Preparation method and application of tetravalent hand-foot-and-mouth disease subunit-new adjuvant vaccine

Abstract

The invention discloses a preparation method and application of a tetravalent hand-foot-and-mouth disease subunit-new adjuvant vaccine, and relates to the technical field of hand-foot-and-mouth disease vaccines. VP1 proteins of EV-A71, CV-A16, CV-A10 and CV-A6 are expressed through an insect cell-baculovirus system, the VP1 proteins are purified through a nickel affinity chromatography column and mixed with an MF59 adjuvant to prepare a tetravalent vaccine, in-vivo evaluation of mice is conducted, and meanwhile the immunogenicity and protection efficacy of the tetravalent VP1 protein vaccine and the immunogenicity and protection efficacy of a monovalent VP1 protein vaccine are compared. Immune results show that compared with a VP1 monovalent vaccine, all serum of a mouse inoculated with the tetravalent VP1 protein vaccine shows strong reactivity to all captured antigens. Therefore, the results show that the prepared tetravalent subunit-new adjuvant vaccine is a promising broad-spectrum vaccine.

Description

Technical Field

[0001] The present invention relates to the technical field of hand, foot and mouth disease vaccines, and in particular to a preparation method and application of a quadrivalent hand, foot and mouth disease subunit-new adjuvant vaccine. Background Art

[0002] HFMD occurs primarily in children under 5 years of age and is associated with oral ulcers, anorexia, low-grade fever, and small blisters or ulcers on the hands, feet, and mouth. Most children recover on their own in about a week, although sometimes the infection can cause complications such as viral myocarditis, pulmonary edema, aseptic meningoencephalitis, and cognitive impairment mediated by neuroinflammation. In addition, HFMD progresses rapidly in individual children with severe disease, leading to death. On December 3, 2015, the China Food and Drug Administration (CFDA) approved the first EV-A71 vaccine for the prevention of HFMD, which has played an important role in controlling the epidemic of HFMD caused by EV-A71-related infections; however, it lacks the ability to provide cross-protection against other enteroviruses that cause HFMD, making the control of HFMD a major challenge.

[0003] Group A enterovirus is the main enterovirus that causes hand, foot and mouth disease, among which EV-A71, CV-A16, CV-A10 and CV-A6 are the main viral pathogenic strains. Relevant epidemiological survey results show that in China, the number of EV-A71-related incidence, severe and death cases has dropped significantly. From 2013 to 2015, severe hand, foot and mouth disease caused by EV-A71 accounted for 62.8%, while from 2017 to 2019, severe hand, foot and mouth disease caused by non-EV-A71 enterovirus accounted for 67.2%; in addition, the capsid of enterovirus is composed of structural proteins and non-structural proteins. The structural proteins are VP1, VP2, VP3, and VP4, among which VP1 and VP2 proteins are exposed on the surface of the virus, and VP1 protein contains the main antigenic determinants.

[0004] Therefore, based on the above situation, it is necessary to develop a broader-spectrum and more effective vaccine to control other types of pathogen infections. This is one of the technical problems that researchers are currently working on. Summary of the invention

[0005] The purpose of the present invention is to provide a preparation method and application of a quadrivalent hand, foot and mouth disease subunit-new adjuvant vaccine to solve the problems raised in the above background technology.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] A hand, foot and mouth disease subunit-new adjuvant vaccine, the vaccine comprises the VP1 protein of the hand, foot and mouth disease virus and an adjuvant; wherein the hand, foot and mouth disease virus is any one or more of EV-A71, CV-A16, CV-A10, and CV-A6, and the adjuvant is MF59 adjuvant.

[0008] The more optimized solution is a quadrivalent HFMD subunit-new adjuvant vaccine, wherein the HFMD virus VP1 protein is a combination of EV-A71 VP1 protein, CV-A16 VP1 protein, CV-A10 VP1 protein, and CV-A6 VP1 protein. The adjuvant is MF59 adjuvant.

[0009] In a more optimized scheme, the mass ratio of the VP1 protein of EV-A71, the VP1 protein of CV-A16, the VP1 protein of CV-A10, the VP1 protein of CV-A6, and the MF59 adjuvant is 1:1:1:1:(18-20).

[0010] The most optimized scheme is based on the preparation method of the hand, foot and mouth disease subunit-new adjuvant vaccine described above. Under sterile conditions, the VP1 protein of the hand, foot and mouth disease virus and the phosphate buffer are evenly mixed to obtain a protein solution, and the protein solution is mixed with the MF59 adjuvant and shaken for 15 to 20 minutes to obtain the hand, foot and mouth disease subunit-new adjuvant vaccine; wherein the hand, foot and mouth disease virus is any one or more of EV-A71, CV-A16, CV-A10, and CV-A6. The volume ratio of the protein solution to the MF59 adjuvant is 1:1.

[0011] The most optimized solution is to prepare the VP1 protein of hand, foot and mouth disease virus as follows:

[0012] Step 1: Select any one of the hand, foot and mouth disease viruses EV-A71 (GenBank: QQL05585.1), CV-A16 (GenBank: BBC44551.1), CV-A10 (GenBank: AEP43825.1), and CV-A6 (GenBank: QWY15465.1), optimize the VP1 protein sequence of the virus using BLAST, clone the optimized nucleotide sequence into the vector, sequence the entire plasmid, and obtain the expression vector;

[0013] Step 2: Transform the expression vector containing the VP1 gene of different hand, foot and mouth disease viruses into Escherichia coli DH10Bac competent cells, screen for blue-white spots, extract positive plasmids, and collect them by ethanol precipitation after expansion culture to obtain the recombinant virus Bacmid plasmid;

[0014] Step 3: Use insect cell transfection reagent to transfect the recombinant virus Bacmid plasmid into insect cells to obtain P0 generation baculovirus, and then inoculate the insect cells with the P0 generation baculovirus at an inoculation concentration of MOI = 0.1. Collect the cells after 3 to 4 days, freeze-thaw and lyse the cells, harvest the supernatant, separate and purify, and obtain the purified VP1 protein of hand, foot and mouth disease virus.

[0015] In a more optimized scheme, in step 1, the nucleotide sequence of the optimized EV-A71 protein is shown as SEQ ID NO.1; the nucleotide sequence of the optimized CV-A16 protein is shown as SEQ ID NO.2; the nucleotide sequence of the optimized CV-A10 protein is shown as SEQ ID NO.3; and the nucleotide sequence of the optimized CV-A6 protein is shown as SEQ ID NO.4.

[0016] The nucleotide sequence of EV-A71 protein is SEQ ID NO.1:

[0017] GAAACAACCCTGGACAGCTTCTTCTCCCGCGCTGGTCTAGTGGGAGAAATAGACTTGCCTCTGAAGGGGACCACAAATCCAAATGGCTATGCGAACTGGGACATTGACATCACTGGTTATGCTCAAATGCGGAGGAAAGTGGAGCTCTTCACCTACATGAGATTTGATGCAGAGTTCACTTTTGTGGCCTGCACTCCAACAGGGGAAGTGGTGCCCCAGCTGCTCCAGTACAT GTTTGTTCCACCTGGGGCTCCGAAACCAGATTCTCGAGAAAGTTTAGCCTGGCATACAGCAACCAATCCCAGCGTCTTTGTCAAGCTTACGGATCCTCCAGCCCAAGTATCTGTTCCCTTCATGTCACCTGCTTCCGCCTACCAGTGGTTCTATGATGGCTACCCTGCCTTTGGAGAGCACAAGCAGGAGAAGGACCTGGAGTACGGAGCATGTCCCAACAACATGATGGGC.

[0018] The nucleotide sequence of CV-A16 protein is shown in SEQ ID NO.2:

[0019] GCGAGTGACAAGAACCTGATAGAGACTCGCTGTGTCCTCAATCATCATTCCACACAAGAAACAGCCATTGGAAACTTCTTCTCAAGAGCAGGTTTAGTTAGCATCATCACCATGCCAACCACTGGTACCCAGAATACAGATGGGTATGTGAACTGGGATATTGACCTGATGGGCTATGCCCAACTTCGAAGGAAATGTGAGCTGTTCACCTACATGAGGTTTGATGCTGAATTTACTTTTGTGGTGGCCAAGCCAAATGGAGAACTCGTGCCTCAGCTGCTTCAATATATGTACGTACCGCCTGGGGCTCCAAAACCCACCAGTAGAGACAGCTTTGCCTGGCAGACTGCTACAAATCCATCAGTATTTGTCAAGATGACAGACCCCCCTGCTCAGGTGTCTGTTCCTTTCATGTCCCCTGCATCGGCCTACCAGTGGTTCTATGATGGCTACCCCACGTTTGGAGAGCACCTGCAGGCCAATGATCTAGACTATGGCCAGTGCCCCAACAACATGATGGGGACCTTCTCCATCCGCACTGTGGGCACAGAGAAATCTCCACACAGCATTACGTTGCGTGTCTACATGAGAATCAAGCACGTCCGGGCATGGATCCCAAGGCCTTTGCGGAACCAGCCCTACCTCTTCAAGACCAACCCCAAT。

[0020] The nucleotide sequence of CV-A10 protein is as SEQ ID NO.3:

[0021] CCGACTGGTGCTCCCAAGCCCACTGGGAGAGATGCCTTCCAGTGGCAGACAGCCACCAACCCTAGCATATTTGTGAAGCTAACAGACCCTCCAGCTCAAGTATCTGTTCCTTTCATGTCACCTGCATCTGCCTACCAGTGGTTCTATGATGGCTACCCAACATTTGGGCAGCACCCAGAGACGAGCAATACAGCTTATGGCCTCTGCCCAAATAATATGATGGGAACCTTTGCTGTGCGCGTTGTCTCCACTGTGGCGAGTCAGCTGAAACTTCAAACCAGAGTCTACATGAAGCTGAAGCATGTGAAAGCCTGGATTCCTAGGCCCATCCGATCGCAGCCCTACCTGTTGAAAAACTTCCCCAACTATGACAACAGCAAAATTGCAAATAGTGCACGGGACAGGTCATCCATCAAGCAGGCCAACATGGGCAAGTTTGGA。

[0022] The nucleotide sequence of CV-A6 protein is as SEQ ID NO.4:

[0023] AATGATCCGATTACGAACGCTGTGGAAAGTGCAGTGTCTGCCCTGGCAGACACAACTATCAGCAGAGTGACTGCTGCTAACACTGCCGCATCTACTCATAGTCTGGGCACTGGGCGCGTCCCAGCACTACAAGCCGCCGAGACAGGCGCGTCATCCAACGCCTCAGATGAGAACCTCATTGAGACCCGGTGCGTCATGAACAGAAATGGCGTTAATGAAGCTTCTGTAGAACACTTCTACTCGAGGGCAGGATTAGTTGGGGTGGTGGAGGTGAAAGATTCCGGCACCTCACTTGACGGTTATACTGTGTGGCCTATCGATGTGATGGGATTTGTGCAGCAGAGGCGGAAGCTGGAGCTCAGCACATATATGAGGTTTGATGCTGAGTTCACCTTCGTCAGCAACCTGAATGACAGCACAACACCTGGAATGCTGCTGCAGTACATGTACGTACCTCCAGGTGCCCCAAAACCTGACAGTAGGAAATCCTACCAGTGGCAGACTGCAACGAATCCAAGCATATTTGCGAAGTTGAGTGACCCACCACCCCAGGTGTCCGTTCCCTTCATGTCACCCGCCACAGCATATCAATGGTTCTATGATGGCTACCCGACCTTTGGAGAACACAAGCAGGCCACCAATTTGCAGTATGGGCAGTGTCCTAACAACATGATGGGCCACTTTGCTATCCGTACAGTTTCCGAGTCTACCACTGGAAAAAATGTTCATGTCCGAGTCTACATGCGCATCAAGCATGTAAGAGCCTGGGTCCCTCGACCCCTTCGGTCTCAAGCCTACATGGTCAAGAACTACCCAACCTACTCTCAGACCATTACCAATACCGCTGCTGACCGCGCTTCCATAACCACAACAGACTATGAAGGTGGGGTGCCCGCCAACCCCCAAAGAACGAGC。

[0024] In a more optimized scheme, in step 1, the vector is a pFastBac vector; in step 3, the insect cell is an Sf9 cell. The insect cell Sf9 is cultured in Sf-900TM II SFM (gibco, 10902104), maintained at 27°C. The insect cell transfection reagent was Mirus

[0025] In the more optimized scheme, in step 3, the separation and purification steps are: use the equilibration buffer (0.15M NaCl, 20mM Na2HPO4) to equilibrate the nickel column, load the supernatant onto the column, repeat twice, elute the VP1 protein with 0.1M glycine, and collect the eluate to obtain the purified VP1 protein of hand, foot and mouth disease virus; the purified VP1 protein of hand, foot and mouth disease virus is neutralized to neutrality by adding 1M Tris-HCL in a volume ratio of 1:1, and stored at -80℃ for use.

[0026] A more optimized scheme is based on the use of the above-mentioned vaccine in the treatment or prevention of hand, foot and mouth disease.

[0027] Compared with the prior art, the beneficial effects achieved by the present invention are:

[0028] The present invention discloses a preparation method and application of a quadrivalent hand, foot and mouth disease subunit-new adjuvant vaccine. The VP1 proteins of EV-A71, CV-A16, CV-A10 and CV-A6 are expressed by an insect cell-baculovirus system, purified by a nickel affinity chromatography column and mixed with an MF59 adjuvant to prepare a quadrivalent vaccine, which is evaluated in mice, and the immunogenicity and protective efficacy of the quadrivalent VP1 protein vaccine are compared with those of the monovalent VP1 protein vaccine. The immunization results showed that all sera of mice vaccinated with the quadrivalent VP1 protein vaccine showed strong reactivity to all captured antigens compared with the VP1 monovalent vaccine. Treatment with the quadrivalent VP1 protein vaccine completely protected the recipient mice from single infection with EV71, CVA16, CVA10 or CVA6. Therefore, these results indicate that the quadrivalent subunit-new adjuvant vaccine prepared by us is a promising broad-spectrum vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a schematic diagram of the construction of the recombinant plasmid of the present invention;

[0030] Figure 2 Schematic diagram of the antibody response induced by vaccine immunization, where the capture antigen is EV-A71;

[0031] Figure 3 Schematic diagram of the antibody response induced by vaccine immunization, where the capture antigen is CV-A16;

[0032] Figure 4 Schematic diagram of the antibody response induced by vaccine immunization, where the capture antigen is CV-A10;

[0033] Figure 5Schematic diagram of the antibody response induced by vaccine immunization, where the capture antigen is CV-A6;

[0034] Figure 6 This is a schematic diagram of the vaccine neutralizing antibody titer, the virus is EV71 / G082;

[0035] Figure 7 This is a schematic diagram of the vaccine neutralizing antibody titer, the virus is CVA16 / SZ05;

[0036] Figure 8 This is a schematic diagram of the vaccine neutralizing antibody titer, the virus is CVA10 / S0273b;

[0037] Fig. 9 This is a schematic diagram of the vaccine neutralizing antibody titer, the virus is CVA6 / Gdula;

[0038] Fig.10 This is a schematic diagram of the vaccine's protective effect against virus infection. DETAILED DESCRIPTION

[0039] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] Example 1: The steps for preparing the VP1 protein of hand, foot and mouth disease virus are as follows:

[0041] Step 1: Select any one of the hand, foot and mouth disease viruses EV-A71 (GenBank: QQL05585.1), CV-A16 (GenBank: BBC44551.1), CV-A10 (GenBank: AEP43825.1), and CV-A6 (GenBank: QWY15465.1), optimize the VP1 protein sequence of the virus using BLAST, clone the optimized nucleotide sequence into the vector, sequence the entire plasmid, and obtain an expression vector; the vector is a pFastBac vector.

[0042] The optimized nucleotide sequence of EV-A71 protein is shown in SEQ ID NO.1; the optimized nucleotide sequence of CV-A16 protein is shown in SEQ ID NO.2; the optimized nucleotide sequence of CV-A10 protein is shown in SEQ ID NO.3; and the optimized nucleotide sequence of CV-A6 protein is shown in SEQ ID NO.4.

[0043] Step 2: Transform the expression vector containing the VP1 gene of different hand, foot and mouth disease viruses into Escherichia coli DH10Bac competent cells, screen for blue-white spots, extract the positive plasmid, expand the culture and collect it by ethanol precipitation to obtain the recombinant virus Bacmid plasmid.

[0044] Step 3: Use insect cell transfection reagent to transfect the recombinant virus Bacmid plasmid into insect cells to obtain P0 generation baculovirus, then inoculate the P0 generation baculovirus into insect cells at an inoculation concentration of MOI = 0.1, collect the cells after 3 to 4 days, freeze-thaw and lyse the cells, harvest the supernatant, separate and purify, and obtain the purified VP1 protein of hand, foot and mouth disease virus. The insect cells are Sf9 cells. The insect cells Sf9 are cultured in Sf-900 TM II SFM (gibco, 10902104), maintained at 27°C. The insect cell transfection reagent was Mirus

[0045] In step 3, the separation and purification steps are as follows: use an equilibrium buffer (0.15M NaCl, 20mM Na2HPO4) to balance the nickel column, load the supernatant onto the column, repeat twice, elute the VP1 protein with 0.1M glycine, and collect the eluate to obtain the purified VP1 protein of hand, foot and mouth disease virus; the purified VP1 protein of hand, foot and mouth disease virus is neutralized to neutrality by adding 1M Tris-HCL in a volume ratio of 1:1, and stored at -80°C for use.

[0046] In the present invention, the VP1 genes of EV-A71, CV-A16, CV-A10 and CV-A6 are respectively inserted into the pFastBac vector to construct a recombinant plasmid, and then transfected into Sf9 insect cells. The specific schematic diagram of the recombinant plasmid construction can be seen in Figure 1 .

[0047] Embodiment 2:

[0048] According to the method disclosed in Example 1, the VP1 protein of EV-A71, the VP1 protein of CV-A16, the VP1 protein of CV-A10, and the VP1 protein of CV-A6 were prepared respectively; and the vaccine was prepared according to the following method; the specific proportions are shown in Table 1 below.

[0049] Immunization group 1: 50 μL PBS (phosphate buffered saline) was mixed with 50 μg MF59 adjuvant and shaken for 15 to 20 minutes.

[0050] Immunization groups 2-5: Under sterile conditions, 10 μg of any one of the VP1 proteins of EV-A71, CV-A16, CV-A10, and CV-A6 was dissolved in 50 μL PBS (phosphate buffer) to obtain a protein solution; 50 μg of MF59 adjuvant was dissolved in PBS (phosphate buffer), the volume was fixed to 50 μL, and the required protein solution was added and mixed, and shaken for 15-20 minutes.

[0051] Immunization group 6: Under sterile conditions, 10 μg of EV-A71 VP1 protein, 10 μg of CV-A16 VP1 protein, 10 μg of CV-A10 VP1 protein and 10 μg of CV-A6 VP1 protein were mixed and dissolved in 50 μL PBS (phosphate buffer) to obtain a protein solution; 200 μg of MF59 adjuvant was dissolved in PBS (phosphate buffer), the volume was fixed to 50 μL, and the required protein solution was added and mixed, and the mixture was shaken for 15 to 20 minutes.

[0052] Table 1 Vaccine preparation scheme

[0053]

[0054] Test experiment 1: Antibody response induced by immunization with quadrivalent subunit combination vaccine

[0055] Seven-week-old BALB / c female mice were randomly divided into 6 groups, 6 mice / group, and the prepared vaccines (immunization groups 1-6) were injected intramuscularly for the first immunization on day 0 and for the booster immunization on day 14. Antiserum was obtained one week after the booster immunization and diluted to 1:1000. Then, the VP1 protein of EV-A71, VP1 protein of CV-A16, VP1 protein of CV-A10, and VP1 protein of CV-A6 were used as coating antigens, and antigen-specific IgG antibodies were analyzed by ELISA.

[0056] Specific test results such as Figure 2 to Figure 5 As shown, each symbol represents one mouse, and the solid line indicates the geometric mean of the group. (Statistical significance was determined by two-tailed Student's t test and is indicated as follows: ns; no significant difference (P ≥ 0.05); *P < 0.05; **P < 0.01; and ***P < 0.001).

[0057] The results showed that sera from mice immunized with VP1 monovalent vaccine reacted with their corresponding antigens but not with other antigens, indicating that antigen-specific antibody responses occurred in mice after immunization with VP1 monovalent vaccine. In contrast, all sera from mice vaccinated with Tetra-VP1 showed strong reactivity to all captured antigens.

[0058] Test 2: Antibody response induced by immunization with quadrivalent subunit combination vaccine

[0059] In order to test the neutralization reaction of the quadrivalent vaccine, the individual antisera collected one week after booster immunization were further tested for their ability to neutralize EV71, CVA16, CVA10 and CVA6 viruses in vitro using a microneutralization assay; the specific method is: the virus dilution was cultured with cells in a 96-well plate, and the presence of CPE in each well was monitored to calculate the virus titer. After that, 100TCID50 of the virus was co-incubated with gradient diluted mouse serum for 1 hour and then added to new uninfected cells, and the pathological changes were observed regularly.

[0060] Specific test results such as Figure 6 to Figure 9 As shown (statistical significance was determined by two-tailed Student’s t test and are indicated as follows: ns; no significant difference (P ≥ 0.05); *P < 0.05; **P < 0.01; and ***P < 0.001).

[0061] The sera from immune group 1 (CTL group) showed no virus neutralizing activity at the lowest dilution tested (1:16), while anti-EV71-VP1 (immune group 2), anti-CVA16-VP1 (immune group 3), anti-CVA10-VP1 (immune group 4), and anti-CVA6-VP1 (immune group 5) sera had effective virus neutralizing activity, neutralizing the corresponding homologous viruses EV71 / G082, CVA16 / SZ05, CVA10 / S0273b, and CVA6 / Gdula with geometric mean titers (GMTs) of 5461, 3413, 6826, and 6826, respectively. However, all monovalent vaccine immune sera failed to neutralize the heterologous viruses tested at a dilution of 1:16. In contrast, all sera from the Tetra-VP1 group (immune group 6) strongly neutralized EV71 / G082, CVA16 / SZ05, CVA10 / S0273b, and CVA6 / Gdula, with GMTs of 6144, 3754, 7509, and 7509, respectively, which were comparable to the neutralizing antibody titers induced by the corresponding monovalent vaccines, indicating that the quadrivalent vaccine showed good compatibility in inducing neutralizing antibodies.

[0062] Test 4: The protective effect of quadrivalent subunit combination vaccine against virus

[0063] Previous studies have shown that EV71 strain EV71 / MAV-W, CVA16 strain CVA16 / MAV, CVA10 clinical isolate CVA10 / S0148b, and CVA6 clinical isolate CVA6 / S0087b can infect ICR suckling mice, causing limb weakness, paralysis, and death. Therefore, these strains were used for the challenge protection experiments in this study.

[0064] Female mice were immunized with the prepared tetravalent subunit combination vaccine (immunization group 6), monovalent vaccine (immunization groups 2 to 5), and PBS (immunization group 1), and mated with male mice on day 28 after immunization. On day 42 after immunization, mice were infected with a lethal dose of EV71 / MAV-W, CVA16 / MAV, CVA10 / S0148b, or CVA6 / S0087b. The clinical scores and survival of the suckling mice were observed every day for 15 days.

[0065] Test results such as Fig.10 As shown, mice treated with PBS (immune group 1) antiserum began to show clinical symptoms at 2-4 dpi after challenge, and these mice eventually died at 7 dpi. Mice receiving monovalent vaccine immune serum were completely protected from homotypic virus infection, but showed symptoms and mortality similar to the control group when infected with heterotypic viruses. Tetra-VP1 immune serum treatment completely protected recipient mice from single infection with EV71, CVA16, CVA10 or CVA6.

[0066] Conclusion: The present invention discloses a preparation method and application of a quadrivalent hand, foot and mouth disease subunit-new adjuvant vaccine. The VP1 proteins of EV-A71, CV-A16, CV-A10 and CV-A6 were expressed by the insect cell-baculovirus system, purified by nickel affinity chromatography column and mixed with MF59 adjuvant to prepare a quadrivalent vaccine, which was evaluated in mice, and the immunogenicity and protective efficacy of the quadrivalent VP1 protein vaccine were compared with those of the monovalent VP1 protein vaccine. The immunization results showed that compared with the VP1 monovalent vaccine, all sera of mice vaccinated with Tetra-VP1 showed strong reactivity to all captured antigens. Further experiments showed that all sera in the Tetra-VP1 group strongly neutralized EV71 / G082, CVA16 / SZ05, CVA10 / S0273b and CVA6 / Gdula, with GMTs of 6144, 3754, 7509 and 7509, respectively. Finally, the in vivo challenge protection effect was tested using EV71 strain EV71 / MAV-W, CVA16 strain CVA16 / MAV, CVA10 clinical isolate CVA10 / S0148b and CVA6 clinical isolate CVA6 / S0087b. The results showed that Tetra-VP1 immune serum treatment completely protected recipient mice from single infection with EV71, CVA16, CVA10 or CVA6. Therefore, these results indicate that the tetravalent subunit-new adjuvant vaccine we prepared is a promising broad-spectrum candidate vaccine.

[0067] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0068]

[0069]

[0070]

[0071]

Claims

1. A hand, foot and mouth disease subunit-new adjuvant vaccine, characterized in that: The vaccine comprises the VP1 protein of the hand, foot and mouth disease virus and an adjuvant; wherein the hand, foot and mouth disease virus is any one or more of EV-A71, CV-A16, CV-A10, and CV-A6, and the adjuvant is MF59 adjuvant.

2. A hand, foot and mouth disease subunit-new adjuvant vaccine according to claim 1, characterized in that: The VP1 protein of the hand, foot and mouth disease virus is a composite of four of the VP1 protein of EV-A71, the VP1 protein of CV-A16, the VP1 protein of CV-A10 and the VP1 protein of CV-A6.

3. A hand, foot and mouth disease subunit-new adjuvant vaccine according to claim 2, characterized in that: The mass ratio of the VP1 protein of EV-A71, the VP1 protein of CV-A16, the VP1 protein of CV-A10, the VP1 protein of CV-A6, and the MF59 adjuvant is 1:1:1:1:(18-20).

4. The method for preparing a hand, foot and mouth disease subunit-new adjuvant vaccine according to any one of claims 1 to 3, characterized in that: Under sterile conditions, the VP1 protein of the hand, foot and mouth disease virus and phosphate buffer are evenly mixed to obtain a protein solution, the protein solution is mixed with the MF59 adjuvant, and the mixture is shaken for 15 to 20 minutes to obtain a hand, foot and mouth disease subunit-new adjuvant vaccine; The hand, foot and mouth disease virus is any one or more of EV-A71, CV-A16, CV-A10, and CV-A6.

5. The method for preparing a hand, foot and mouth disease subunit-new adjuvant vaccine according to claim 4, characterized in that: The volume ratio of protein solution and MF59 adjuvant was 1:

1.

6. The method for preparing a hand, foot and mouth disease subunit-new adjuvant vaccine according to claim 5, characterized in that: The steps for preparing the VP1 protein of hand, foot and mouth disease virus are as follows: Step 1: Select any one of the hand, foot and mouth disease viruses EV-A71, CV-A16, CV-A10, and CV-A6, optimize the VP1 protein sequence of the virus using BLAST, clone the optimized nucleotide sequence into the vector, sequence the entire plasmid, and obtain the expression vector; Step 2: Transform the expression vector containing the VP1 gene of different hand, foot and mouth disease viruses into Escherichia coli DH10Bac competent cells, screen for blue-white spots, extract positive plasmids, and collect them by ethanol precipitation after expansion culture to obtain the recombinant virus Bacmid plasmid; Step 3: Use insect cell transfection reagent to transfect the recombinant virus Bacmid plasmid into insect cells to obtain P0 generation baculovirus, and then inoculate the insect cells with the P0 generation baculovirus at an inoculation concentration of MOI = 0.

1. Collect the cells after 3 to 4 days, freeze-thaw and lyse the cells, harvest the supernatant, separate and purify, and obtain the purified VP1 protein of hand, foot and mouth disease virus.

7. The method for preparing a hand, foot and mouth disease subunit-new adjuvant vaccine according to claim 6, characterized in that: In step 1, the optimized nucleotide sequence of EV-A71 protein is shown as SEQ ID NO.1; the optimized nucleotide sequence of CV-A16 protein is shown as SEQ ID NO.2; the optimized nucleotide sequence of CV-A10 protein is shown as SEQ ID NO.3; and the optimized nucleotide sequence of CV-A6 protein is shown as SEQ ID NO.

4.

8. The method for preparing a hand, foot and mouth disease subunit-new adjuvant vaccine according to claim 6, characterized in that: In step 1, the vector is a pFastBac vector; in step 3, the insect cell is a Sf9 cell.

9. The method for preparing a hand, foot and mouth disease subunit-new adjuvant vaccine according to claim 6, characterized in that: In step 3, the separation and purification steps are: balance the nickel column with a balance buffer, load the supernatant onto the column, repeat twice, elute the VP1 protein with glycine, and collect the eluate to obtain the purified VP1 protein of hand, foot and mouth disease virus.

10. Use of a hand, foot and mouth disease subunit-new adjuvant vaccine according to any one of claims 1 to 3 in a drug for treating or preventing hand, foot and mouth disease.

Images