added to elute the protein, and the eluted protein solution is collected to obtain purified recombinant bovine interferon α / γ, that is, purified rBoIFNα / γ.

[0074] result:

[0075] The constructed expression plasmid was transformed into E.coil BL21 (DE3) competent cells, and single colonies were picked. The clones that were positive by bacterial liquid PCR were expanded and cultured. After induction with 1mmol / L IPTG for 4h, SDS-PAGE was performed.

[0076] like Figure 1 As shown, 1A is the solubility identification diagram of rBoIFNα / γ, Figure 1Lane 1 in A: empty pET28a before induction, lane 2: empty pET28a after induction, lane 3: rBoIFNα / γ before induction, lane 4: rBoIFNα / γ after induction, lane 5: whole rBoIFNα / γ after ultrasound, lane 6: supernatant after ultrasound, lane 7: precipitate after ultrasound.

[0077] It was identified that rBoIFNα / γ was expressed in inclusion bodies. Figure 1 As shown in A.

[0078] Figure 1 B is the purification result of inclusion body protein rBoIFNα / γ (i.e. purified rBoIFNα / γ). Figure 1 As shown in B, Figure 1 The results were consistent with those in A, with the target band appearing at approximately 42 kDa.

[0079] 1.2 Renaturation of recombinant bovine interferon α / γ:

[0080] The purified rBoIFNα / γ obtained in 1.1 was added to a dialysis bag, and the two ends of the dialysis bag were tightly sealed with sealing clips. The bag was renatured in a renaturation solution (formula of renaturation solution: 8.71 g arginine, 0.0612 g oxidized glutathione, 0.09 g reduced glutathione, added to distilled water and made up to 100 mL) at 4°C, and the renaturation solution was replaced every 4 hours for a total of 24 hours. After the renaturation, the bag was transferred to PBS for dialyzation, and fresh PBS was replaced every 4 hours for a total of 24 hours. After the dialysis, the liquid in the dialysis bag was aspirated, and the protein concentration was determined by Bradford method. The bag was stored at -20°C to obtain the renatured rBoIFNα / γ.

[0081] The specific operation of Bradford method for determining protein concentration (microwell microplate reader method) is as follows: Take 10 μL of completely dissolved protein standard and dilute to 250 μL to a final concentration of 0.2 mg / mL. Take 1 mL of 5×G250 staining solution, add 4 mL of double distilled water, and mix to form 1×G250 staining solution. Add 0, 2, 4, 6, 8, 12, 16, and 20 μL of the standard to a 96-well plate, and add PBS diluent to 20 μL, which is equivalent to the standard concentration of 0, 0.02, 0.04, 0.06, 0.08, 0.12, 0.16, and 0.2 mg / ml, respectively. Dilute the sample 2-fold, 4-fold, and 8-fold, and add 20 μL to the sample wells of the 96-well plate. Add 200 μL of diluted 1×G250 staining solution to each well, place at room temperature for 3-5 minutes, and then measure the absorbance at 570 nm with a microplate reader. After obtaining the data, a standard curve is drawn, and the protein concentration in the sample is calculated according to the standard curve. In this example, the concentration of the renatured rBoIFNα / γ protein prepared in 1.2 is 1 mg / mL;

[0082] 1.3 SDS-PAGE and WB identification of recombinant bovine interferon α / γ after renaturation

[0083] Pipette 30 μL of the renatured rBoIFNα / γ obtained in 1.2 into a new centrifuge tube, add 10 μL of 4× protein loading buffer and mix evenly. Then put it in a boiling water bath and boil for 10 minutes, cool it and centrifuge for 2 minutes to take the supernatant. Fix the glass plate for preparing protein gel on the gel maker, inject the prepared gel solution between the two glass plates as soon as possible, insert the tooth comb, and wait for it to solidify. Slowly pull out the tooth comb upwards and try not to cause bubbles, put the glass plate into the vertical electrophoresis tank according to the positive and negative directions of the power supply, and add 1×SDS buffer. Spot 10 μL in each well, set the electrophoresis instrument U=80V, I=150mA, T=2.5h. After the sample reaches the bottom, separate the two glass plates to take out the gel, and stain it with Coomassie Brilliant Blue staining solution for 2h. After the end, put the gel into distilled water, decolorize it with boiling water until the background color becomes clean, and place it on the gel plate to observe the results.

[0084] Preliminary protein gel electrophoresis SDS-PAGE. After the electrophoresis is completed, soak the wet transfer filter paper and sponge in the wet transfer solution. Cut the PVDF membrane in advance and activate it in anhydrous ethanol. Place the transfer clamp with the black side facing down, and install it from bottom to top in the order of black board, sponge, filter paper, protein gel, PVDF membrane, filter paper, sponge, and white board. Place the transfer clamp in the manner of negative electrode to negative electrode and positive electrode to positive electrode, and transfer the membrane for 2 hours at U=120V and I=200mA. After the end, take out the successfully wet-transferred PVDF membrane and put it into the incubation box, add skim milk powder and incubate for 1 hour. Use Anti-His Mouse mAb as the primary antibody, dilute it at 1:6000, mix it thoroughly with skim milk powder, cover it on the PVDF membrane, and incubate it at room temperature for 1 hour. Wash the membrane 4 times with working concentration 1×TBST, 5 minutes each time. Goat Anti-Mouse IgG was used as the secondary antibody and diluted in skim milk powder at 1:16000 and incubated at room temperature for 1 hour. After repeated washing, ECL was added to develop the color using a chemiluminescent imager to obtain a Western Blot identification image.

[0085] Figure 2 A is the SDS-PAGE identification of rBoIFNα / γ after renaturation. Figure 2 B is the WB identification image of rBoIFNα / γ after renaturation. After rBoIFNα / γ protein renaturation, 30μL was added to 10μL 4× protein loading buffer, mixed and boiled in boiling water for 10 minutes. SDS-PAGE identification showed that the renaturation protein was consistent with the purified protein, with a size of about 42kDa. Figure 2 A. The WB results are shown in Figure 2As shown in B, rBoIFNα / γ loaded with pET28a has a specific band at 42 kDa, which has good reactivity with antibodies and is consistent with the expected size of the experiment.

[0086] 1.4 Antiviral activity assay

[0087] The activity of recombinant bovine interferon against bovine viral diarrhea virus (BVDV) and vesicular stomatitis virus (VSV) on MDBK and Vero cells was determined by cytopathic inhibition assay. The specific steps are as follows: take a 96-well cell culture plate of MDBK and Vero cells grown to a monolayer, add recombinant bovine interferon to 2% FBS DMEM nutrient solution and dilute it 4 times. -1 ~4 -9 Each gradient was set up with 8 replicate wells and incubated for 14 h. 100 μL of 100 TCID 50 The BVDV and VSV dilutions were set up with blank control, negative control and positive control wells. The results were recorded when 80% of the cells in the positive control group showed pathological changes, and the antiviral activity of recombinant bovine interferon was calculated according to the Reed-Muench method.

[0088] like Figure 3 As shown in the figure, the antiviral activity of the recombinant protein was detected by the MDBK / BVDV and Vero / VSV systems, and the activity was calculated according to the Reed-Muench method. The anti-VSV activity of rBoIFNα / γ was about 14133U / mL; the anti-BVDV activity of rBoIFNα / γ was about 9292U / mL, and the in vitro anti-VSV activity of rBoIFNα / γ was significantly higher than the in vitro anti-BVDV activity (P<0.001).

[0089] 1.5 Determination of interferon-stimulated gene transcription levels

[0090] According to the results of bovine interferon activity and toxicity determination, the cells were incubated with recombinant bovine interferon dilution that could completely inhibit BVDV infection but had low toxicity or no toxicity to MDBK. After 6h, 12h, 24h, and 36h of incubation, the cell samples were lysed and collected with RNAiso Plus, and the cell RNA was extracted for reverse transcription to obtain cDNA. According to the existing bovine interferon-stimulated gene sequence information in GenBank, anti-myxovirus protein (MX1), 2', 5'-oligoadenylate synthetase (OAS), and interferon-stimulated gene 15 (ISG15). GAPDH was selected as the internal reference gene, and qPCR specific primers Mx1 primer pair, OAS primer pair, and ISG15 primer pair were designed. The RT-qPCR reaction procedure was a three-step amplification, and the total reaction system was 20μL: 2×SYBR Mix 10μL, interferon-stimulated gene specific primers upstream and downstream primers, and cDNA template 1μL each, and finally supplemented to 20μL with ddH2O.

[0091] Mx1 Primer Pair:

[0092] The nucleotide sequence of primer Mx1-F is CCAGAAAGCAAGTCCATTAGGC;

[0093] The nucleotide sequence of primer Mx1-R is CCAACACCGCCTTGCTCC;

[0094] OAS primer pair:

[0095] The nucleotide sequence of primer OAS-F was TGGGTGGTGGAGACACAAAG;

[0096] The nucleotide sequence of primer OAS-R was CCGGTGTCAGGTTTACATCC;

[0097] ISG15 primer pair:

[0098] The nucleotide sequence of primer ISG15-F is GCAGCCAACCAGTGTCTG;

[0099] The nucleotide sequence of primer ISG15-R is CCTAGCATCTTCACCGTCAG;

[0100] The MDBK cells incubated with recombinant proteins were collected, and the control group was untreated MDBK cells. The cDNA obtained by reverse transcription of total RNA from cell samples was used as a template to determine the dynamic changes in the transcription level of interferon-stimulated genes at different time points. Figure 4As shown in the figure, compared with the cells in the control group, the transcription levels of MX1, OAS, and ISG15 in the cells incubated with recombinant protein were significantly upregulated. And when the recombinant protein acted on the cells for 12 hours, the transcription levels of several interferon-stimulated genes reached the highest level, MX1 and ISG15 could be increased by more than 100 times, and OAS increased by about 20 times, which was significantly different from the control group (P<0.001), further verifying the antiviral activity of recombinant bovine interferon.

[0101] 1.6 Preparation of chitosan nanoparticles loaded with recombinant bovine interferon α / γ:

[0102] Dissolve chitosan powder (CS powder) in acetic acid aqueous solution with a mass fraction of 2%, and stir magnetically for 2 hours to obtain a chitosan solution (CS solution) with a concentration of 2 mg / mL. After filtering with a 0.45 μm filter, dissolve the renatured rBoIFNα / γ obtained in step 1.2 in the filtered CS solution, and stir for 30 minutes to obtain a chitosan solution containing rBoIFNα / γ (i.e., a CS solution containing rBoIFNα / γ);

[0103] A sodium tripolyphosphate (TPP) aqueous solution with a concentration of 1.5 mg / mL was added dropwise to the chitosan solution of rBoIFNα / γ with a concentration of 1.5 mg / mL at a dropping rate of 15 mL / h, and magnetic stirring was performed at a rotation speed of 700 rpm for 30 min to spontaneously form CS-TPP NPs (wherein NPs is the abbreviation of nanoparticles) to obtain a suspension of chitosan nanoparticles loaded with recombinant bovine interferon α / γ, which was named CS-TPP-rBoIFNα / γNPs suspension; after freeze-drying, chitosan nanoparticles loaded with recombinant bovine interferon α / γ were obtained, which were named CS-TPP-rBoIFNα / γNPs; the volume ratio of the sodium tripolyphosphate aqueous solution with a concentration of 1.5 mg / mL to the chitosan solution containing rBoIFNα / γ was 1:5.

[0104] 1.7 Characterization and analysis of chitosan nanoparticles loaded with recombinant bovine interferon α / γ

[0105] The morphology of the nanoparticles was observed using a transmission electron microscope (TEM). The freeze-dried powder of chitosan nanoparticles loaded with bovine interferon was dissolved in deionized water and ultrasonically dispersed for later use. A sealing film was pasted on the back of the plate, and the ultra-thin carbon support film was gently placed on the sealing film with the front side facing up. 10 μL of the nanoparticle sample was dripped on the ultra-thin carbon support film, and it was allowed to stand at room temperature for 10 minutes. The excess sample was absorbed with rough filter paper. 10 μL of phosphotungstic acid staining solution was dripped on the sealing film, and the copper mesh was gently inverted on the dye solution, and it was allowed to stand at room temperature for 2 minutes, and the dye solution was absorbed with ordinary filter paper. Samples with dyeing times of 5 minutes and 10 minutes were prepared in the same way. The copper mesh was placed at room temperature for 10 minutes, placed in a copper mesh box, vacuum dried for 1 hour, and the morphology distribution was observed under TEM (JEM-1400).

[0106] The solubility, hydrated particle size and size distribution of the nanoparticles were determined using dynamic light scattering (DLS). The freeze-dried nanoparticles were re-dissolved in water and ultrasonicated for 5 min to make the particles uniformly dispersed. The results were measured using DLS (Malvern ZetasizerNano ZS90), with three replicates for each sample. The Thermo Fisher Scientific Nicolet iS20 Fourier transform infrared spectrometer was used to measure the nanoparticle size at 400-4000 cm -1 Infrared absorption spectrum in the range. Take 1 mg of freeze-dried recombinant bovine interferon α / γ nanoparticles and dissolve them in 1 mL of deionized water. Ultrasonicate the reconstituted nanoparticle solution, take 30 μL of each and add 10 μL of protein loading buffer for sample preparation. Boil in a boiling water bath for 10 minutes, cool and centrifuge for 2 minutes to obtain the supernatant. Subsequent operations are the same as 1.3 for WB identification of nanoparticles.

[0107] like Figure 5 A shows the TEM image of CS-TPP-rBoIFNα / γNPs nanoparticles ( Figure 5 A) and dynamic light scattering results. TEM results show that the nanoparticles are spherical nanospheres with relatively uniform size, and the size of CS-TPP-rBoIFNα / γNPs is between 150-200nm. Combined with the dynamic light scattering results, the nanoparticle size is mainly distributed between 170-180nm, with an average size of 176.21nm, which is relatively uniform in size, and the size observed by TEM is consistent with the DLS results. The polydispersity index (PDI) of bovine interferon-loaded chitosan nanoparticles CS-TPP-rBoIFNα / γNPs is as small as 0.014, indicating that the molecular weight distribution of the nanoparticles is relatively uniform; the Zeta potential value is 2.93mV (Table 1), indicating that the repulsion between the nanoparticles is strong, and the nanoparticles are relatively stable and not easy to aggregate.

[0108] Table 1 Dynamic light scattering results of CS-TPP-rBoIFNα / γNPs

[0109] Nanoparticles Average size (nm) PDI Zeta potential (mV) CS-TPP-rBoIFNα / γNPs 176.21±1.6 0.014±0.01 2.93±0.49

[0110] The spectra of blank chitosan nanoparticles (CS-TPP NPs) and rBoIFNα / γ loaded NPs showed high similarity between them, which was consistent with the results reported for chitosan nanoparticles.

[0111] The preparation method of blank chitosan nanoparticles (CS-TPP NPs) is as follows: chitosan powder (CS powder) is dissolved in an acetic acid aqueous solution with a mass fraction of 2%, and after magnetic stirring for 2 hours, a chitosan solution (CS solution) with a concentration of 2 mg / mL is obtained, and filtered with a 0.45 μm filter. A sodium tripolyphosphate (TPP) aqueous solution with a concentration of 1.5 mg / mL is added dropwise to the chitosan solution with a concentration of 1.5 mg / mL at a drop rate of 15 mL / h, and magnetic stirring is performed for 30 minutes at a speed of 700 rpm to spontaneously form CS-TPP NPs (wherein NPs is the abbreviation of nanoparticles). The volume ratio of the sodium tripolyphosphate aqueous solution with a concentration of 1.5 mg / mL to the chitosan solution with a concentration of 2 mg / mL is 1:5.

[0112] like Figure 5 As shown in B, the renatured rBoIFNα / γ and blank chitosan nanoparticles (CS-TPP NPs) were used as controls. -1 The characteristic absorption peak at 3000 to 3500 cm is due to the combination of NH and OH bonds in the CS chain. -1 C=O (amide I) and NH2 (amide II) were detected at 1645 cm -1 and 1545cm -1 This observation indicates that the position of the amide peak has changed, which is caused by the interaction between the CS chain and the phosphate anion in TPP. The above results confirm that CS-TPP-rBoIFNα / γNPs have been successfully prepared.

[0113] The nanoparticles were ultrasonically broken and then subjected to SDS-PAGE and WB identification. Figure 6 As shown, Figure 6A: SDS-PAGE identification of recombinant bovine interferon α / γ (rBoIFNα / γ) after renaturation; B: SDS-PAGE identification of blank chitosan nanoparticles (CS-TPP NPs); C: SDS-PAGE identification of chitosan nanoparticles loaded with recombinant bovine interferon α / γ (CS-TPP-rBoIFNα / γNPs); D: WB identification of recombinant bovine interferon α / γ (rBoIFNα / γ) after renaturation; E: WB identification of blank chitosan nanoparticles (CS-TPP NPs); F: WB identification of chitosan nanoparticles loaded with recombinant bovine interferon α / γ (CS-TPP-rBoIFNα / γNPs).

[0114] CS-TPP-rBoIFNα / γNPs( Figure 6 C, F) showed similarity with rBoIFNα / γ( Figure 6 A, D) consistent band (42kDa), while blank chitosan nanoparticles ( Figure 6 B and E) showed no obvious bands. This once again verified that the recombinant bovine interferon α / γ was successfully encapsulated into chitosan nanoparticles.

[0115] 1.8 Determination of the encapsulation effect of chitosan nanoparticles loaded with recombinant bovine interferon α / γ

[0116] The encapsulation efficiency and loading capacity of the nanoparticles for recombinant bovine interferon α / γ were indirectly detected by measuring the remaining free rBoIFNα / γ in the supernatant after centrifugation (i.e., the supernatant after centrifugation of the CS-TPP-rBoIFNα / γNPs suspension).

[0117] The specific operation is as follows: 1mL CS-TPP-rBoIFNα / γNPs suspension was centrifuged at 20000rpm for 20min, and the concentration of rBoIFNα / γ in the supernatant was determined using a Bradford assay kit. The standard curve was drawn according to the instructions of the protein detection kit, and the supernatant of blank chitosan nanoparticles was used as a blank control to correct the absorbance reading of CS-TPP-rBoIFNα / γNPs. The concentration of rBoIFNα / γ in the supernatant was calculated using the corrected OD value.

[0118] Encapsulation efficiency (%) = (total amount of rBoIFNα / γ - amount of free rBoIFNα / γ in supernatant) / total amount of rBoIFNα / γ

[0119] Loading efficiency (%) = (total amount of rBoIFNα / γ - amount of free rBoIFNα / γ in supernatant) / total amount of dried nanoparticles

[0120] The free rBoIFNα / γ in the supernatant was measured by Bradford method to indirectly determine the encapsulation effect of nanoparticles on recombinant bovine interferon. The ratio between rBoIFNα / γ, CS, and TPP was optimized through repeated experiments, and finally 1:5:1 was determined as their optimal ratio. The CS-TPP-rBoIFNα / γNPs prepared under this condition had an encapsulation efficiency of 76.3% and a loading efficiency of 67.2% (Table 2), indicating that CS-TPP NPs successfully loaded rBoIFNα / γ.

[0121] Table 2 Encapsulation efficiency and loading efficiency of CS-TPP-rBoIFNα / γNPs nanoparticles

[0122] Nanoparticles Packaging efficiency (%) Load efficiency (%) CS-TPP-rBoIFNα / γNPs 76.3±4.0 67.2±3.5

[0123] 1.9 In vitro cell viability assay

[0124] The toxicity of nanoparticles was detected using 3-(4,5-dimethylthiazole-2)-2,5-diphenyltetrazolium bromide (MTT) reagent. MDBK (bovine kidney cell) cells were plated in a 96-well plate, 100 μL of DMEM medium containing 10% fetal bovine serum was added, and the cells were cultured in an incubator at 37°C and 5% carbon dioxide concentration for 24 hours to allow the cells to grow. After 24 hours, 100 μL of culture medium containing different concentrations of nanoparticles was added, and 100 μL of pure culture medium was added to the control group for continued culture. After 24 hours, 20 μL of MTT was added to each well and cultured for another 4 hours. Then the solution in each well was aspirated, 150 μL of DMSO was added, and the crystals were dissolved by shaking, and then the absorbance was measured at 450 nm using an enzyme reader.

[0125] The cytotoxic effect of nanoparticles on MDBK cells was determined by MTT assay. Figure 7 As shown, the nanoparticles showed a dose-dependent cytotoxic effect after acting on the cells. Compared with the control group, the cell viability of MDBK cells showed a downward trend after high concentrations of blank chitosan nanoparticles (CS-TPP NPs) and rBoIFNα / γ acted on MDBK cells; while there was no significant difference between CS-TPP-rBoIFNα / γNPs and the control group. The results showed that CS-TPP-rBoIFNα / γNPs had no obvious cytotoxic effect on MDBK cells.

[0126] 1.10 Study on the in vitro release of recombinant bovine interferon α / γ

[0127] To determine the amount of protein released from the nanoparticles (CS-TPP-rBoIFNα / γNPs), the analysis was performed using a Bradford assay kit in a 96-well plate. Freeze-dried CS-TPP-rBoIFNα / γNPs (5 mg) were dispersed in 2 mL of biological fluid and gently stirred in a 37°C bath shaker.

[0128] At pre-set time intervals of 0, 1, 2, 4, 6, 8, 10, 12, 24, 36, 48, 60, 72, and 96 h, 1.0 mL of the dissolution medium was collected and replaced with the same volume of fresh body fluid. The samples were centrifuged at 15,000 r / min, and the supernatant was taken and the absorbance value at a wavelength of 570 nm was read using the Bradford assay kit standard to analyze the protein content.

[0129] The cumulative amount of rBoIFNα / γ released from CS-TPP-rBoIFNα / γNPs was determined in simulated body fluid, and the concentration of rBoIFNα / γ was estimated by measuring the absorbance by Bradford assay. Figure 8 As shown. The release of CS-TPP-rBoIFNα / γNPs is divided into two stages, with rapid release of rBoIFNα / γ in the first 10 hours, followed by a gradual release for up to 96 hours. CS-TPP-rBoIFNα / γNPs first burst release 49% of rBoIFNα / γ within 10 hours and release 82% within 96 hours. CS-TPP-rBoIFNα / γNPs showed 82%, 38%, and 16% rBoIFNα / γ release in three simulated biological fluids within 96 hours, respectively.

[0130] Freeze-dried CS-TPP-rBoIFNα / γNPs (5 mg) were dispersed in 2 mL of simulated biological fluid, and the loading efficiency of CS-TPP-rBoIFNα / γNPs was 67.2%, so the total amount of rBoIFNα / γ in CS-TPP-rBoIFNα / γNPs was 3.4 mg. CS-TPP-rBoIFNα / γNPs showed 82%, 38%, and 16% rBoIFNα / γ release in three biological fluids within 96 hours, respectively. This shows that CS-TPP-rBoIFNα / γNPs showed good sustained release effect in three biological fluids.

[0131] Among them, bovine serum corresponds to the injection mode of administration, and bovine gastric juice and intestinal juice correspond to the oral mode of administration. Therefore, both injection and oral administration can be used as the administration mode of CS-TPP-rBoIFNα / γNPs.

[0132] The initial rapid release of rBoIFNα / γ may be due to the loose binding of proteins through electrostatic interactions in chitosan nanoparticles, which can be easily eroded in the ionic environment. The second stage may correspond to the protein molecules being effectively encapsulated and tightly bound within the chitosan molecules.

[0133] The three simulated biological fluids used in this experiment are bovine serum, bovine gastric juice with pH = 1.2, and bovine intestinal juice with pH = 7.2.

[0134] Bovine serum (commercial fetal bovine serum Hangzhou Sijiqing Bioengineering Company)

[0135] pH = 1.2 bovine gastric juice preparation: add 0.0797g sodium chloride, 0.0164g ammonium nitrate, 0.0101g potassium chloride, 0.0318g potassium phosphate, 0.0154g potassium citrate, 0.0099g urea, 0.00105g uric acid sodium salt, and 0.0073g lactic acid sodium salt into 50mL double distilled water, adjust the pH to 1.2 with 37% (V / V) hydrochloric acid, and store at 4°C.

[0136] pH = 7.2 Preparation of bovine intestinal fluid: add 0.0797g sodium chloride, 0.0164g ammonium nitrate, 0.0101g potassium chloride, 0.0318g potassium phosphate, 0.0154g potassium citrate, 0.0099g urea, 0.00105g uric acid sodium salt, 0.0073g lactic acid sodium salt, 2.7g bile salt, and 1.2g pancreatic lipase into 50mL double distilled water, adjust the pH to 7.2, and store at 4°C.

[0137] 1.11 Evaluation of the antiviral activity of chitosan nanoparticles loaded with bovine interferon in mice

[0138] (1) Negative control group: On day 0, each mouse was intraperitoneally injected with 0.5 mL of DMEM (Duke's modified Eagle's medium);

[0139] (2) Infection group: Each mouse was intraperitoneally injected with 0.5 mL of BVDV (bovine viral diarrhea virus) on day 0;

[0140] (3) Prevention and treatment group:

[0141] ① rBoIFNα / γ group: On day 0, each mouse was intraperitoneally injected with 0.5 mL of BVDV (bovine viral diarrhea virus), and on day -2 (2 days before infection), day 1, and day 2, 50 μg of renatured recombinant bovine interferon rBoIFNα / γ was injected intramuscularly.

[0142] ②CS-TPP-rBoIFNα / γNPs group: Each mouse was intraperitoneally injected with 0.5 mL of BVDV on day 0, and chitosan nanoparticles loaded with 50 μg rBoIFNα / γ (CS-TPP-rBoIFNα / γNPs, including 50 μg rBoIFNα / γ) were injected intramuscularly on days -2, 1, and 2.

[0143] Forty BALB / c female mice were randomly divided into 4 groups according to the table below (Table 2) and kept in an animal room under sterile conditions. After the mice adapted for one week, each mouse in the BVDV infection group, rBoIFNα / γ group and CS-TPP-rBoIFNα / γNPs group was intraperitoneally injected with 0.5 mL of virus solution; each mouse in the negative control group was intraperitoneally injected with 0.5 mL of DMEM; the rBoIFNα / γ group in the preventive treatment group was intramuscularly injected with 50 μg of renatured recombinant bovine interferon rBoIFNα / γ 2 days before and for two consecutive days after the infection; the CS-TPP-rBoIFNα / γNPs group in the preventive treatment group was intramuscularly injected with chitosan nanoparticles loaded with 50 μg rBoIFNα / γ 2 days before and for two consecutive days after the infection; each mouse in the negative control group was intramuscularly injected with an equal amount of PBS (phosphate buffered saline). After the infection, the mice were allowed to eat freely. The activity, mental state and weight of the mice were observed and recorded every day (0 points for no symptoms; 1 point for weight loss, reduced food intake, depression, aggregation and soft stool diarrhea). Blood was collected from 3 mice in each group on days 0, 4, 7, 10 and 14 after infection. In this study, blood was collected by orbital blood sampling, and trisodium citrate was used as an anticoagulant. The collected blood was used for routine blood tests. The test items mainly included white blood cells (WBC), platelets (PLT), and lymphocytes (LYM). On days 4, 7, 10, 14 and 21 after infection, 2 mice were selected from each group for euthanasia. The mice were dissected on a sterile operating table and the pathological changes of their organs were observed. Feces in the spleen, liver, lung, duodenum, jejunum, mesenteric lymph nodes and rectum were collected. Part of the collected tissues was used for BVDV detection, and the other part was fixed with 4% paraformaldehyde fixative for HE staining and observation of pathological changes in the tissues of BALB / c mice after infection.

[0144] Table 3 Animal groups for the biological activity evaluation of recombinant bovine interferon loaded nanoparticles in mice

[0145]

[0146] 1.11.1 Clinical symptoms and autopsy of mice

[0147] After intraperitoneal injection of BVDV (bovine viral diarrhea virus), the activity of mice was observed every day and the weight was recorded in time. Mice in the group infected with BVDV alone showed symptoms of gathering together and reduced food intake, and some had mild diarrhea, but no obvious symptoms were found in other treatment groups. Fig. 9 The clinical autopsy results of mice in different groups are shown in Figure 2. The clinical autopsy results of the infected group showed slight bleeding in the lungs, slight atrophy of the spleen, enlarged mesenteric lymph nodes, and watery intestinal contents. The mesenteric lymph nodes of the rBoIFNα / γ group were also slightly enlarged. No obvious pathological changes were found in the negative control group and the CS-TPP-rBoIFNα / γNPs group.

[0148] 1.11.2 Routine blood test

[0149] After intraperitoneal injection of BVDV, the mice were anticoagulated and blood was collected on the 4th, 7th, 10th and 14th days, and the viremia of the mice was analyzed and measured using a blood routine analyzer. After intraperitoneal injection of BVDV, the levels of white blood cells and lymphocytes in the simple BVDV infection group were significantly reduced. Fig.10 It can be seen that the levels of white blood cells and lymphocytes in the rBoIFNα / γ group and the CS-TPP-rBoIFNα / γNPs group decreased on the 4th day after infection, which was significantly different from the control group (P<0.05); the viremia level reached a peak on the 7th day, but on the 10th and 14th days, the levels of white blood cells and lymphocytes in each group gradually recovered, while the levels of white blood cells and lymphocytes in the control group remained basically unchanged throughout the process. Overall, after the rBoIFNα / γ group and the CS-TPP-rBoIFNα / γNPs group mice were infected with BVDV, the levels of white blood cells and lymphocytes showed a downward trend but were still significantly higher than those in the BVDV infection group, and the viremia was alleviated. And at 14 days, the CS-TPP-rBoIFNα / γNPs group continued to play a role, and the levels of white blood cells and lymphocytes were not significantly different from those in the control group, showing a better effect.

[0150] 1.11.3 Cytokine level determination

[0151] Proinflammatory cytokines such as IL-6 and TNF-α are key to the pathogenesis of intestinal inflammation. Diarrhea caused by intestinal inflammation is one of the main clinical symptoms of BVD. Therefore, the cytokine levels of each group of mice were tested ( Fig.11). The IL-6 level in the blood of mice in the BVDV infection group was significantly increased on the 7th day (P<0.01), and the levels of TNF-α in the blood of mice on the 7th day and IL-6 and TNF-α in the blood of mice on the 14th day were significantly different from those in the control group (P<0.001). However, the levels of IL-6 and TNF-α in the blood of mice in the rBoIFNα / γ group and CS-TPP-rBoIFNα / γNPs group were significantly lower than those in the infection group (P<0.05), and the lowest level could reach about 100pg / mL. The results showed that rBoIFNα / γ and CS-TPP-rBoIFNα / γNPs can inhibit the expression of inflammatory factors induced by BVDV to a certain extent, among which chitosan nanoparticles CS-TPP-rBoIFNα / γNPs showed a strong inhibitory effect, with no significant difference compared with the control group.

[0152] 1.11.4 Determination of viral load in tissues and organs

[0153] According to the results of the previous mouse infection model, the viral load of mice was the highest on the 7th day after infection with BVDV, and the blood, feces, spleen and duodenum were most suitable for BVDV detection. Therefore, on this basis, spleen, duodenum, feces, blood and other tissue and organ samples were collected from mice on the 7th and 14th days after infection with BVDV for viral load detection. The results showed that BVDV was detected in all mice injected intraperitoneally with BVDV. Fig.12As shown in the figure, the tissue viral loads in the simple infection group and the preventive treatment group on the 7th day were higher than those on the 10th day. Compared with the simple infection group, the viral loads in the CS-TPP-rBoIFNα / γNPs and CS-TPP-rBoIFNα / γNPs groups were significantly reduced, and the difference with the CS-TPP-rBoIFNα / γNPs group was extremely significant (P<0.001). As can be seen from the figure, the viral load in the spleen of the simple infection group on the 7th day was extremely different from that of the other groups (P<0.001), and on the 14th day, it was significantly different from that of the groups (P<0.05), indicating that the preventive treatment groups all had an inhibitory effect on viral infection. It can be seen from the viral load in the blood and feces that the groups treated with CS-TPP-rBoIFNα / γNPs and CS-TPP-rBoIFNα / γNPs can reduce the viral load in the tissues, and the viral load in the mouse tissues of the CS-TPP-rBoIFNα / γNPs group is relatively lower, especially on the 14th day, the effect of the CS-TPP-rBoIFNα / γNPs group is significantly better than that of the CS-TPP-rBoIFNα / γNPs group. No virus was detected in the tissue and organ samples of the control group. In summary, the experimental results show that CS-TPP-rBoIFNα / γNPs and CS-TPP-rBoIFNα / γNPs can effectively reduce the viral load in various tissues after acting on mice, and have certain antiviral activity. In addition, CS-TPP-rBoIFNα / γNPs has the best effect in enhancing the antiviral activity of recombinant bovine interferon, and can still play a significant role on the 14th day.

[0154] 1.11.5 Histopathological changes

[0155] like Fig.13From the histopathological observation, it can be seen that the duodenal damage in the simple BVDV infection group is more serious, and the intestinal villi are short, small in number and loosely arranged in the field of view; a small number of mucosal epithelial cells are missing (black arrows), the lamina propria is exposed, and a small number of villus tips fall off (brown arrows), but no obvious necrosis is observed. In the rBoIFNα / γ group and CS-TPP-rBoIFNα / γNPs group, the intestinal villi are long and abundant in number; mucosal epithelial cells occasionally fall off (black arrows), and a small number of mucosal epithelial cells are edematous (red arrows) and separated from the lamina propria (yellow arrows); the damage in the CS-TPP-rBoIFNα / γNPs group is relatively mild. No obvious pathological changes were observed in the duodenum of the control group. By observing the pathological changes of mesenteric lymph nodes in each group, it was found that a small amount of lymphocyte punctate necrosis (black arrows) was observed in the field of vision of the simple BVDV infection group and the rBoIFNα / γ group, with condensed and fragmented nuclei, enhanced eosinophilia, and unclear structure; the punctate necrosis of lymphocytes in the CS-TPP-rBoIFNα / γNPs group was relatively small (black arrows), but the nuclei were still condensed and fragmented, with unclear structure, and no obvious bleeding was observed in the above groups. The morphological structure of mesenteric lymph node lymphocytes in the control group was normal, the cells were mostly round, the nucleus was large, the nuclear-cytoplasmic ratio was high, the cells were closely arranged, and no obvious pathological changes were observed. In summary, compared with the simple BVDV infection group, the prevention and treatment groups reduced the damage of duodenal and mesenteric lymph nodes to varying degrees, among which the CS-TPP-rBoIFNα / γNPs group had the best effect.

[0156] The CS-TPP-rBoIFNα / γNPs prepared by the present invention can significantly improve the antiviral activity of rBoIFNα / γ, and CS-TPP-rBoIFNα / γNPs can reduce the clinical symptoms, viremia levels and tissue damage in mice. In addition, CS-TPP-rBoIFNα / γNPs can also inhibit the expression of inflammatory factors induced by BVDV and reduce the viral load in various tissues. In summary, CS-TPP-rBoIFNα / γNPs is an effective preparation against BVDV infection, providing a new idea for the prevention and treatment of BVDV.

[0157] The incidence of calf diarrhea caused by BVDV has increased year by year, affecting the health of calves and public health safety, and causing great economic losses to the cattle industry. CS-TPP-rBoIFNα / γNPs is an effective preparation against BVDV infection. By injecting calves, it can theoretically reduce tissue damage and infection symptoms, reduce viremia levels and viral loads in tissues, inhibit the expression of inflammatory factors in calves, and enhance the antiviral ability of calves. It can be used for the prevention and treatment of BVDV in calves.

[0158] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent change made to the above embodiment according to the technical essence of the invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A method for preparing chitosan nanoparticles loaded with recombinant bovine interferon α / γ, characterized in that: The method is: S1. Expression and purification of recombinant bovine interferon α / γ: S101, transform the pET28a empty plasmid into E.coil BL21 competent cells, pick single clones, perform PCR identification, select positive clones and expand them into LB medium containing Kan resistance at a ratio of 1:100, and culture at 37°C and 200 rpm until OD 600 When the value is 0.6-0.8, bacterial solution A is obtained; 1 mL of the bacterial solution A was centrifuged at 4°C and 10,000 rpm for 1 min, the precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and the mixture was boiled in boiling water for 10 min to obtain the pET28a empty vector before induction; IPTG with a final concentration of 1 mmol / L was added to the remaining bacterial solution A for induction for 4 h. After the induction, 1 mL was taken, and centrifuged at 4°C and 10,000 rpm for 1 min. The precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and boiled in boiling water for 10 min to obtain the induced pET28a empty vector; S102, transform the pET28a-rBoIFNα / γ plasmid into E.coilBL21 competent cells, pick single clones, perform PCR identification, select positive clones and expand them into LB medium containing Kan resistance at a ratio of 1:100, and culture at 37°C and 200 rpm until OD 600 When the value is 0.6-0.8, bacterial solution B is obtained; 1 mL of the bacterial solution B was centrifuged at 4°C and 10,000 rpm for 1 min, the precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and the mixture was boiled in boiling water for 10 min to obtain pre-induced rBoIFNα / γ; IPTG with a final concentration of 1 mmol / L was added to the remaining bacterial solution B for induction for 4 hours. After the induction, the induced bacterial solution B was obtained. 1 mL of the induced bacterial solution B was taken, and centrifuged at 4°C and 10000 rpm for 1 min. The precipitate was resuspended with PBS, 30 μL was taken, 10 μL of 4× protein loading buffer was added, and boiled with boiling water for 10 min to obtain induced rBoIFNα / γ; S103, centrifuging the induced rBoIFNα / γ obtained in S102 at 4°C and 10,000 rpm for 5 min, resuspending the precipitate with PBS, and performing ultrasound in an ice bath to obtain bacterial solution C; Take 30 μL of the bacterial solution C, add 10 μL of 4× protein loading buffer, boil in boiling water for 10 min, and obtain the whole rBoIFNα / γ bacteria after ultrasonication; Then the remaining bacterial solution C was centrifuged again at 4°C and 10000rpm, and 30 μL of the supernatant and the precipitate after centrifugation were taken, 10 μL of 4× protein loading buffer was added, and boiled in boiling water for 10 minutes to obtain the supernatant and precipitate after ultrasound, respectively; S104, performing solubility identification on the pET28a empty load before induction, the pET28a empty load after induction obtained in S101, the rBoIFNα / γ before induction, the rBoIFNα / γ after induction obtained in S102, the whole rBoIFNα / γ after ultrasound, the supernatant after ultrasound, and the precipitate after ultrasound obtained in S103 to determine whether the rBoIFNα / γ protein is expressed in inclusion bodies or in a soluble manner; S105. After identifying that rBoIFNα / γ is expressed in inclusion bodies, the induced bacterial solution B obtained in S102 is centrifuged at 4°C and 10,000 rpm for 15 min, the precipitate is resuspended in PBS, ultrasonicated in an ice bath, centrifuged, and the precipitate is resuspended in PBS, added with Binding Buffer for overnight denaturation, and centrifuged at 4°C and 10,000 rpm for 15 min the next day to obtain the denatured supernatant of the inclusion body protein, and the protein is purified using a His tag protein purification kit to obtain purified recombinant bovine interferon α / γ, i.e., purified rBoIFNα / γ; S2. Renaturation of recombinant bovine interferon α / γ: The purified rBoIFNα / γ obtained in S105 was added to a dialysis bag, placed in a renaturation solution at 4°C for 24 hours, and after renaturation, transferred to PBS and dialyzed for 24 hours to obtain renatured rBoIFNα / γ; S3. Preparation of chitosan nanoparticles loaded with recombinant bovine interferon α / γ: Dissolve chitosan powder in 2% acetic acid aqueous solution, stir magnetically for 2 hours to obtain a chitosan solution, filter with a 0.45 μm filter, dissolve the renatured rBoIFNα / γ obtained in S2 in the filtered chitosan solution, stir for 30 minutes, and obtain a chitosan solution containing rBoIFNα / γ; A sodium tripolyphosphate aqueous solution with a concentration of 1.5 mg / mL was added dropwise to the chitosan solution containing rBoIFNα / γ at a dropping rate of 15 mL / h, and magnetic stirring was performed at a rotation speed of 700 rpm for 30 min to obtain a suspension of chitosan nanoparticles loaded with recombinant bovine interferon α / γ, which was named CS-TPP-rBoIFNα / γNPs suspension; after freeze-drying, chitosan nanoparticles loaded with recombinant bovine interferon α / γ were obtained, which were named CS-TPP-rBoIFNα / γNPs.

2. The method for preparing chitosan nanoparticles loaded with recombinant bovine interferon α / γ according to claim 1, characterized in that: The method for purifying protein in the His-tag protein purification kit in S106 is as follows: 3 mL of Ni-NTA is added to a 10 mL chromatography column, and after the gel and liquid are separated, the outlet is opened to remove anhydrous ethanol, and then the column is washed with distilled water and Binding Buffer in sequence; the supernatant after the inclusion body protein is denatured is filtered through a 0.45 μm filter membrane, and the supernatant after the inclusion body protein is denatured is added to the chromatography column at a rate of 15 mL / h, and then the protein purification column is washed with 15 times the column volume of Binding Buffer, and finally 1.5 times the column volume of Elution Buffer is added to elute the protein, and the eluted protein solution is collected to obtain purified recombinant bovine interferon α / γ.

3. The method for preparing chitosan nanoparticles loaded with recombinant bovine interferon α / γ according to claim 1, characterized in that: The refolding solution in S2 is prepared by adding 8.71 g of arginine, 0.0612 g of oxidized glutathione, and 0.09 g of reduced glutathione to distilled water to make the volume to 100 mL.

4. The method for preparing chitosan nanoparticles loaded with recombinant bovine interferon α / γ according to claim 1, characterized in that: The concentration of chitosan in the chitosan solution in S3 is 2 mg / mL.

5. The method for preparing chitosan nanoparticles loaded with recombinant bovine interferon α / γ according to claim 1, characterized in that: The concentration of rBoIFNα / γ in the chitosan solution containing rBoIFNα / γ in S3 is 1 mg / mL.

6. The method for preparing chitosan nanoparticles loaded with recombinant bovine interferon α / γ according to claim 1, characterized in that: The volume ratio of the sodium tripolyphosphate aqueous solution with a concentration of 1.5 mg / mL and the chitosan solution containing rBoIFNα / γ in S3 is 1:

5.

7. An application of chitosan nanoparticles loaded with recombinant bovine interferon α / γ prepared by the preparation method according to claims 1-6, characterized in that: The chitosan nanoparticles loaded with recombinant bovine interferon α / γ are used for preparing medicine for preventing and treating bovine viral diarrhea virus BVDV.

Images