Fusarium venanii with high protein conversion rate and application of fusarium venanii in improving hypha protein satiety

Abstract

The invention relates to fusarium venanii with high protein conversion rate and application of the fusarium venanii to improvement of hypha protein satiety, and belongs to the field of genetic engineering technology and food biotechnology. The fusarium venenatum FCPD disclosed by the invention is preserved in the China Center for Type Culture Collection on December 6, 2024, and the preservation number of the fusarium venenatum FCPD is CCTCC (China Center for Type Culture Collection) NO: M 20242752. The glucose consumption of a substrate for producing mycelia with the same dry weight by the fusarium venanii is reduced by 40-60% compared with that of a wild type, the protein conversion rate is improved by 70-80%, the grease content is improved by 90-110%, the gastric semi-emptying time of in-vitro simulated digestion is prolonged by 10-30%, and the quality of fusarium venanii mycelium protein is remarkably improved. Genetic engineering modification work can be further developed, and fusarium strains with high substrate conversion rate, high grease content and high satiety potential can be cultivated.

Description

Technical Field

[0001] The invention relates to a strain of Fusarium venezuelae with high protein conversion rate and application thereof in improving satiety of mycelial protein, belonging to the field of genetic engineering technology and food biotechnology. Background Art

[0002] As a variety of alternative proteins are used to replace animal proteins worldwide, the proportion of new alternative protein foods in consumers' dietary structure is gradually increasing. Among them, fungal protein is a multicellular mycelial protein produced by fermentation of filamentous fungi. It contains essential dietary amino acids for the human body, including lysine, which is usually lacking in plant protein, which makes it have excellent nutritional value. In addition, fungal protein also has the advantages of wide production organisms, short growth time and high production efficiency. Because the mycelium of filamentous fungi naturally has the characteristics of mimicking the fiber feel of meat, it has good chewiness and meaty texture, and fungal mycelium protein usually accounts for 30%-40% of dry matter, it has the potential to be a high-quality protein source for the next generation of alternative protein foods. Quorn Foods in the UK has developed a variety of commercial fungal meat products for consumers to choose from using Fusarium venenatum.

[0003] However, the production cost of Fusarium venezia is still high, especially the conversion rate of substrate glucose to bacterial protein synthesis is not high, and the glucose consumption is large. At present, although the strains obtained by metabolically modifying Fusarium venezia in the prior art and reports have been improved in terms of bacterial protein content, the protein conversion rate cannot be greatly improved, and the improvement of protein conversion rate helps to reduce substrate consumption and cost, and create better production efficiency and economic benefits. In addition, the fat content of Fusarium mycelium is low, and the chewing feeling is poor, so the taste is relatively lacking compared with animal meat. In addition, fungal mycelium usually has unique digestive characteristics, which is believed to slow down the release kinetics of protein during digestion, and has the effect of increasing satiety, which is suitable for people who lose weight and diabetic patients. Patent CN118421487A discloses that knocking out the chitinase gene helps to increase the protein content of Fusarium venezia, but the gastric emptying time is reduced, and it is difficult to achieve the effect of improving satiety. Therefore, there is an urgent need to provide a new strain that can improve protein conversion rate and fat content, significantly reduce glucose consumption during fermentation, and at the same time has a long gastric emptying time and high satiety characteristics. Summary of the invention

[0004] In view of this, the present invention provides a strain of Fusarium venenatum with a high protein conversion rate and its application in improving satiety of mycelial protein. The Fusarium venenatum FCPD of the present invention is obtained by knocking out the chitin synthase gene FvChs and the thiamine diphosphate binding protein gene in the wild-type Fusarium venenatum bacteria. The bacteria can not only improve the substrate glucose conversion rate, significantly reduce glucose consumption and ethanol production in the fermentation broth, but also have a high fat content and a significantly slowed gastric emptying rate.

[0005] The present invention is achieved through the following technical solutions:

[0006] The first object of the present invention is to provide a strain of Fusarium venenatum, which is named Fusarium venenatum FCPD, and was deposited in the China Center for Type Culture Collection on December 6, 2024, with a deposit number of CCTCC NO: M 20242752.

[0007] The second object of the present invention is to provide a product containing the Fusarium venezuelae FCPD.

[0008] The third object of the present invention is to provide a method for preparing the Venetian Fusarium, wherein the Venetian Fusarium is obtained by knocking out the chitin synthase gene FvChs (FVRRES_06397) and the thiamine diphosphate binding protein gene Pdc (FVRRES_12865) in the starting bacteria through CRISPR-Cas9 scarless knockout technology.

[0009] In one embodiment of the present invention, the nucleotide sequence of the chitin synthase gene FvChs is shown in SEQ ID NO.1, which contains 3155 bp of nucleotides. The nucleotide sequence of the thiamine diphosphate binding protein gene is shown in SEQ ID NO.2, which contains 2272 bp of nucleotides.

[0010] The fourth object of the present invention is to provide a method for improving the protein conversion rate of Fusarium venezuelae.

[0011] In one embodiment of the present invention, the method is to knock out the chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium venezuelae; the nucleotide sequence of the gene FvChs is shown in SEQ ID NO.1, and the nucleotide sequence of the gene Pdc is shown in SEQ ID NO.2.

[0012] The fifth object of the present invention is to provide a method for increasing the oil content of Fusarium venezuelae.

[0013] In one embodiment of the present invention, the method is to knock out the chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium venezuelae; the nucleotide sequence of the gene FvChs is shown in SEQ ID NO.1, and the nucleotide sequence of the gene Pdc is shown in SEQ ID NO.2.

[0014] The sixth object of the present invention is to provide a method for improving the satiety of Fusarium venezuelae.

[0015] In one embodiment of the present invention, the method is to knock out the chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium venezuelae; the nucleotide sequence of the gene FvChs is shown in SEQ ID NO.1, and the nucleotide sequence of the gene Pdc is shown in SEQ ID NO.2.

[0016] In one embodiment of the present invention, the improving satiety of Fusarium venezuelae is to prolong gastric emptying time.

[0017] The seventh object of the present invention is to provide a method for preparing mycelial protein, which comprises culturing the Fusarium venezuelae FCPD.

[0018] In one embodiment of the present invention, the liquid culture medium used for the culture includes 30 g / L glucose, 1.2 g / L potassium sulfate, 0.5 g / L phosphoric acid, 0.1 g / L magnesium sulfate heptahydrate, 0.03 g / L zinc sulfate heptahydrate, 0.0055 g / L copper sulfate pentahydrate, 0.01 g / L ferrous sulfate heptahydrate, 0.00003 g / L biotin, 0.4 g / L calcium acetate, and 6 g / L ammonia water.

[0019] In one embodiment of the present invention, the culture conditions are: 28°C-32°C for 48h-72h, and a rotation speed of 100rpm-250rpm.

[0020] In one embodiment of the present invention, the substrate glucose consumption of the Fusarium venezuelae FCPD of the present invention is reduced by 40-60% compared with the wild type when producing the same mass of dry mycelium.

[0021] In one embodiment of the present invention, the oil content, calculated on a dry basis of mycelium, reaches 10%-20%, which is 90%-110% higher than that of the wild type.

[0022] In one embodiment of the present invention, the gastric half-emptying time of the in vitro simulated digestion of the mycelium / thalline protein of Fusarium venezuelae of the present invention is increased by 10%-30% compared with the wild type.

[0023] The eighth object of the present invention is to provide the use of the method in increasing the bacterial protein content, substrate glucose conversion rate, protein conversion rate, oil content and / or prolonging gastric emptying time of Fusarium venezuelae.

[0024] The ninth objective of the present invention is to provide the use of the Fusarium venezuelae FCPD in the preparation of products with high satiety and / or high protein content and / or high fat content.

[0025] Beneficial effects:

[0026] The present invention provides a mutant of Fusarium venenatum (FCPD). Compared with the wild type Fusarium venenatum, the genome of the FCPD of Fusarium venenatum lacks 3155bp of chitin synthase gene FvChs and 2272bp of thiamine diphosphate binding protein gene Pdc. The substrate conversion rate of the FCPD of Fusarium venenatum is improved, the sugar consumption of producing the same dry weight of mycelium is reduced by 40%-60% compared with the wild type, the oil content of the mycelium is increased by 90%-110% compared with the wild fungus, and the gastric half-emptying time of the mycelium is increased by 10%-30%, which significantly improves the production efficiency and nutritional quality of mycelial protein of Fusarium venenatum and reduces the production cost. The Fusarium venenatum can be used to further develop genetic engineering transformation work to cultivate Fusarium strains with high protein content and high oil content.

[0027] Biomaterial Deposit

[0028] The Fusarium venenatum FCPD provided by the present invention was deposited in the China Center for Type Culture Collection on December 6, 2024, with the deposit address being Wuhan University, Wuhan, China, with the deposit number being CCTCC NO: M20242752, and the classification name being Fusarium venenatum FCPD. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The back images of the wild type WT and FCPD of Fusarium venenatum of the present invention after growing on the PDA plate for 7 days;

[0030] Figure 2 This is an image of wet-based mycelium obtained after the wild type WT and FCPD of Fusarium venenatum of the present invention were cultured in PDB medium for 72 hours;

[0031] Figure 3 is the biomass yield of the strain of the present invention during liquid culture;

[0032] Figure 4is the ethanol yield of the strain of the present invention during liquid culture;

[0033] Figure 5 is the 72h protein conversion rate of the strain of the present invention in liquid culture;

[0034] Figure 6 is the glucose consumption of the strain of the present invention in liquid culture for 72 hours;

[0035] Figure 7 is the oil and fat ratio of mycelium of the present invention (%);

[0036] Figure 8 The gastric emptying curves of mycelium digestion of the present invention (A: wild type; B: FCPD). DETAILED DESCRIPTION

[0037] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0038] It should be noted that the test methods described in the following examples are conventional methods unless otherwise specified, and the reagents and materials are commercially available unless otherwise specified.

[0039] The culture medium and reagents used in the following examples of the present invention are as follows:

[0040] Potato dextrose broth (PDB): 10g / L-20g / L glucose, 20g / L-30g / L potato extract;

[0041] Potato dextrose solid medium (PDA): 10g / L-20g / L glucose, 20g / L-30g / L potato extract, 15g / L agar powder;

[0042] FDB tank culture medium: 30g / L glucose, 1.2g / L potassium sulfate, 0.5g / L phosphoric acid, 0.1g / L magnesium sulfate heptahydrate, 0.03g / L zinc sulfate heptahydrate, 0.0055g / L copper sulfate pentahydrate, 0.01g / L ferrous sulfate heptahydrate, 0.00003g / L biotin, 0.4g / L calcium acetate, 6g / L ammonia water;

[0043] RM: 1g / L-5g / L yeast powder, 1g / L-5g / L peptone, 250g / L-300g / L sucrose, 20g agar;

[0044] SMC solution: 0.8M-1.2M sorbitol, 50mM-100mM CaCl2, 10mM-20mM Mes / NaOH;

[0045] STC solution: 0.8M-1.2M sorbitol, 50mM-100mM CaCl2, 10mM-50mM Tris–HCl;

[0046] SPTC solution: 20-40% PEG6000 dissolved in STC;

[0047] Mycelial lysis solution: 2mg / mL-5mg / mL driselase; 2mg / mL-5mg / mL snailase.

[0048] Example 1 Preparation of Fusarium venezuelae FCPD strain

[0049] Fusarium venenatum FCPD is a gene knockout mutant created by CRISPR / Cas9 gene editing technology using wild-type Fusarium venenatum BNCC362640 as the starting strain. Protospacers of genes were predicted using an online tool (http: / / crispor.tefor.net / ) for the location of gene editing sites. The 5SrRNA promoter, protospacers and sgRNA scaffold were inserted into the plasmid pUC57 to generate pTarget-Chs. To knock out Chs, two pairs of primers Chsup-F and Chsup-R and Chsdown-F and Chsdown-R were used to amplify the upstream and downstream homology arms of Chs from the Fusarium venenatum genome. The recombinant plasmid was obtained by ligating the upstream and downstream homology arm fragments of Chs into the linear pUC57 vector by a one-step cloning method. When transformed, the linear sgRNA and homology arm target fragments were amplified from the corresponding plasmid by PCR. The knockout process of the thiamine diphosphate-binding protein gene Pdc was similar. Two pairs of primers, Pdcup-F and Pdcup-R, and Pdcdown-F and Pdcdown-R, were used to amplify the upstream and downstream homologous arms of Pdc from the Fusarium venenatum genome.

[0050] Knockout of target gene by protoplast transformation mediated by PEG: Rinse the mycelium grown on the PDA plate for 5 days with about 2 mL of sterile water to obtain a conidia suspension. Conidia were cultured in 50 mL of PDB medium for 24 h. The mycelium was filtered through a double layer of lens paper and washed with sterile water for harvest. Add 20 mL of mycelium lysis solution and incubate at 30°C and 100 rpm for 3 h. Add 10 mL of STC solution, mix gently up and down, collect the protoplasts through Miracloth filtration, and rinse again with STC. Centrifuge at 10°C and 2,000 × g for 10 min. After washing with pre-cooled STC, resuspend the protoplasts in STC and use directly for transformation. Mix 10 μg of linear DNA, 100 μL of at least 10 8 protoplasts, 25 μL of the prepared SPTC solution, and the mixture was incubated on ice for 40 minutes. After adding 1 mL of SPTC solution and incubating at room temperature for 30 minutes, the protoplast mixture was diluted with 2 mL of STC. The mixture was mixed with RM medium preheated to about 42°C and poured into a culture dish. After overnight incubation, it was covered with selective medium containing 100 μg / mL hygromycin. Fusarium mycelium was visible after 2-3 days of culture at 28°C, and the homokaryons were purified by transfer 1-2 times for colony PCR verification.

[0051] The gene sequences of FvChs gene (FVRRES_06397) and thiamine diphosphate binding protein (FVRRES_12865) were downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), and the Fusarium genome was extracted using the Ezup column fungal genomic DNA extraction kit (B518259-0100, Shanghai Sangon Biotechnology Co., Ltd.). The genomic DNA of the wild type and mutant was amplified and sequenced. Compared with the wild type, the gene sequence of the FCPD mutant was deleted by 3155bp and 2272bp at two sites, respectively. The Fusarium venenatum FCPD was deposited in the China Center for Type Culture Collection on December 6, 2024, with the deposit number of CCTCC NO: M 20242752.

[0052] The primer sequences are:

[0053] FChs:5'-atggtcttcaacgaaaatggcca-3';

[0054] RChs:5'-ttatcgccttgcaatgcag-3';

[0055] Chsup-F:5'-agctatgaccatgattacctgatccgatggtacctagag-3';

[0056] Chsup-R: 5’-gatatgtagagttcgtctgttatatcaatcggtcgc-3’;

[0057] Chsdown-F: 5’-accgattgatataacagacgaactctacatatcgagc-3’;

[0058] Chsdown-R: 5’-gccagtgccaagcttgcagatcggaagtttcac-3’;

[0059] Pdcup-F: 5’-agctatgaccatgattacttagacccgtccacctttc-3’;

[0060] Pdcup-R: 5’-atacatacaatcagaagtggttgcggattgatcggt-3’;

[0061] Pdcdown-F: 5’-accgatcaatccgcaaccacttctgattgtatgtatcgtagta-3’;

[0062] Pdcdown-R: 5’-tccagtcacgacgttgtatcaatgccgttgtcggtg-3’;

[0063] FvChs gene sequence: SEQ ID NO.1

[0064] atggtcttcaacgaaaatggccaaagaaatggccccaactatgatgcgccacgcgagatgcaagatctacctgctggccaagcagtaagctttagccccttcagcctccaacagttggcaactgcaatagcgaccttacagggcagctacgccagcgccagcaccagcctcactggaacctgtcgcaaaacaattacaaccaccgtttctaacttgacctttcttttccttccagtaccactttcgcgaatctgacgacgcaaacgcctcaaaccgatc

[0065] gcccgtgagcaacccatacgaacccgattatgaacaattatctcccccgcccatgctgggcgcacagcgccctgtccccgaacaaaacgagtc

[0066] gagccgcgatcttctacacagctcttaccatggcagtataggtcaggccagcttcgaccagggcagcctcggccacaacagtgcctatggagtt

[0067] ggcgctttcggtcattatcctcctgaccagcacggtcggttgcctggctcgccgggttacgagtacccagaacctgagtacgatgtcgaagcctc

[0068] ccgcctggctgaatcacgcctttctgtcgtgcatcgtacacctacgatgcaggaatggggtcagaatggggagacactgtctgtttcgcctgaatt

[0069] tgcccacggccgcccagattcgacttaccaggaattcgacgttgacgagagctggatgatgcgccagcagcaagcacaacttggacctggtg

[0070] gcctcggtcgctcaaagactcgcaaggtcaagcttgtccagggctccgtcctcagtatcgactaccccgtccccagcgccgtcaagaacgccat

[0071] cgagcccaggtatcgcaacggtcctggaagcatggaggaggaattcacaaagatgcgctacacagctgctacctgcgatccgaacgacttca

[0072] ccctgcgcaacggtttcaacctccgcccgcgaatgtataaccgtcataccgaactcctcatcgcaatcacctattacaacgaagacaaggtgctt

[0073] ctcgcccgaaccctacactacacaatgaagaacattcaggacattgtgaacctgaagcgatccaaattctggaacaagggaggtccagcctgg

[0074] cagaaaatcgtcgtctgtctcgtcttcgatggtctcgataaagttgacaagaatgtctttgacgtcctcgccactgttggtgtctatcaggacggcgt

[0075] tctcaaaaaggacgtcaatggcaaggaaactgtcgcccatattttcgagtacaccagtcaaatctccgtgacgcccgatcaacagcttgtccgtc

[0076] ctgaccccgacaagccgcatcgcaatctgccccccgtgcagttcattttctgtcttaagcaaaagaacagcaagaagatcaattcgcatcgctgg

[0077] ctgttcaacgcctttggtcgcattctaaacccagaagtcgccatcctcatcgacgccggaacaaaacctggcccgcgcgccctgttgtctctctgg

[0078] gaaggcttctataacgatcgtgacctcggcggtgcttgtggtgagatccacgtcatgttaggcaagggtggaaagatgcttctcaacccgcttgtc

[0079] gcggtacagaacttcgagtacaaaatttccaatgtgctcgataagcctctggaaagtgcgttcggatacgtcagtgtcctgcctggtgcgttttcag

[0080] cgtaccgcttccgtgccattatgggacgaccattggagcagtacttccacggcgaccacacgctctccaaaactctaggcaagaagggtattga

[0081] cggaatgaacatcttcaagaagaacatgttccttgccgaggaccgaattctctgcttcgaattggtcgcaaaggcgagtcaaaaatggcatctga

[0082] gctacatcaaggcatccaagggcgagaccgatgtgcctgaaggcgcatctgagtttattggccagcgacgtcgatggcttaacggatctttcgc

[0083] catgtctctctattctcttatgcatttcggacgaatgtatggctctggccataacgttgtccgactctttttcctccacatccagttcgtgtacaacttact

[0084] caacgtgctgttcagttggttctcgctcgctgctttctatctcactaccacgattatcatgaagcttgtcggaacgccacaggttctatccgggtacca

[0085] tggctggccgtttggcgatatggctacgccaattgtcaatgttctgatcaaatatatttacatcgctttcctcgtcctgcaattcgtcctcgctcttgga

[0086] aacagaccaaagggtgctcagtacacttacgtcctctccttcatggttttcggcttgatccagttgtatcttttggtcttgactggctatctcgtgtacc

[0087] gagccttcactggaacgcccattgaagaccagatctcattcgcgtccgggcaagccttcttcgatagtttcttcggaggcgatactggtgtcgcag

[0088] gtctgatcatcatcgccttgatcactatctacggtctcaactacatcgcgtccttcctctacctagatccgtggcacatgttccactccttccctcaata

[0089] tcttgtcctcatgtcaacctacatcaacatcctgatggtttatgccttcaacaactggcacgatgtgtcctggggaacaaagggttccgatgctgcc

[0090] gaagctctgccctctgccaacattgtcaaggatgaaaagggcaaggaagccgttgtggaagaaatcgagcaggagcaggaggatatcgaca

[0091] gcaagtttgaaaaggtcgtttggcgagccctcgcaccaatgagcgaaatgatggaagaacagcccgagaagaaggacgttgaagattcataca

[0092] agtctttccgaactggtcttgttattctttggttgctgtgcaacattgttctcattgtctttgtcacaacagacgattttatcactctcggtgtctctgtaagt

[0093] tatcttccccttgttctatagttccaacagcatgctaacccattcctttcagaaagccgcagacgtccgtacacccatgtatttccgtttcctcctctact

[0094] cgacaggtgtgctgtctattgtccgcttcattggtttcctctggttcattggacgaactggtattatgtgctgcattgcaaggcgataa;

[0095] Thiamine diphosphate binding protein gene Pdc sequence: SEQ ID NO.2

[0096]

[0097] Example 2 Cultivation and characterization of Fusarium venezuelae FCPD

[0098] Mycelium culture method:

[0099] For solid plate culture, 2 mL of sterile water was taken to rinse the mycelium on the original plate and the turbid liquid was diluted to an appropriate concentration, and 10 μL of spore suspension was added to a new PDA culture plate. After it dried, it was inverted and cultured for 2-5 days to obtain Fusarium colonies.

[0100] For the culture in a 20 L fermenter, fresh spores (1 mL, 1 × 10 5 Conidia / mL) were inoculated into 1.5L PDB liquid culture medium for pre-culture for 48h (28℃-32℃, 100rpm-250rpm) to obtain seed liquid, which was then inoculated into a 20L stirred tank bioreactor containing 12.5L FDB tank culture medium. The fermentation temperature was 29℃, the ventilation volume was 1vvm, the rotation speed was 100rpm, and the pH was adjusted to 6.0 by adding 6M ammonia water. The tank fermentation culture time was 72h, and samples were taken at intervals of 24h for sugar consumption and ethanol production tests; after the fermentation was completed, the fermentation liquid was heat treated at 60℃ for 20min, the mycelium was collected by washing with sterile water, and the fresh wet-based mycelium was used for in vitro simulated digestion experiments; the wet-based mycelium was freeze-dried to determine the oil content of FCPD and the wild type.

[0101] 1. Apparent differences between FCPD and wild-type strains of Fusarium venezuelae

[0102] The wild-type and FCPD mutant strains of Fusarium venezuelae were plated and mycelial cultured. Figure 1 and Figure 2 As shown, compared with the wild type, the back of the plate of the FCPD strain turned red and the wet-based mycelium had better ductility.

[0103] 2. Comparative analysis of sugar consumption and ethanol production between FCPD and wild-type strains of Fusarium venezuelae

[0104] The 72h fermentation broth obtained in the above culture was collected, and after appropriate dilution, the residual glucose and ethanol content in the fermentation broth was determined using a Silman M-100 biosensor analyzer. The 72h mycelium was collected, freeze-dried and weighed to determine the sugar consumption of FCPD and wild-type strains when the mycelium weight was the same. The protein conversion rate was calculated as: biomass × protein content / glucose consumption. The protein content of the dry mycelium was determined using a Kjeldahl nitrogen analyzer. The determination was repeated three times.

[0105] Statistical analysis showed significant differences between the FCPD strain and the wild type (see Figure 3-6). Based on dry mycelium, the biomass yield of FCPD strain (85.87 g / L) was similar to that of wild type (87.43 g / L) after 72 h of fermentation in a 20L fermenter. The wild type strain produced 10.5 g / L of byproduct ethanol in the fermentation broth after 72 h, but the FCPD strain produced almost no ethanol (0.1 g / L), and the total sugar consumption in 72 h (1012.66 g) was significantly lower than that of the wild type (1934 g). The protein content of dry mycelium of FCPD was 50.83%, while that of the wild type was 43.65%, an increase of 7.18%. The protein conversion rate was as high as 57.32%, an increase of 77.1% compared with the wild type.

[0106] 3. Analysis of oil content in mycelium of Fusarium venezia

[0107] The fat content of the dried mycelium was determined using a Soxhlet fat analyzer. The determination was repeated three times. There was a significant difference in the oil content between the FCPD strain and the wild type (see Figure 7 ). Based on the dry mycelium, the oil content of wild-type mycelium is 5.23%, while the oil content of FCPD mycelium is significantly increased to 10.07%. High oil content may be one of the important reasons for the subsequent prolonged gastric emptying time.

[0108] 4. Digestion quality analysis of FCPD and wild-type strains of Fusarium venezuelae

[0109] In vitro dynamic digestion was performed using the DIVHS-IV system (Xiaodong Yijian Instruments Co., Ltd., Suzhou, China), which included a bionic gastrointestinal human model. A 100 g sample was placed in the bionic human stomach to start the gastric emptying or gastrointestinal digestion process. The ambient temperature was set at 37 °C. For the gastric emptying experiment, the chyme discharged from the end of the duodenum was collected every 20 min and weighed to determine the gastric emptying curve and half-emptying time.

[0110] In order to further quantitatively compare the gastric emptying characteristics, the Elashoff index model, which is widely used to characterize gastric emptying of food matrices, was used to fit the gastric emptying data. The mycelial gastric emptying data of FCPD and wild-type strains were well fitted by the model (see Figure 8 ). Further comparison of the gastric half-emptying time t 1 / 2 (See Table 1). The half-emptying time of the wild-type WT is 96.18 min, while the half-emptying time of FCPD is 109.98 min, which is significantly improved compared with the wild-type. This indicates that knocking out the FvChs gene and the thiamine diphosphate-binding protein gene can significantly slow down the gastric emptying process, which is beneficial for its application in high-satiety foods.

[0111] Table 1 Elashoff model fitting results

[0112] sample k(1 / min) β <![CDATA[t 1 / 2 (min)]]> <![CDATA[r 2 ]]> WT 0.0206±0.0014 4.88±0.74 98.37 0.992 FCPD 0.01947±0.001 5.55±0.65 109.98 0.995

[0113] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Fusarium venenatum FCPD, characterized in that: The Venezia fungus FCPD was deposited in the China Center for Type Culture Collection on December 6, 2024, with the deposit number CCTCC NO:M20242752.

2. A product containing the Fusarium venezuelae FCPD according to claim 1.

3. A method for improving the protein conversion rate of Fusarium venezuelae, characterized in that: The chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium venezuelae are knocked out; the nucleotide sequence of the gene FvChs is shown in SEQ ID NO.1, and the nucleotide sequence of the gene Pdc is shown in SEQ ID NO.

2.

4. A method for increasing the oil content of Fusarium venezuelae, characterized in that: The chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium venezuelae are knocked out; the nucleotide sequence of the gene FvChs is shown in SEQ ID NO.1, and the nucleotide sequence of the gene Pdc is shown in SEQ ID NO.

2.

5. A method for improving satiety of Fusarium venezuelae, characterized in that: The chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium venezuelae are knocked out; the nucleotide sequence of the gene FvChs is shown in SEQ ID NO.1, and the nucleotide sequence of the gene Pdc is shown in SEQ ID NO.

2.

6. The method according to claim 5, characterized in that: The method of improving the satiety of Fusarium venezuelae is to prolong the gastric emptying time.

7. A method for preparing mycelial protein, characterized in that: The Fusarium venezuelae FCPD according to claim 1 is cultured.

8. The method according to claim 7, characterized in that Culture at 28°C-32°C for 48-96h, with a rotation speed of 100rpm-250rpm.

9. Use of the method according to any one of claims 3 to 6 for increasing the bacterial protein content, substrate glucose conversion rate, protein conversion rate, fat content and / or prolonging gastric emptying time of Fusarium venezuelae.

10. Use of the Fusarium venezuelae FCPD according to claim 1 in preparing products with high satiety and / or high protein content and / or high fat content.

Images