Application of RTN3 protein and related biomaterials in regulating rice tiller number
Through RTN3 protein and genome editing technology, the number of rice tillers is regulated, and the problem of insufficient understanding of the molecular genetic network formed by rice tillers is solved, and the rice yield is improved.
Patent Information
- Application Number
- CN202510308268.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-17
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2045-03-17
AI Technical Summary
How to specifically regulate the tiller count of rice, the existing technology lacks understanding of the molecular genetic network formed by rice tillering, which affects the improvement of yield.
The RTN3 protein and its related biological materials are used to regulate the tiller number in rice through gene location and genome editing technology, including the introduction or knockout of the coding gene of RTN3 protein, and gene editing is used to achieve the regulation of the tiller number in rice using pCAMBIA1300 and pYLCRISPR/Cas9Pubi-H-TRTN3 vectors.
Specifically regulate the number of tillers in rice, avoid affecting the spike type, improve the yield potential of rice, break the mutual constraints between tillers and spike types, and achieve a new breakthrough in yield.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present application belongs to the field of genetic engineering technology, and specifically relates to the application of RTN3 protein and related biological materials in regulating the tiller number of rice. Background Art
[0002] Plants in nature possess a diverse array of plant forms, creating a breathtaking landscape. Plant form refers to the overall appearance and structural characteristics of the aboveground part of a plant, generally composed of structures such as plant height, number and angle of branches, and leaf shape. Research has shown that plant form originates from the shoot apical meristem (SAM), which forms during embryonic development. During late embryonic development, the SAM continuously produces growth units consisting of internodes, leaves, and lateral meristems (AM) in the leaf axils, establishing the plant's stem-root axis and ultimately resulting in a wide variety of plant forms. The diversity of plant form in nature not only influences cultivation methods, resource acquisition, and yield optimization, but also regulates environmental adaptation and competitive survival.
[0003] Plant branching is one of the important components of plant shape formation. Plants form different branching types according to the branching rules and patterns of the stem. Plant branching types are mainly divided into the following five categories: (1) Monopodial branching, in which the growth of lateral buds is inhibited and the terminal bud grows upward continuously to form a branching pattern with a single main stem. Most gymnosperms and some angiosperms, such as poplars, ginkgo and many herbaceous plants, have this branching pattern. (2) Sympodial branching, in which the terminal bud of the main stem grows for a period of time and then slows down or even stops growing, while the lateral buds continue to grow in place of the terminal bud, forming new branches. The lateral buds on the branches produce new branches in the same way, thus forming a branching pattern with a tortuous main stem composed of multiple branches. Most angiosperms, such as tomatoes and peach trees, have this branching pattern. (3) Dichotomous branching, in which the growth point at the tip of the stem splits into two, developing into opposite branches, and new branches are continuously produced on this branch, forming an umbrella-like structure. This branching method is relatively ancient and appears in some lower and a few higher plants such as liverworts. (4) Pseudo-binary branching: When the apical bud no longer grows or differentiates into a flower bud, the lateral buds on both sides below it develop and form branches. The growth pattern of the apical bud and lateral buds on the branch is the same as that of the main stem, and the branching method continues to develop in this way. Because this branching method is different from binary branching, it is called pseudo-binary branching. Generally, plants with opposite leaves such as carnations, lilacs, and jasmine belong to this branching method. (5) Tillering: Usually located in the internodes at the base of the main stem of the plant that have not elongated, it is in a clustered state. Tillers have independent root systems and can survive independently after being separated from the main stem. Tillering is common in grass crops such as rice and wheat. As a special type of branching, tillers directly determine the yield per plant by affecting the number of ears per plant. Therefore, exploring the regulatory genes of tiller development and exploring the genetic mechanism behind it has important theoretical value for improving crop plant type and further increasing its yield.
[0004] Tiller number is an important agronomic trait in rice, crucial for increasing yield. In recent years, several regulatory factors have been identified, but their genetic relationships and the molecular genetic networks mediating tiller formation remain largely unknown. Therefore, cloning novel genes that regulate tiller formation in rice and elucidating their regulatory mechanisms will help uncover the genetic regulatory networks underlying tiller development and ultimately improve our ability to rationally improve rice plant architecture. Summary of the Invention
[0005] The technical problem to be solved by the present application is: how to regulate the tiller number of a plant. Specifically, the technical problem to be solved by the present application is: how to specifically regulate the tiller number of rice.
[0006] To solve the above technical problems, the present application provides the use of RTN3 protein and / or biomaterials related to the RTN3 protein in at least one of the following:
[0007] A1) Application in regulating plant tillering number;
[0008] A2) Application in the preparation of products for regulating plant tillering number;
[0009] A3) Application in plant breeding or plant-assisted breeding;
[0010] A4) Use in the preparation of products for plant breeding or plant-assisted breeding;
[0011] The RTN3 protein may be any of the following proteins:
[0012] a1), the amino acid sequence is the protein shown in SEQ ID NO: 3;
[0013] a2) a protein obtained by substituting and / or deleting and / or adding amino acid residues in the amino acid sequence of the protein shown in a1) and having at least 80% identity with the amino acid sequence shown in a1) and associated with plant tillering number;
[0014] a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in a1) or a2).
[0015] In the present application, the plant breeding assessment index may include the number of tillers, more specifically the number of effective tillers.
[0016] In the present application, the purpose of plant breeding may include cultivating plants with altered tiller number (effective tiller number).
[0017] In the present application, the regulation may be improvement, promotion or upregulation.
[0018] In the present application, the regulation may also mean reduction, inhibition or down-regulation.
[0019] In the present application, the protein may be derived from rice.
[0020] In the present application, SEQ ID NO: 3 consists of 578 amino acid residues.
[0021] The above proteins can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0022] A protein tag is a polypeptide or protein that is fused with a target protein using in vitro DNA recombination techniques to facilitate expression, detection, tracing, and / or purification of the target protein. Examples of protein tags include Flag, His, MBP, HA, myc, GST, and / or SUMO tags.
[0023] Furthermore, the linkage described in a3) may be a peptide bond formed between the N-terminus of the tag and the C-terminus of the protein described in a1) or a2) via dehydration condensation. Alternatively, the linkage described in a3) may be a peptide bond formed between the C-terminus of the tag and the N-terminus of the protein described in a1) or a2) via dehydration condensation.
[0024] Furthermore, in the application, the biomaterial may be any of the following:
[0025] B1), a nucleic acid molecule encoding the RTN3 protein;
[0026] B2), an expression cassette and / or construct containing the nucleic acid molecule described in B1);
[0027] B3), a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette and / or construct described in B2);
[0028] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette and / or construct described in B2), or a recombinant microorganism containing the recombinant vector described in B3);
[0029] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette and / or construct described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);
[0030] B6), transgenic plant tissue containing the nucleic acid molecule described in B1), transgenic plant tissue containing the expression cassette and / or construct described in B2), or transgenic plant tissue containing the recombinant vector described in B3);
[0031] B7), a transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette and / or construct described in B2), or a transgenic plant organ containing the recombinant vector described in B3);
[0032] B8), a nucleic acid molecule that inhibits or reduces the expression of the RTN3 protein encoding gene;
[0033] B9) Expression cassettes and / or constructs, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues and / or transgenic plant organs containing the nucleic acid molecule described in B8).
[0034] Furthermore, in the application, the nucleic acid molecule in B1) may be a DNA molecule as described in any one of g1) to g3) below:
[0035] g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO: 2;
[0036] g2), the nucleotide sequence of the coding strand is the DNA molecule of positions 1838-5807 of SEQ ID NO: 1;
[0037] g3) A DNA molecule that has more than 80% identity with the DNA molecule in g1) or g2) and regulates the number of plant tillers.
[0038] Furthermore, in the application, the expression cassette described in B2) refers to a DNA capable of expressing the RTN3 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the RTN3 protein encoding gene, but also a terminator and / or enhancer sequence for terminating transcription of the RTN3 protein encoding gene.
[0039] In some embodiments of the present application, the recombinant vector described in B3) may be pCAMBIA1300- RTN3 . pCAMBIA1300- RTN3 The vector can express the RTN3 protein whose amino acid sequence is SEQ ID NO: 3. RTN3 The structure is: the DNA molecule with the nucleotide sequence of SEQ ID NO: 1 replaces the pCAMBIA1300 vector Hin d III and Eco The fragment between the RI restriction sites ( Hin d III and Eco RI restriction site), keeping the other nucleotide sequences of the pCAMBIA1300 vector unchanged.
[0040] Furthermore, in the application, B8) the nucleic acid molecule may be an RNA targeting the gene encoding the above-mentioned RTN3 protein or a DNA encoding the RNA.
[0041] Furthermore, in the application, B8) the target site sequence of the nucleic acid molecule may be SEQ ID NO: 4 and / or SEQ ID NO: 5.
[0042] In some embodiments of the present application, the expression cassette described in B9) may be an expression cassette targeting the RNA encoding the gene of the aforementioned RTN3 protein.
[0043] The recombinant vector described in B9) can be pYLCRISPR / Cas9P ubi -H- T RTN3 pYLCRISPR / Cas9P ubi -H- T RTN3The vector can encode the sgRNA targeting the DNA molecule shown in SEQ ID NO: 1 and the effector protein of the CRISPR / Cas9 system: Cas9 protein.
[0044] Furthermore, in the application, the recombinant microorganism can specifically be yeast, bacteria, algae and fungi.
[0045] Furthermore, in the application, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.
[0046] Furthermore, in the application, the transgenic plant organ can be the root, stem, leaf, flower, fruit and seed of the transgenic plant.
[0047] Furthermore, in the above application, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ may or may not include propagation materials.
[0048] The present application also provides a method for increasing the number of tillers in a plant, the method comprising introducing a gene encoding the RTN3 protein into a recipient plant to increase the number of tillers in the recipient plant, wherein the recipient plant does not contain the gene encoding the RTN3 protein.
[0049] The present application also provides a method for obtaining a target plant with increased tiller number, the method comprising introducing a gene encoding the RTN3 protein into a recipient plant to obtain the target plant with increased tiller number, wherein the recipient plant does not contain the gene encoding the RTN3 protein.
[0050] Furthermore, the gene encoding the RTN3 protein may be a DNA molecule as described in any one of g1) to g3) below:
[0051] g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO: 2;
[0052] g2), the nucleotide sequence of the coding strand is the DNA molecule of positions 1838-5807 of SEQ ID NO: 1;
[0053] g3) A DNA molecule that has more than 80% identity with the DNA molecule in g1) or g2) and regulates the number of plant tillers.
[0054] The present application also provides a method for reducing the number of plant tillers and / or obtaining a target plant with reduced tiller number, the method comprising the following m1) or m2),
[0055] m1), knocking out the gene encoding the RTN3 protein in the recipient plant by a genome editing system to reduce the plant tiller number and / or obtain a target plant with reduced tiller number; the genome editing system comprises an sgRNA with a target site of SEQ ID NO: 4, an sgRNA with a target site of SEQ ID NO: 5, and an effector protein Cas9 of CRISPR / Cas9;
[0056] m2), mutating a gene in a recipient plant to reduce the number of plant tillers and / or obtain a target plant with a reduced number of tillers, wherein the mutation is: deleting the adenine deoxyribonucleotide at position 1825 of SEQ ID NO: 1 and the deoxyribonucleotides at positions 3616-3618 of SEQ ID NO: 1.
[0057] In the present application, the gene encoding the RTN3 protein may be a DNA molecule as described in any one of g1) to g3) below:
[0058] g1), a DNA molecule whose coding sequence of the coding strand is SEQ ID NO: 2;
[0059] g2), the nucleotide sequence of the coding strand is the DNA molecule of positions 1838-5807 of SEQ ID NO: 1;
[0060] g3) A DNA molecule that has more than 80% identity with the DNA molecule in g1) or g2) and regulates the number of plant tillers.
[0061] Furthermore, in the method described above, the RTN3 protein encoding gene and / or genome editing system is introduced into the recipient plant in the form of a vector.
[0062] In one embodiment of the present application, the vector containing the coding gene may be pCAMBIA1300- RTN3 . pCAMBIA1300- RTN3 The vector can express the RTN3 protein whose amino acid sequence is SEQ ID NO: 3.
[0063] In some embodiments of the present application, the vector containing the CRISPR / Cas system may be pYLCRISPR / Cas9P ubi -H- T RTN3 The pYLCRISPR / Cas9P ubi -H- T RTN3 The vector can encode the sgRNA targeting the DNA molecule shown in SEQ ID NO: 1 and the effector protein of the CRISPR / Cas9 system: Cas9 protein. Recombinant vector pYLCRISPR / Cas9Pubi -H- T RTN3 Contains two sgRNA expression cassettes and one Cas9 protein expression cassette. RTN3 The genome editing system for a gene includes: an sgRNA with a target site of SEQ ID NO: 4, an sgRNA with a target site of SEQ ID NO: 5, and the effector protein Cas9 of CRISPR / Cas9. After being introduced into the receptor, the two transcribed guide RNAs (i.e., sgRNA and sgRNA) can target the target sequence near the PAM of the receptor genome through complementary base pairing, i.e., targeting RTN3 gene, Cas9 protein and two sgRNAs form genome editing effector complexes, RTN3 The DNA double-strand breaks near the target sites shown in SEQ ID NO: 4 and SEQ ID NO: 5 of the gene are repaired by the organism's own DNA damage repair response mechanism, causing gene mutations in the sheared regions during the repair process, thereby achieving RTN3 Gene knockout.
[0064] The present application also provides the RTN3 protein and the biological material.
[0065] The present application also provides a composition for genome editing, comprising an sgRNA with a target site of SEQ ID NO: 4, an sgRNA with a target site of SEQ ID NO: 5, and an effector protein Cas9 of CRISPR / Cas9.
[0066] In the present application, the plant can be selected from monocotyledonous plants.
[0067] In the present application, the monocotyledonous plant can be selected from the grass family.
[0068] In the present application, the grass plant can be selected from cereal plants.
[0069] In the present application, the cereal plant can be selected from rice plants.
[0070] In the present application, the rice plant can be selected from rice ( Oryza sativa L.).
[0071] The beneficial technical effects achieved by this application are as follows:
[0072] This application was finally located through gene mapping and map-based cloning. RTN3 genes, and through genetic complementation experiments and genome editing experiments, RTN3 The function of genes. Rice genes RTN3The research on rice tillering breeding and the mechanism of rice tillering plays an important role and can be widely used in plant fields such as rice genetic breeding, germplasm resource screening, transgenic and genome editing breeding.
[0073] It is worth noting that the tiller number regulating genes disclosed in the prior art are often accompanied by changes in panicle shape. RTN3 The gene specifically regulates tiller number without affecting panicle shape. Tillering and panicle shape are important components of rice yield, but the antagonistic relationship between them affects rice yield potential to a certain extent. Uncovering genes that specifically regulate tillering and panicle shape is an effective strategy to break the mutual constraints between the two and achieve new breakthroughs in rice yield. BRIEF DESCRIPTION OF THE DRAWINGS
[0074] Figure 1 mutant rtn3 Phenotypic analysis of AB: wild-type ZH11 and mutants rtn3 Phenotypes at tillering stage (A) and maturity stage (B), scale bar is 10 cm. CD: Phenotypes of ZH11 and rtn3 Statistical results of tiller number (C) and plant height (D) of mutants. The values in the figure are mean ± standard deviation ( n = 10). E: ZH11 and rtn3 Dynamic changes in the number of tillers of mutants. The values in the figure are mean ± standard deviation ( n = 10). Student's t The test is used to analyze the data, ** indicates that P The difference was statistically significant at the <0.01 level.
[0075] Figure 2 mutant rtn3 A: Wild type ZH11 and rtn3 The mutant ears have the same phenotype, and the scale bar is 2.5 cm. BC: ZH11 and rtn3 Grain length (B) and width (C) phenotypes of mutants. Scale bar is 10 mm. DI: ZH11 and rtn3 Statistical results of the mutant ear length (D), ear branching (E), grain length (F), width (G), 1000-grain weight (H) and seed setting rate (I). The values in the figure represent the mean ± standard deviation ( n = 10).
[0076] Figure 3 for RTN3 Gene cloning and functional verification. A: RTN3 Gene cloning. Blue rectangles represent exons. Letters in brackets represent base changes, and letters outside brackets represent corresponding amino acid changes. B: Wild-type ZH11, rtn3 andpRTN3C Phenotypes of complementary transgenic plants. Scale bar is 10 cm. CD: wild type ZH11, rtn3 and pRTN3C Statistical results of tiller number (C) and plant height (D) of complementary transgenic plants. The values in the figure represent mean ± standard deviation ( n = 15). Tukey's variance analysis was performed in one-way ANOVA. Different letters indicate significant differences between groups ( P <0.05).
[0077] Figure 4 for CR-rtn3 Phenotypic identification of mutants. A: RTN3 Schematic diagram of CRISPR / Cas9 target sites and gene editing results. Red font represents the sgRNA target sequence, underlined positions indicate protospacer-adjacent sequences, and dotted lines indicate deletions. ZH11 represents the reference sequence. CR-rtn3-1 Indicates mutant sequence. B: wild type ZH11, rtn3 and CR-rtn3 The phenotype of ZH11 is shown in Figure 2. The scale bar is 10 cm. CD: wild type ZH11, rtn3 and CR-rtn3 Statistical results of tiller number and plant height of mutants. The values in the figure represent mean ± standard deviation ( n = 15). The data were analyzed by variance analysis using Tukey's method. Different letters indicate significant differences between the groups ( P <0.05). DETAILED DESCRIPTION
[0078] 1. Terms used in this application:
[0079] Examples of resources describing many of the molecular biology-related terms used herein can be found in Alberts et al., Molecular Biology of The Cell, 5th ed., Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed., Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, 6th ed., Oxford University Press: New York, 2002; and Lewin, Genes IX, Oxford University Press: New York, 2007.
[0080] Any references cited herein, including, for example, all patents, published patent applications, and non-patent publications, are hereby incorporated by reference in their entirety.
[0081] To facilitate understanding of the present disclosure, several terms and abbreviations used herein are defined as follows:
[0082] In this application, "identity" refers to the identity of an amino acid sequence or nucleotide sequence. Amino acid sequence (or nucleotide sequence) identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, a search can be performed using blastp with the Expect value set to 10, all filters set to OFF, BLOSUM62 as the matrix, and the Gap existence cost, Perresidue gap cost, and Lambda ratio set to 11, 1, and 0.85 (default values), respectively. The identity of a pair of amino acid sequences can be calculated to obtain a percent identity.
[0083] Specifically, the consistency of more than 70% may be more than 75% consistency. Specifically, the consistency of more than 75% may be more than 80% consistency. Specifically, the consistency of more than 80% may be more than 85% consistency. Specifically, the consistency of more than 85% may be more than 90% consistency. Specifically, the consistency of more than 90% may be more than 91% consistency, more than 92% consistency, more than 93% consistency, more than 94% consistency, more than 95% consistency, more than 96% consistency, more than 97% consistency, more than 98% consistency, or more than 99% consistency. More specifically, the consistency of more than 70% may be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% consistency.
[0084] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B, and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C.
[0085] As used herein, "plant" includes an explant, plant part, seedling, plantlet or whole plant at any stage of regeneration or development.
[0086] As used herein, the term "cereal" refers to monocotyledonous crop plants of the Poaceae or Gramineae family, and typically harvested for their seeds, including, for example, corn, wheat, rice, millet, barley, sorghum, oats, and rye.
[0087] As used herein, "plant part" can refer to any organ or intact tissue of a plant, such as meristem, bud organ / structure (e.g., leaf, stem, or node), root, flower or flower organ / structure (e.g., flower, bract, sepal, petal, stamen, carpel, anther, and ovule), seed (e.g., embryo, endosperm, and seed coat), fruit (e.g., mature ovary), propagule, or other plant tissue (e.g., vascular tissue, dermal tissue, ground tissue, etc.), or any part thereof. The plant parts of the present disclosure can be viable, non-viable, regenerable, and / or non-regenerable. "Propagule" can include any plant part that can grow into a whole plant.
[0088] A plant cell is a biological cell of a plant that is taken from a plant or derived from a culture obtained by culturing cells taken from a plant. As used herein, a "transgenic plant cell" refers to any plant cell transformed with a stably integrated recombinant DNA molecule, construct, expression cassette, or sequence. Transgenic plant cells can include the original transformed plant cell, a transgenic plant cell regenerated or developed from an R0 generation transgenic plant cell, a transgenic plant cell cultured from another transgenic plant cell, or a transgenic plant cell from any progeny or subsequent generation of a transformed R0 generation plant, including cells from plant seeds or embryos, or cultured plant cells, callus cells, and the like.
[0089] As generally understood in the art, the term "promoter" generally refers to a DNA that contains an RNA polymerase binding site, a transcription start site, and / or a TATA box and assists or promotes transcription of a transcribable DNA. Promoters can be produced by artificial synthesis, altered, or derived from known or naturally occurring promoters. Promoters can also include chimeric promoters comprising a combination of two or more heterologous sequences. Therefore, the promoters of the present application can include variants of promoter sequences that are similar in composition to other promoter sequences provided herein, but not identical.
[0090] Promoters can be classified according to various criteria related to the expression pattern of the associated coding or transcribable sequence or gene (including transgene) operably linked to the promoter. For example, promoters that drive expression in all or most tissues of a plant are called "constitutive" promoters, developmental promoters, tissue-specific promoters, and inducible promoters. Promoters that drive expression during certain periods or stages of development are called "developmental" promoters. Promoters that drive enhanced expression in certain plant tissues relative to other plant tissues are called "tissue-enhanced" or "tissue-preferred" promoters. Thus, "tissue-preferred" promoters induce relatively high or preferential expression in specific plant tissues, but lower expression levels in other plant tissues. Promoters that express in specific plant tissues but have little or no expression in other plant tissues are called "tissue-specific" promoters. "Inducible" promoters are promoters that initiate transcription in response to environmental stimuli (such as cold, drought, or light) or other stimuli (such as wounding or chemical application). Promoters can also be classified according to their origin, such as heterologous, homologous, chimeric, or synthetic.
[0091] The term "transcribable DNA" refers to DNA that can be transcribed into an RNA molecule.
[0092] The term "operably linked" may refer to a functional connection between a promoter and transcribable DNA, such that the promoter functions to initiate transcription of the transcribable DNA. The term "operably linked" may also refer to a functional connection between other regulatory elements and a gene of interest to regulate the transcription and / or expression of the gene of interest.
[0093] The term "construct" refers to any recombinant DNA molecule or recombinant RNA molecule. A recombinant DNA molecule can be a plasmid, a cosmid, a virus, a phage, or a linear or circular DNA. A construct typically includes one or more expression cassettes.
[0094] As used herein, an "expression cassette" refers to a composition comprising at least transcribable DNA operably linked to one or more regulatory elements, typically at least a promoter and a 3'UTR (eg, a terminator).
[0095] As used herein, the term "vector" means any construct that can be used for transformation purposes, i.e., to introduce heterologous DNA into a host cell, such as a plasmid, cosmid, virus, phage, or linear or circular DNA.
[0096] As used herein, "editing" or "genome editing" refers to the use of targeted genome editing technology to generate targeted mutations, deletions, inversions or substitutions of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 1000, at least 2500, at least 5000 or at least 10,000 nucleotides of an endogenous plant genomic nucleic acid sequence.
[0097] As used herein, "editing" or "genome editing" also encompasses the targeted insertion or site-directed integration of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 750, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 4000, at least 5000, or at least 10,000 nucleotides into the endogenous genome of a plant using targeted genome editing technology.
[0098] In this application, a "target site" for genome editing refers to the position of a polynucleotide sequence in a plant genome that is targeted and cleaved by a site-specific nuclease, thereby introducing a double-strand break (or single-strand nick) into the nucleic acid backbone of the polynucleotide sequence and / or its complementary DNA strand. The site-specific nuclease can, for example, bind to the target site via a non-coding guide RNA (such as, but not limited to, CRISPR RNA (crRNA) or a single-stranded guide RNA (sgRNA)). The non-coding guide RNA provided herein can be complementary to the target site (e.g., complementary to a strand of a double-stranded nucleic acid molecule or a chromosome of the target site). A "target site" also refers to the position of a polynucleotide sequence in a plant genome that is bound and cleaved by another site-specific nuclease that may not be guided by a non-coding RNA molecule, such as a large-range nuclease, a zinc finger nuclease (ZFN), or a transcription activator-like effector nuclease (TALEN), to introduce a double-strand break (or single-strand nick) into the polynucleotide sequence and / or its complementary DNA strand.
[0099] As used herein, the term "guide RNA" or "gRNA" is a short RNA sequence that comprises (1) a structural or scaffold RNA sequence required for binding to or interacting with an RNA-guided nuclease and / or with other RNA molecules (e.g., tracrRNA), and (2) an RNA sequence that is identical or complementary to a target sequence or target site (referred to herein as a "guide sequence"). A "single-stranded guide RNA" (or "sgRNA") is an RNA molecule that comprises a tracrRNA and a crRNA covalently linked by a linker sequence, which can be expressed as a single RNA transcript or molecule. The guide RNA comprises a guide or targeting sequence ("guide sequence") that is identical or complementary to a target site within the plant genome, for example, at or near a GA oxidase gene. A protospacer adjacent motif (PAM) can be present in the genome immediately 5' to and upstream of the genomic target site sequence that is complementary to the guide RNA's targeting sequence, i.e., immediately downstream (3') of the sense (+) strand of the genomic target site (relative to the guide RNA's targeting sequence) as known in the art. The genomic PAM sequence on the sense (+) strand adjacent to the target site (relative to the guide RNA's targeting sequence) can comprise 5'-NGG-3'. However, the corresponding sequence of the guide RNA (i.e., immediately downstream (3') of the guide RNA's targeting sequence) is typically not complementary to the genomic PAM sequence. The guide RNA can typically be a non-coding RNA molecule that does not encode a protein.
[0100] As used herein, "RNA-guided nuclease" refers to an RNA-guided DNA endonuclease associated with the CRISPR system. Non-limiting examples of RNA-guided nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, homologs thereof, or modified forms thereof. In one aspect embodiment, the RNA-guided nuclease is Cas9. In one aspect embodiment, the RNA-guided nuclease comprises an N-terminal and a C-terminal nuclear localization sequence (NLS).
[0101] In some embodiments of the present application, the composition for genome editing can be co-delivered with a DNA molecule containing a selection or screening marker gene.
[0102] Furthermore, the Cas9 protein described in the present application is not limited to a specific protein, as long as it can be used in conjunction with the sgRNA of the present application. Furthermore, the Cas9 protein described herein is selected from Streptococcus pyogenes Cas9 (spCas9, subtype II-A), spCas9HF (high fidelity), nickase Cas9 (nCas9), Staphylococcus aureus Cas9 (saCas9, subtype II-A), Neisseria meningitidis Cas9 (NmCas9, subtype II-C), Francisella novicida Cas9 specification 71000022023.03 (FnCas9, subtype II-B), Streptococcus thermophilus Cas9 (St1Cas9, St3Cas9), Campylobacter jejuni Cas9 (CjCas9) and Treponema sp. Cas9, as well as Cas9 orthologs of other organisms but not limited thereto. The Cas9 protein may also include high-fidelity Cas9 mutants (such as SpCas9-HF1, eSpCas9-1.1 and TrueCut™HiFiCas9 protein), etc.
[0103] II. Biomaterials, Test Methods, and Examples in This Application
[0104] The genetic complementation vector pCAMBIA1300 is disclosed in the document "Lin, H., Wang, R., Qian, Q., Yan, M., Meng, X., Fu, Z., Yan, C., Jiang, B., Su, Z., Li, J., et al. (2009). DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth. Plant Cell 21:1512-1525." The public may obtain the relevant biological materials from the applicant. The obtained biological materials may only be used to verify the patented technical solution and may not be used for other purposes.
[0105] Gene knockout vector system pYLCRISPR / Cas9P ubi-H was kindly donated by Professor Liu Yaoguang of South China Agricultural University and is disclosed in the paper "Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8: 1274-1284." The public may obtain the relevant biological materials from the applicant. The obtained biological materials may only be used to validate the patented technology and may not be used for other purposes.
[0106] rtn3 The mutant is Oryza sativa rtn3 in the NCBI SRA database: https: / / www.ncbi.nlm.nih.gov / sra / SRX27850146[accn], published on 2025-03-01; Accession: SRX27850146). The public can obtain biological materials from Shandong Agricultural University.
[0107] Some experiments and methods involved in this application are as follows:
[0108] 1) Rice planting and field observation methods
[0109] Seeds of wild-type, mutant, and transgenic materials to be propagated or observed for phenotype were placed in breathable seed soaking bags and soaked at room temperature for 3-4 days, with the water changed daily. Germinated seeds were sown in seedling trays or nursery beds and covered with film to maintain a constant humidity and temperature, conducive to seedling emergence and rapid growth. Seedlings were transplanted into the field approximately one month later. Unless otherwise specified, the general cultivation method was to plant three rows per number, with eight seedlings per row, and approximately 10 cm between rows. Rice material planting and phenotypic investigation were conducted at the experimental bases of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, in Changping and Shunyi districts of Beijing (May to November) or at the Lingshui Nanfan Breeding Base in Hainan (December to April). All materials were grown under natural field conditions.
[0110] Rice tiller number refers to the number of effective tillers at the heading stage, i.e., tillers that have grown into panicles. Rice plant height is the distance from the panicle tip to the ground. In addition, rice yield traits such as panicle length, panicle branching, number of grains per panicle, grain length, grain width, 1000-grain weight, and seed set rate were measured and counted at maturity. Based on the statistical results, representative individual plants were selected for photography.
[0111] 2) The method for extracting rice genomic DNA is as follows:
[0112] Rice genomic DNA was extracted using the CTAB method. The specific steps are as follows:
[0113] CTAB extraction buffer was prepared by mixing 20 g / L CTAB, 0.1 M Tris, 0.02 M EDTA, and 1.4 M NaCl in water.
[0114] (1) Take an appropriate amount of rice leaves and place them in a 2 mL round-bottom centrifuge tube containing a steel ball. Place them in liquid nitrogen and freeze thoroughly.
[0115] (2) Oscillate the tissue at 800 times / min using a tissue disruptor (Thmorgan CK1000) for 1 minute and then cool to room temperature.
[0116] (3) Add 750 μL of CTAB extraction buffer to each centrifuge tube and mix thoroughly by inverting. Place the tube in a 65°C oven and incubate for about 40 minutes, inverting the tube 2-3 times to mix thoroughly.
[0117] (4) Add an equal volume of chloroform and mix thoroughly by inversion. g Centrifuge for 10 minutes.
[0118] (5) Take 400 μL of supernatant and transfer it to a new centrifuge tube. Add 800 μL of anhydrous ethanol and mix thoroughly by inversion. Let it stand at room temperature for 30 minutes or at -20°C overnight.
[0119] (6) 10,000 g Centrifuge for 10 minutes and discard the supernatant. After a brief centrifugation, remove the supernatant. Allow to dry at room temperature, dissolve in an appropriate amount of ultrapure water, and store at -20°C until needed.
[0120] 3) BSA colony construction and gene cloning
[0121] Will rtn3 The mutant was hybridized with ZH11 to obtain F1, and self-pollinated to obtain F2 segregating population. Individuals with similar phenotypes to the wild type and mutant were obtained from F2, and 20-30 individual plants were taken from each to extract genomic DNA. At the same time, the wild type ZH11 and rtn3DNA from the mutant population was collected and mixed in equal amounts to create four DNA pools. Genome resequencing was performed on each of the four pools, and data were analyzed using MutMap Pepline (Abe A, Kosugi S, Yoshida K, Natsume S, Takagi H, Kanzaki H, Matsumura H, Yoshida K, Mitsuoka C, Tamiru M, et al. (2012) Genome sequencing reveals agronomically important loci in rice using MutMap. Nat Biotechnol 30: 174-178). By aligning the pools with the reference genome sequence, a series of single nucleotide polymorphisms (SNPs) were identified across all 12 rice chromosomes. The SNP index, representing the frequency of SNPs in the wild-type and mutant pools, was calculated. This SNP index pinpointed a mutation site closely linked to the mutant phenotype. Further analysis revealed that the site was located in exon 7 of the gene, resulting in an adenine A to guanine G mutation. Further PCR and sequencing were used to verify that the mutation site was consistent with the analysis results, and genetic complementation experiments and gene editing experiments were used to functionally verify the candidate gene, thus clarifying that the point mutation of the gene led to the mutant phenotype.
[0122] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0123] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0124] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.
[0125] Example 1 RTN3 Discovery, cloning, and functional verification of genes regulating rice tiller development
[0126] 1.1 Rice rtn3 Mutant phenotype analysis
[0127] 1.1.1 Rice rtn3 The mutant had a reduced number of tillers
[0128] Our laboratory has collected a series of mutants with few tillers and named them reduced tiller number ( rtn ) series. Among them, rtn3 The mutant is from the Zhonghua 11 (Oryza sativa L. ssp. japonica, ZH11) background. Its tiller number is significantly reduced, and its plant height is slightly reduced, both at the tillering stage and at the maturity stage ( Figure 1 To compare wild-type ZH11 and mutant rtn3 The dynamic changes of tiller number in the whole growth cycle, the tiller number of experimental materials in the field was counted, and it was found that the wild type and rtn3 Both mutants began to develop tillers. Afterwards, the number of tillers in both plants continued to increase, but rtn3 The number of tillers in the mutant was always less than that in the wild type ( Figure 1 Middle E).
[0129] To clarify rtn3 We investigated whether the mutants had the panicle development phenotype in wild type and rtn3 The panicle traits of the mutants included panicle length, panicle branching, grain length and width, thousand-grain weight, and seed setting rate. rtn3 There was no significant difference in the panicle traits of the mutants ( Figure 2 ).therefore, rtn3 The mutant specifically affects the tillering development of rice. Exploring the tillering regulatory genes of the mutant and analyzing its molecular mechanism of specific regulation of tillering development have important theoretical guiding significance for improving rice plant type.
[0130] 1.1.2、 RTN3 Gene cloning and functional analysis: Gene cloning
[0131] For clone control rtn3 We identified the target gene of the mutant phenotype by combining BSA with genome resequencing. rtn3 In the backcross population of the mutant and the wild-type material ZH11, all F1 plants showed the same phenotype as the wild type. The F2 segregation population was obtained by self-pollination, and 120 plants were randomly selected from the population for phenotypic statistical analysis of tiller number and plant height. The results showed that 96 plants had a phenotype similar to the wild type, and the remaining 24 plants showed a phenotype similar to the wild type. rtn3 The mutants showed consistent low tillering phenotype. The above statistical data were subjected to χ 2The results showed that the segregation ratio of normal plants to mutant plants was 3:1 (Table 1), indicating that the genetic locus controlling the mutant phenotype was a recessive single gene.
[0132] At the same time, 50 plants with wild-type and mutant phenotypes were selected from the F2 population, and 50 plants with wild-type and mutant phenotypes were selected from the two parents to form four DNA pools. By resequencing the genomes of the four pools and performing linkage analysis using the MutMap method, a SNP (G / A) site was identified within the 1 Mbp interval. Further sequencing revealed that the site was located in RTN3 In the seventh exon of the gene, an amino acid change occurs (G / D) Figure 3 A in the middle), the mutated protein is named RTN3 G410D protein.
[0133]
[0134] RTN3 The genomic sequence of the gene is SEQ ID NO: 1. In SEQ ID NO: 1, positions 1-1716 are the promoter region, positions 1717-1837 are the 5'UTR, positions 1838-1880 are the first exon, positions 1881-2131 are the first intron, positions 2132-2385 are the second exon, positions 2386-3190 are the second intron, positions 3191-3312 are the third exon, positions 3313-3416 are the third intron, positions 3417-3624 are the fourth exon, and positions 3625-37 Position 72 is the fourth intron, positions 3773-3918 are the fifth exon, positions 3919-4048 are the fifth intron, positions 4049-4355 are the sixth exon, positions 4356-4794 are the sixth intron, positions 4795-5246 are the seventh exon, positions 5247-5516 are the seventh intron, positions 5517-5807 are the eighth exon, positions 5808-6062 are the 3'UTR, and positions 6063-6480 are the downstream sequence. RTN3 The coding sequence of the gene is SEQ ID NO: 2, and the encoded amino acid sequence is SEQ ID NO: 3 for the RTN3 protein.
[0135] RTN3 G410DThe genomic sequence of the gene is that the guanine deoxyribonucleotide (G) at position 5029 of SEQ ID NO: 1 mutates to an adenine deoxyribonucleotide (A), and the corresponding coding sequence is that the guanine deoxyribonucleotide (G) at position 1229 of SEQ ID NO: 2 mutates to an adenine deoxyribonucleotide (A). The protein obtained by transcription and translation mutates from glycine (G) to aspartic acid (D) at position 410 of SEQ ID NO: 3. The mutant protein is named RTN3 G410D protein.
[0136] 1.2. Vector Construction and Construction of Transgenic and Gene-Edited Strains
[0137] 1.2.1. Vector Construction
[0138] (1) Construction of rice genetic complementation:
[0139] The wild-type ZH11 genome was used as a template to amplify a genomic sequence of 6480 bp in length, including the promoter sequence, coding region, and 673 bp downstream of the stop codon (SEQ ID NO: 1). This fragment was integrated into the Hin d III and Eco After RI digestion, the pCAMBIA1300 vector was obtained. RTN3 Genetic complementation vector pCAMBIA1300- RTN3 . pCAMBIA1300- The structure is: the DNA molecule with the nucleotide sequence of SEQ ID NO: 1 replaces the pCAMBIA1300 vector d III and The fragment between the RI restriction sites ( d III and The pCAMBIA1300 vector can express the RTN3 protein with the amino acid sequence of SEQ ID NO: 3.
[0140] (2) Construction of rice genome editing vector
[0141] To further clarify the function of RTN3 in regulating rice tillering development, CRISPR / Cas9 technology was used to design target sites in the 5'UTR and the fourth exon of the RTN3 gene for gene editing to create an RTN3 homozygous mutant. ( The target site sequences and corresponding promoter sequences are as follows:
[0142] T1 (5' to 3'): CCATTAGAGGGAAGCTTGG (SEQ ID NO: 4);
[0143] T2 (5' to 3'): AAGGGCAGTGGTGATATCAA (SEQ ID NO: 5);
[0144] The promoter of the sgRNA gene targeting T1 is the U6 promoter, and the promoter of the sgRNA gene targeting T2 is the U3 promoter.
[0145] Following the method reported by Ma et al. (Ma X, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicotplants. Mol Plant 8: 1274-1284.), the target site primers were annealed and integrated into gRNA vectors containing different promoters. U3 / U6-sgRNA fragments were obtained by amplification. Different fragments were ligated into pYLCRISPR / Cas9P by end complementation. ubi -H, thereby obtaining the gene editing vector pYLCRISPR / Cas9P ubi -H- T RTN3 .
[0146] Recombinant vector pYLCRISPR / Cas9P ubi -H- T RTN3 Contains two sgRNA expression cassettes and one Cas9 protein expression cassette. The genome editing system includes: sgRNA with target site SEQ ID NO: 4, sgRNA with target site SEQ ID NO: 5 and CRISPR / Cas9 effector protein Cas9. After being introduced into the receptor, the two transcribed guide RNAs (i.e., sgRNAs) can target the gene through complementary base pairing. The target sequence near the PAM of the gene is located, and the Cas9 protein forms a genome editing effector complex with two sgRNAs. The DNA double-strand break near the gene target site causes gene mutation in the cut area during the repair process through the organism's own DNA damage repair response mechanism, thereby achieving Gene knockout.
[0147] 1.2.2 Agrobacterium-mediated rice genetic transformation
[0148] Genetic transformation mediated by Agrobacterium tumefaciens EHA105 (Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice ( L.) mediated by and sequence analysis of the boundaries of the T-DNA. Plant J6: 271-282) to transform rice callus to create rice transgenic and genome editing materials. The genetic complementation vector pCAMBIA1300- The transformation recipient is rice Mutant, pYLCRISPR / Cas9P ubi -H- T RTN3 The transformation receptor is rice Zhonghua 11 (ZH11). The details are as follows:
[0149] (1) Rice callus induction and subculture. After dehulling the rice seeds, sterilize the surface with 70% ethanol for 1 minute. Then wash with 2.5% (w / v) sodium hypochlorite for 45 minutes. After washing with sterile water 3-4 times, sow the seeds on NB solid medium and place them in a dark incubator at 28℃ for 10 days. Cut the newly grown callus and subculture it on new NB solid medium. Replace the NB solid medium every 7 days. After 3-4 propagation, it can be used for genetic transformation.
[0150] (2) Agrobacterium culture. The constructed plasmids were transformed into EHA105 strains by electroporation and spread on solid LB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. The culture was placed at 28°C for 2-3 days. The positive clones were selected and inoculated into liquid LB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin and cultured for 14-16 hours. The culture temperature was 3,500 °C. g Centrifuge for 10 minutes to collect the cells and resuspend them in the infection solution to a concentration of OD 600 The concentration of the culture medium was 0.6-0.8, and then used for transformation of rice callus.
[0151] (3) Agrobacterium infection. Select 100-200 calli with a light yellow color, smooth and dense surface and incubate them with Agrobacterium infection solution for 3-4 minutes, shaking continuously. Then remove the calli and remove the remaining bacterial solution with sterile filter paper. Place the calli in a culture dish containing filter paper and incubate in a dark incubator at 22°C for 2-3 days.
[0152] (4) Screening, differentiation, and plant regeneration of callus tissue. After the callus tissue is removed, it is placed on NB solid medium containing hygromycin and carbenicillin. After 7 days of selective culture at 28°C in the dark, it is transferred to a new selective culture medium. After 3-4 rounds of selective culture, the callus tissue with good growth status is transferred to the differentiation medium. After one month of light culture at 28°C, the main stem of the seedlings and part of the young roots are inserted into the rooting medium for rooting and seedling strengthening. After about 2 weeks of culture, water is added to harden the seedlings. After one week, the seedlings are transplanted to the experimental field.
[0153] The culture medium formulas involved are as follows:
[0154] Preparation of NB solid medium: To 1 L of double-distilled water, add 2830 mg potassium nitrate, 463 mg ammonium sulfate, 400 mg potassium dihydrogen phosphate, 185 mg magnesium sulfate heptahydrate, 166 g calcium chloride dihydrate, 27.8 mg ferrous sulfate heptahydrate, 37.5 mg disodium edetate, 10 mg manganese sulfate tetrahydrate, 3 mg boric acid, 2 mg zinc sulfate heptahydrate, 0.25 mg sodium molybdate crystals, 0.025 mg copper sulfate pentahydrate, 0.025 mg cobalt dichloride hexahydrate, 0.75 mg potassium iodide, 10 mg vitamin B1, 1 mg vitamin B6, 1 mg niacin, 100 mg inositol tripyrophosphate, 300 mg casein hydrolyzate, 500 mg glutamine, 2 mg glycine, 1000 mg proline, 2 mg 2,4-dichlorophenoxyacetic acid, and 3.2 g plant gel.
[0155] LB medium preparation: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride and 15 g / L agar, the solvent is water.
[0156] Preparation of infection medium: NB liquid medium (the only difference from NB solid medium is that it does not contain 3.2 g of plant gel) was supplemented with 2 g / L inositol, 2 g / L glutamine, 500 mg / L casein hydrolysate, 10 mL / L 10% poloxamer, and 100 μM acetosyringone.
[0157] Selection medium: NB solid medium supplemented with 50 mg / L hygromycin and 100 mg / L carbenicillin.
[0158] Preparation of differentiation medium: Add 100 mg / L inositol, 2 g / L casein hydrolysate, 0.2 mg / L naphthaleneacetic acid, 0.2 mg / L kinetin, 2 mg / L 6-benzylaminoadenine, 30 g / L sorbitol, 30 g / L sucrose, 3 g / L hygromycin, and 50 mg / L gelatin to NB solid medium.
[0159] Rooting medium: NB solid medium supplemented with 1.0-5.0 mg / L methionine and 0.5 mg / L indolebutyric acid.
[0160] Genetic complementation vector pCAMBIA1300- Transformed mutants The obtained strains were named pRTN3C complemented transgenic strains. After three generations of propagation, the T3 generation plants were used for phenotypic verification, and finally the T3 generation pRTN3C complemented transgenic strains numbered #1, #2 and #3 were obtained. The pRTN3C complemented transgenic strains numbered #1, #2 and #3, Zhonghua 11 (ZH11) and mutants were 24 plants of each type were planted in the field in 3 rows with a row spacing of 25 cm, and 8 plants in each row with a plant spacing of 15 cm.
[0161] pYLCRISPR / Cas9P ubi -H- T RTN3 The strain obtained by transforming the wild type Zhonghua 11 (ZH11) was named After two generations of propagation, the T2 generation plants were used for phenotypic verification, and the T2 generation was finally obtained. The sequencing results showed that: In the T2 generation homozygous lines, compared with rice variety ZH11, the rice genome The region corresponding to the gene has undergone the following changes: The 1825th position (adenine deoxyribonucleotide) and the 3616-3618th deoxyribonucleotides (ATA) of the sequence shown in SEQ ID NO: 1 are deleted, thereby changing the Gene knockout ( Middle A).
[0162] 1.3、 Functional verification in regulating rice tillering development
[0163] Will , Zhonghua11 (ZH11) and mutants 24 plants of each type were planted in the field in 3 rows with a row spacing of 25 cm, and 8 plants in each row with a plant spacing of 15 cm.
[0164] Here are the results:
[0165] (1) Through molecular identification and phenotypic observation, it was found that The tiller number and plant height of the complemented transgenic lines were restored to the wild type level ( BD), indicating The low-tillering phenotype of the mutant is due to The introduction of the RTN3 protein encoding gene into the recipient rice caused by a gene mutation (G410D) can increase the tiller number of the recipient rice.
[0166] (2) Phenotypic analysis revealed that the mutant The number of tillers was significantly reduced compared with the wild type, and the plant height was slightly reduced, showing the Similar phenotypes ( The above results show that It plays an important role in regulating rice tillering development.
[0167] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. A method for increasing the number of plant tillers, characterized in that: The method comprises introducing a gene encoding an RTN3 protein into a recipient plant to increase the tiller number of the recipient plant; The RTN3 protein is any one of the following proteins: a1), the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of the protein shown in a1); The plant is rice.
2. A method for obtaining a target plant with increased tiller number, characterized in that: The method comprises the steps of introducing a gene encoding an RTN3 protein into a recipient plant to obtain a target plant with increased tiller number; The RTN3 protein is any one of the following proteins: a1), the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of the protein shown in a1); The plant is rice.