Retinal ganglion cell specific promoters and uses thereof

Abstract

The present invention relates to a nucleic acid sequence derived from a regulatory region of a human sox4 gene and having promoter activity in retinal ganglion cells. The invention also relates to an expression cassette or vector comprising the promoter, a viral particle or cell comprising the expression cassette or vector, and a pharmaceutical composition comprising the expression cassette or vector and the viral particle or cell. The invention also relates to the use of the expression cassette, vector, viral particle, cell or pharmaceutical composition in the treatment of eye diseases, especially eye diseases associated with retinal ganglion cell or photoreceptor cell degeneration.

Description

Technical Field

[0001] The present invention relates to a nucleic acid sequence derived from the regulatory region of human sox4 gene and having promoter activity in retinal ganglion cells. Specifically, the present invention relates to a retinal ganglion cell-specific promoter and its use in medicine, especially in treating eye diseases. Background Art

[0002] Retinal neurodegenerative diseases, including retinitis pigmentosa and age-related macular degeneration, are blinding eye diseases caused by the degeneration and death of key retinal cells such as photoreceptors, which in turn leads to loss of visual function or even blindness. The pathogenesis of retinal neurodegenerative diseases seriously damages the patient's vision, and currently, the existing treatment methods cannot escape the fate of irreversible loss of visual function. Its pathogenesis is often due to the apoptosis reaction of the photoreceptor cells themselves due to gene mutations or the imbalanced retinal microenvironment (such as new blood vessels, death of retinal pigment epithelial cells, etc.) aggravating the apoptosis of photoreceptor cells. According to the pathogenesis, the treatment strategies mainly focus on (1) overexpression or gene editing to repair related mutant genes to delay the degeneration of photoreceptor cells; (2) inhibiting new blood vessel formation to reduce damage to photoreceptor cells; and (3) other retinal neurons (such as bipolar cells or ganglion cells, etc.) express photosensitive proteins to perform photosensitivity.

[0003] The strategy of restoring vision by expressing photosensitive proteins in other retinal neurons is currently the most popular research topic. Photosensitive proteins include endogenous photosensitive proteins (such as opsin, rhodopsin, melanopsin, etc.) and exogenous photosensitive proteins. Studies have found that expressing endogenous photosensitive proteins or their fusions with the metabotropic glutamate receptor mGLUR can restore partial vision in blind mice. This strategy is currently in the early stages of research and development. The use of exogenous photosensitive proteins, such as light-sensitive ion channel proteins (such as chr2, chrimsonR, MCO, etc.), has also achieved vision restoration in mice, and related products have entered the clinic, with relatively positive preliminary results.

[0004] Gene expression in retinal ganglion cells (RGCs) has been obtained by using ubiquitous promoters.Ubiquitous promoters provide strong but unrestricted gene expression patterns in tissues.Ubiquitous eukaryotic promoters are derived from the promoters of chicken beta actin (CBA) gene or phosphoglycerate kinase (PGK) or elongation factor 1α (EF1α).Other ubiquitous promoters of viral origin include promoters derived from cytomegalovirus (CMV) or synthetic promoter sequences such as CAG.However, it has been confirmed that the regulation of CMV promoter depends on many cell signaling pathways that can change the expression of the gene transferred into.In addition, these promoters are not limited to given cell types, and they are delivered to all cells therein such as retinal pigment epithelium (RPE), retina and other eye tissues outside the retina such as ciliary body, iris, cornea, etc., causing expression.

[0005] Tissue-specific promoters that cause expression in RPE or photoreceptor cells have also been used to obtain gene expression that is limited to retinal cells. Promoters such as promoters based on RPE65, VMD2 and OA1 cause gene expression in RPE cells, while promoters of people (RK) or cattle (RHO) rhodopsin kinase or the promoter of mouse opsin (mOP) cause expression that is limited to photoreceptor cells. These promoters are limited to retina, but efficiency is not high in RGC.

[0006] To achieve the expression of photosensitive proteins in other retinal neurons, such as using retinal ganglion cells (RGCs), a specific and efficient promoter, i.e., a cell-specific promoter, is required. Cell-specific promoters are important elements in gene regulation, and they play a key role in maintaining cell specificity and tissue specificity in organisms. Promoters are regulatory regions of genes that are responsible for initiating the process of gene transcription, so that gene expression produces the corresponding protein. Cell-specific promoters have the ability to initiate gene expression in specific types of cells, so that the function of genes can be precisely regulated in specific cell types.

[0007] The characteristics of cell-specific promoters are mainly reflected in the following aspects:

[0008] Specific expression: Cell-specific promoters can ensure that genes are expressed in specific cell types, while being silenced in other cell types. This specific expression is the basis of cell differentiation and tissue development in organisms, ensuring the coordinated and orderly operation of various cell functions.

[0009] Regulatory elements: Cell-specific promoters usually contain multiple regulatory elements, such as enhancers and repressors, which interact with transcription factors to form a complex regulatory network. These regulatory elements play an important role in maintaining cell specificity and regulate promoter activity through interactions.

[0010] Signal transduction pathways: The activation of cell-specific promoters is often associated with extracellular signal transduction pathways. For example, the activity of some cell-specific promoters is regulated by extracellular factors, which activate specific signal transduction pathways and ultimately affect the activity of the promoter, thereby regulating gene expression.

[0011] Epigenetic regulation: In addition to traditional genetic regulation mechanisms, the activity of cell-specific promoters is also affected by epigenetic regulation. Epigenetic modifications such as DNA methylation and histone modification can play an important regulatory role in cell-specific gene expression.

[0012] Cell-specific promoters can be used as an important resource for gene therapy applications. Designing gene expression vectors using cell-specific promoters can achieve gene therapy and gene regulation for specific cell types. In addition, the specificity of promoters can also be used in gene editing technology to achieve precise editing and regulation of specific cell populations.

[0013] Chinese patent number CN109661471A describes a nucleic acid sequence derived from the regulatory region of the gamma-synuclein gene (SNCG) as a retinal ganglion cell-specific promoter, which allows the target gene to be expressed strongly, stably and specifically in RGCs. Gensight Biologics uses the SNCG promoter to express the light-sensitive ion channel protein ChrimsonR. Preliminary clinical results show that after administration, patients can see objects on the table by wearing special glasses.

[0014] Therefore, the screening of cell-specific promoters is a complex and critical research task, and its results are of great significance for understanding the mechanism of cell fate determination, the occurrence and development of diseases, and especially for developing new therapeutic strategies. There has always been a need in the art for promoters that allow target genes to be expressed strongly, stably and specifically in RGCs. Summary of the invention

[0015] The present invention provides a novel transcriptional promoter that can drive high levels of gene expression specifically in retinal ganglion cells (RGCs).

[0016] In the first aspect of the present invention, an isolated nucleic acid (hereinafter also referred to as a promoter) is provided, which has promoter activity in retinal ganglion cells and comprises a nucleotide sequence of any one of SEQ ID NOs: 1-7, or a functional variant having at least 80% identity with any one of SEQ ID NOs: 1-7.

[0017] In one embodiment, the isolated nucleic acid consists of the nucleotide sequence of any one of SEQ ID NOs: 1-7, or a functional variant having at least 80% identity to any one of SEQ ID NOs: 1-7.

[0018] In one embodiment, the isolated nucleic acid has retinal ganglion cell-specific promoter activity.

[0019] In a second aspect of the present invention, an expression cassette is provided, comprising the isolated nucleic acid according to the first aspect of the present invention.

[0020] In one embodiment, the expression cassette further comprises a nucleic acid of interest operably linked to the isolated nucleic acid of the present invention.

[0021] In one embodiment, the target nucleic acid is a nucleic acid encoding a target polypeptide.

[0022] In one embodiment, the polypeptide of interest is a therapeutic protein, an optogenetic driver protein, or a reporter protein.

[0023] In one embodiment, the target polypeptide is a therapeutic protein, wherein the therapeutic protein can be selected from MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7 and ACO2, or can be a neurotrophic factor selected from GDNF, VEGF, CNTF, FGF2, BDNF and EPO, an anti-apoptotic protein selected from BCL2 and BCL2L1, an anti-angiogenic factor selected from endostatin, angiostatin and sFlt, an anti-inflammatory factor selected from IL10, IL1R1, TGFBI and IL4, or a rod-derived cone activity factor (RdCVF).

[0024] In one embodiment, the polypeptide of interest is an optogenetic driver protein, wherein the optogenetic driver protein can be an optogenetic activator, which is preferably selected from rhodopsin, photopsin, melanopsin, pinealopsin, parapinealopsin, VA opsin, periopsin, neuroopsin, brainopsin, retinal pigment, RGR opsin, microbial opsins with red-shifted spectral properties (e.g., ReaChR, Chrimson or ChrimsonR), vertebrate opsins that recruit Gi / o signaling (e.g., short-wavelength vertebrate opsins or long-wavelength vertebrate opsins), The invention relates to an optogenetic inhibitor, which is preferably selected from halophilic rhodopsins (e.g., NpHR, eNpHR2.0, eNpHR3.0, and Halo57), archaeal rhodopsins (e.g., Arch and AR-3), bacterial rhodopsins (e.g., eBR, proteobacterial rhodopsins, and xanthomonas rhodopsins), sphaerocystis fungal opsin (Mac), great white shark cross halophilic rhodopsin, and variants of the above proteins.

[0025] In one embodiment, the target polypeptide is a reporter protein, wherein the reporter protein can be selected from fluorescent protein, calcium indicator, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase and variants of the above proteins.

[0026] In one embodiment, the target nucleic acid encodes a nucleic acid selected from the group consisting of siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozyme and deoxyribozyme (DNAzyme).

[0027] In a third aspect of the present invention, a vector is provided, comprising the isolated nucleic acid according to the first aspect of the present invention or the expression cassette according to the second aspect of the present invention.

[0028] In one embodiment, the vector is a viral vector.

[0029] In one embodiment, the vector is a retroviral vector or a parvoviral vector. In one embodiment, the vector is a Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV or SNV vector, a lentiviral vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector, a simian virus 40 (SV-40) vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, a herpes virus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a mouse mammary tumor virus vector or a Rous sarcoma virus vector. In one embodiment, the vector is an adeno-associated virus (AAV) vector and may comprise two ITRs flanking the target nucleic acid.

[0030] In a fourth aspect of the present invention, a virus particle is provided, which comprises the vector according to the third aspect of the present invention.

[0031] In one embodiment, the vector is an AAV vector. In one embodiment, the viral particle further comprises an AAV-derived capsid. In one embodiment, AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj. In one embodiment, the AAV serotype is preferably selected from AAV-2, AAV-5, AAV2-7m8, AAV-9, and AAV-8, more preferably AAV-2 or AAV2-7m8.

[0032] In a fifth aspect of the present invention, a cell is provided, comprising the isolated nucleic acid according to the first aspect of the present invention, the expression cassette according to the second aspect of the present invention, the vector according to the third aspect of the present invention or the viral particle according to the fourth aspect of the present invention.

[0033] In one embodiment, the cell is a retinal ganglion cell.

[0034] In the sixth aspect of the present invention, a pharmaceutical composition is provided, which comprises the isolated nucleic acid according to the first aspect of the present invention, the expression cassette according to the second aspect of the present invention, the vector according to the third aspect of the present invention, the viral particle according to the fourth aspect of the present invention or the cell according to the fifth aspect of the present invention, and a pharmaceutically acceptable excipient.

[0035] In the seventh aspect of the present invention, a method for treating an eye disease is provided, comprising administering to a patient in need thereof a therapeutically effective amount of an isolated nucleic acid according to the first aspect of the present invention, an expression cassette according to the second aspect of the present invention, a vector according to the third aspect of the present invention, a viral particle according to the fourth aspect of the present invention, a cell according to the fifth aspect of the present invention, or a pharmaceutical composition according to the sixth aspect of the present invention.

[0036] In one embodiment, the eye disease is a disease associated with retinal ganglion cell degeneration. In one embodiment, the eye disease is selected from hereditary optic neuropathy (Leber's hereditary optic neuropathy, dominant optic neuropathy), compressive optic neuropathy (orbital pseudotumor, thyroid eye disease), autoimmune optic neuropathy (lupus), diabetic retinopathy, glaucomatous optic neuropathy (GOND), including glaucoma, arterial ischemic optic neuropathy (giant cell arteritis), non-arteritic ischemic optic neuropathy, infiltrative optic neuropathy (sarcoidosis), infectious optic neuropathy (syphilis, Lyme disease, toxoplasmosis, herpes zoster), optic neuritis from demyelinating disease and radiation-induced optic neuropathy.

[0037] In another embodiment, the eye disease is a disease associated with photoreceptor cell degeneration. In one embodiment, the eye disease is selected from retinitis pigmentosa, age-related macular degeneration, Stargardt's disease, Leber's hereditary optic neuropathy, cone-rod dystrophy, Leber's congenital amaurosis, diabetic retinopathy, retinal detachment, Best's disease, choroideremia, and tapetal retinal degeneration.

[0038] In the eighth aspect of the present invention, there is provided use of an isolated nucleic acid according to the first aspect of the present invention, an expression cassette according to the second aspect of the present invention, a vector according to the third aspect of the present invention, a viral particle according to the fourth aspect of the present invention, a cell according to the fifth aspect of the present invention or a pharmaceutical composition according to the sixth aspect of the present invention in the preparation of a medicament for treating an eye disease.

[0039] In one embodiment, the eye disease is a disease associated with retinal ganglion cell degeneration. In one embodiment, the eye disease is selected from hereditary optic neuropathy (Leber's hereditary optic neuropathy, dominant optic neuropathy), compressive optic neuropathy (orbital pseudotumor, thyroid eye disease), autoimmune optic neuropathy (lupus), diabetic retinopathy, glaucomatous optic neuropathy (GOND), including glaucoma, arterial ischemic optic neuropathy (giant cell arteritis), non-arteritic ischemic optic neuropathy, infiltrative optic neuropathy (sarcoidosis), infectious optic neuropathy (syphilis, Lyme disease, toxoplasmosis, herpes zoster), optic neuritis from demyelinating disease and radiation-induced optic neuropathy.

[0040] In another embodiment, the eye disease is a disease associated with photoreceptor cell degeneration. In one embodiment, the eye disease is selected from retinitis pigmentosa, age-related macular degeneration, Stargardt's disease, cone-rod dystrophy, Leber's congenital amaurosis, diabetic retinopathy, retinal detachment, Best's disease, choroideremia, and tapetal retinal degeneration.

[0041] In a ninth aspect of the present invention, a method for expressing a target polypeptide or a target nucleic acid in retinal ganglion cells is provided, comprising introducing the isolated nucleic acid according to the first aspect of the present invention, the expression cassette according to the second aspect of the present invention, the vector according to the third aspect of the present invention, or the viral particle according to the fourth aspect of the present invention into the retinal ganglion cells. In one embodiment, the method is an in vitro method.

[0042] In one embodiment, the expression is specific in retinal ganglion cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The present invention will be better understood with reference to the accompanying drawings.

[0044] Figure 1 AAV-human sox4 promoter-EGFP plasmid construct is shown.

[0045] Figure 2 Shown are images of HEK293T cells transfected with AAV-human sox4 promoter-EGFP plasmid.

[0046] Figure 3 The figure shows the expression of EGFP in retinal ganglion cells after subvitreal injection of AAV into wild-type C57 mice. Two weeks later, EGFP was efficiently and relatively specifically expressed in retinal ganglion cells (A, C), whose axons converged in the optic nerve (B) and were also expressed in retinal amacrine cells (D, as indicated by the dotted box).

[0047] Figure 4 Shown are the results of ERG (A, C) and VEP (B, D) tests in wild-type C57 mice after AAV administration for >7 weeks.

[0048] Figure 5 Shown are EGR signals in C3H mice 7 weeks after AAV administration.

[0049] Figure 6 Shown are VEP signals of C3H mice 7 weeks after AAV administration. Specific implementation plan

[0050] The inventors identified a promoter sequence derived from the regulatory region of the human sox4 gene. The promoter can specifically drive high-level gene expression in retinal ganglion cells (RGCs). The promoter is of human origin, so it can better drive expression in retinal ganglion cells of non-human primates and humans. Using this promoter to express a protein with photosensitive function in retinal ganglion cells, blind mice regained vision, providing a new therapeutic strategy for restoring sight to blind patients through similar means in clinical practice.

[0051] In the present invention, unless specifically stated otherwise, the use of the singular includes the plural, the word "a" means "at least one", and the use of "or" means "and / or". In addition, the words "include" and "comprising" are open terms without limitation.

[0052] As used herein, the term "about", when used with a percentage or other quantity, refers to all values ​​within the range of plus or minus 10% of the percentage or other quantity. For example, "about 80%" includes all values ​​within the range of 80% plus or minus 8%.

[0053] All documents cited in this application, including but not limited to patents, patent applications, articles, books and treaties, are hereby expressly incorporated by reference into the present invention for any purpose. If one or more of the incorporated literature and similar materials defines a term in conflict with the definition of the term in this application, the definition in this application shall prevail.

[0054] The term "nucleic acid" or "polynucleotide" used herein refers to the polymeric form of nucleotides of any length, and the nucleotides can be ribonucleotides or deoxyribonucleotides. Therefore, the term includes but is not limited to single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or polymers comprising non-natural or derived nucleotide bases of purine and pyrimidine bases or other natural, chemical or biochemical modifications. The backbone of the polynucleotide can include sugar and phosphate groups (as can be usually present in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can include synthetic subunits such as polymers of phosphoramidates, and therefore can be oligodeoxynucleoside phosphoramidates (P-NH2) or mixed phosphoramidate-phosphodiester oligomers. Nucleic acid of the present invention can be prepared by any technology known to those skilled in the art, including chemical synthesis, reorganization and mutation. In a preferred embodiment, nucleic acid of the present invention is a DNA molecule, which is preferably synthesized by recombinant methods well known to those skilled in the art.

[0055] The term "isolated nucleic acid" as used herein refers to a nucleic acid molecule that has been identified and separated and / or recovered from a component of its natural environment. In particular, the term refers to a nucleic acid molecule that is separated from other nucleic acid molecules present in its natural source. For example, for genomic DNA, the term "isolated" includes nucleic acid molecules separated from chromosomes that are naturally associated with the genomic DNA. Preferably, the "isolated" nucleic acid molecule does not contain sequences that naturally flank the nucleic acid molecule in the genomic DNA of the organism from which the nucleic acid molecule is derived.

[0056] The term "promoter" as used herein refers to a regulatory element that directs the transcription of a nucleic acid to which it is operably linked. A promoter can regulate both the transcription rate and efficiency of an operably linked nucleic acid. A promoter can also be operably linked to other regulatory elements that enhance ("enhancer") or repress ("repressor") promoter-dependent transcription of a nucleic acid.

[0057] The term "promoter activity" as used herein refers to the ability of a promoter to initiate transcription of a nucleic acid to which it is operably linked. Promoter activity can be measured using procedures known in the art. For example, promoter activity can be measured as the amount of transcribed mRNA using, for example, Northern blots or polymerase chain reaction (PCR). Alternatively, promoter activity can be measured as the amount of translated protein product, for example, by Western blots, ELISA, colorimetric assays, and various activity assays, including reporter gene assays.

[0058] As used herein, the term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid molecule such that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence when the promoter is capable of affecting the expression of the coding sequence, i.e., the coding sequence is under the transcriptional control of the promoter.

[0059] The terms "polypeptide" and "protein" used herein are used interchangeably and refer to polymers of amino acid residues and are not limited to a minimum length. These polymers of amino acid residues may contain natural or non-natural amino acid residues and include, but are not limited to, dimers, trimers and polymers of peptides, oligopeptides, amino acid residues. Both full-length proteins and fragments thereof are encompassed by this definition. The term also includes post-translational modifications of polypeptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. In addition, for the purposes of the present invention, "polypeptide" may refer to proteins including modifications such as deletions, additions and substitutions to the parent sequence, as long as the protein maintains the desired activity. These modifications may be carefully designed by site-directed mutagenesis, or may be accidental, such as by mutations in the host producing the protein or errors caused by PCR amplification.

[0060] The term "retinal ganglion cell" or "RGCs" used herein refers to the innermost neurons of the retina, excluding misplaced amacrine cells. They integrate information from photoreceptor cells through the bipolar cells of the retina and project into the brain, where they form synapses in the thalamus, hypothalamus, and superior colliculus. It was found that the neural transcription factor BRN3A (GeneID: 5457) is specifically expressed in RGCs, and antibodies against this protein are considered to be reliable markers for identifying and quantifying RGCs (Quina et al., J. Neurosci. 2005; 25 (50): 11595–11604). Therefore, in a specific embodiment, the term "retinal ganglion cell" or "RGCs" refers to the innermost neurons of the retina expressing BRN3A.

[0061] The term "sequence identity" or "identity" as used herein refers to the number (%) of position matches (same nucleic acid residues) obtained from the comparison of two polynucleotide sequences. Sequence identity is determined by comparing the sequences when aligned to maximize overlap and identity and minimize sequence gaps. In particular, sequence identity can be determined using any of a variety of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., Needleman and Wunsch algorithm; Needleman and Wunsch, 1970) that optimally aligns the sequences over the entire length, while sequences of significantly different lengths are preferably aligned using a local alignment algorithm (e.g., Smith and Waterman algorithm (Smith and Waterman, 1981) or Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005)). Comparison for the purpose of determining nucleotide sequence identity percentage can be realized in various different ways within the art, for example, using publicly available computer software that can be obtained on websites such as http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . Those skilled in the art can determine suitable parameters for measuring comparison, including any algorithm required for obtaining maximum comparison within the full length of the sequence compared. For purposes of the present invention, nucleotide sequence identity percentage values ​​refer to the values ​​produced using paired sequence alignment program EMBOSS Needle, which uses the Needleman-Wunsch algorithm to produce the best global comparison of two sequences, wherein all search parameters are set to default values, i.e., scoring matrix=BLOSUM62, gap opening penalty=10, gap extension penalty=0.5, end gap penalty=error, end gap opening penalty=10, end gap extension penalty=0.5.

[0062] As used herein, the term "subject" or "patient" refers to an animal having a retina, preferably a mammal, and even more preferably a human, including an adult, a child, and a human in the prenatal stage.

[0063] In a first aspect, an isolated nucleic acid is provided, which has promoter activity in retinal ganglion cells and comprises a nucleotide sequence of any one of SEQ ID NOs: 1-7, or a functional variant having at least 80% identity with any one of SEQ ID NOs: 1-7. In one embodiment, the isolated nucleic acid consists of a nucleotide sequence of any one of SEQ ID NOs: 1-7, or a functional variant having at least 80% identity with any one of SEQ ID NOs: 1-7.

[0064] The nucleotide sequences of SEQ ID NO: 1-7 are derived from the regulatory region of the human sox4 gene. Sox4 is a member of the SOX family of proteins containing high mobility group (HMG) domain transcription factors, and plays an important role in retinal cell differentiation. The Sox4 gene is a transcription factor belonging to the SoxC group in the Sox (Sry-related high mobility group box) family, and plays an important role in the differentiation and function of neurons. In retinal ganglion cells, Sox4 is usually involved in regulating the development and survival of neurons. Studies have shown that the expression of Sox4 in retinal ganglion cells is closely related to the fate determination of neurons. It affects the differentiation and function of neurons by regulating the expression of other genes. In addition, Sox4 may also be involved in the growth, synapse formation and maintenance of retinal ganglion cells. In the retina, the expression of the two transcription factors Sox4 and Sox11 is highly overlapping in the embryonic stage of the retina. Targeted deletion of Sox4 or Sox11 leads to a moderate reduction in the number of retinal ganglion cells, but when both genes are deleted at the same time, the ganglion cells are completely absent. CKO mouse experiments have shown that Sox4 and Sox11 control the generation and survival of retinal ganglion cells in the early and late embryonic stages, respectively. Therefore, the expression and function of the Sox4 gene in retinal ganglion cells are crucial for the normal development and function of the nervous system.

[0065] Nucleic acid of the present invention exhibits promoter activity in RGCs, i.e. when introduced into RGCs, it can induce transcription of the nucleic acid operably connected thereto. Preferably, the promoter activity is RGCs specific. The term "RGCs specific" used herein should be understood to mean a promoter that is mainly active in retinal ganglion cells. It should be understood that residual expression that is usually lower in other tissues or cells can not be completely excluded. In a preferred embodiment, the promoter of the present invention is inactive in bipolar, amacrine, horizontal, Muller cells or in photoreceptor cells.

[0066] In one embodiment, the promoter of the present invention comprises the nucleotide sequence of SEQ ID NO: 1 or a functional variant thereof, or consists of the nucleotide sequence of SEQ ID NO: 1 or a functional variant thereof.

[0067] In one embodiment, the promoter of the present invention comprises the nucleotide sequence of SEQ ID NO: 2 or a functional variant thereof, or consists of the nucleotide sequence of SEQ ID NO: 2 or a functional variant thereof.

[0068] In one embodiment, the promoter of the present invention comprises the nucleotide sequence of SEQ ID NO: 3 or a functional variant thereof, or consists of the nucleotide sequence of SEQ ID NO: 3 or a functional variant thereof.

[0069] In one embodiment, the promoter of the present invention comprises the nucleotide sequence of SEQ ID NO: 4 or a functional variant thereof, or consists of the nucleotide sequence of SEQ ID NO: 4 or a functional variant thereof.

[0070] In one embodiment, the promoter of the present invention comprises the nucleotide sequence of SEQ ID NO: 5 or a functional variant thereof, or consists of the nucleotide sequence of SEQ ID NO: 5 or a functional variant thereof.

[0071] In one embodiment, the promoter of the present invention comprises the nucleotide sequence of SEQ ID NO: 6 or a functional variant thereof, or consists of the nucleotide sequence of SEQ ID NO: 6 or a functional variant thereof.

[0072] In one embodiment, the promoter of the present invention comprises the nucleotide sequence of SEQ ID NO: 7 or a functional variant thereof, or consists of the nucleotide sequence of SEQ ID NO: 7 or a functional variant thereof.

[0073] The term "variant" or "functional variant" as used herein refers to a nucleotide sequence that is different from the original sequence but retains its essential properties. In general, the variant is closely similar to the original polynucleotide overall and is identical in many regions. The sequence of the variant may differ in nucleotide substitutions, deletions or insertions of one or more nucleotides in the sequence that do not impair the promoter activity. The variant may have the same length as the original sequence, or may be shorter or longer.

[0074] In one embodiment, the functional variant has at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identity with any one of SEQ ID NOs: 1 to 7. In one embodiment, the functional variant may differ from any one of SEQ ID NOs: 1 to 7 by substitutions, deletions and / or insertions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotides.

[0075] In one embodiment, the functional variant is capable of hybridizing to the nucleotide sequence of any one of SEQ ID NOs: 1-7 or its complementary strand under low, medium or high stringency conditions.

[0076] The term "low stringency conditions" as used herein means that the probe is at least 100 nucleotides in length, prehybridized and hybridized in 5X SSPE, 0.3% SDS, 200 micrograms / mL sheared and denatured salmon sperm DNA and 25% formamide at 42°C, followed by a standard Southern blotting procedure for 12 to 24 hours. The carrier material is finally washed three times with 2X SSC, 0.2% SDS at 50°C for 15 minutes each time.

[0077] The term "moderate stringency conditions" as used herein means that the probe is at least 100 nucleotides in length, prehybridized and hybridized in 5XSSPE, 0.3% SDS, 200 micrograms / mL sheared and denatured salmon sperm DNA and 35% formamide at 42°C, followed by a standard Southern blotting procedure for 12 to 24 hours. The carrier material is finally washed three times with 2X SSC, 0.2% SDS at 55°C for 15 minutes each time.

[0078] The term "high stringency conditions" as used herein means that the probe is at least 100 nucleotides in length, prehybridized and hybridized in 5X SSPE, 0.3% SDS, 200 micrograms / mL sheared and denatured salmon sperm DNA and 50% formamide at 42°C, followed by a standard Southern blotting procedure for 12 to 24 hours. The carrier material is finally washed three times with 2X SSC, 0.2% SDS at 65°C for 15 minutes each time.

[0079] In a second aspect, an expression cassette is provided, comprising the isolated nucleic acid according to the first aspect of the invention. In one embodiment, the expression cassette further comprises a target nucleic acid operably linked to the isolated nucleic acid of the invention.

[0080] The term "expression cassette" used herein refers to a nucleic acid construct comprising one or more control sequences required for the expression of a coding sequence and the coding sequence. In particular, one of these control sequences is a promoter of the present invention. Typically, the expression cassette comprises the coding sequence required for expressing a selected gene product and regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. Therefore, the expression cassette typically comprises a promoter sequence, a coding sequence, and a 3' non-translated region that typically contains a polyadenylation site and / or a transcription terminator. The expression cassette may also include other regulatory elements, such as an enhancer sequence, a multiple cloning site sequence and / or a splicing signal sequence that is convenient for the insertion of a DNA fragment in a vector. The expression cassette is typically contained in a vector for ease of cloning and transformation.

[0081] In a preferred embodiment, the target nucleic acid is a heterologous nucleic acid. The term "heterologous" as used herein means a nucleic acid other than the nucleic acid to which the promoter is operably linked in a naturally occurring genome. In particular, in certain embodiments, the promoter of the present invention is not operably linked to a sox4 gene, particularly a human sox4 gene.

[0082] In one embodiment, the target nucleic acid is a nucleic acid encoding a target polypeptide. The target polypeptide can be any polypeptide that needs to be expressed in RGCs. In particular, the target polypeptide can be a therapeutic protein, an optogenetic driver protein, or a reporter protein.

[0083] In one embodiment, the target nucleic acid is a therapeutic gene, ie, a gene encoding a therapeutic protein.

[0084] The term "therapeutic gene" as used herein refers to a gene encoding a therapeutic protein useful in the treatment of a pathological condition. The therapeutic gene, when expressed, provides a beneficial effect to the cells or tissues in which it is present or to the patient in which the gene is expressed in the body. Examples of beneficial effects include improvement of signs or symptoms of a condition or disease, prevention or inhibition of a condition or disease, or provision of a desired characteristic. Therapeutic genes include genes that partially or completely correct genetic defects in patients. In particular, the therapeutic gene may be, but is not limited to, a nucleic acid sequence encoding a protein useful in gene therapy to alleviate defects caused by the absence, defect or suboptimal level of the protein in the cells or tissues of the subject. The therapeutic polypeptide may, for example, provide polypeptides and / or enzyme activities that are absent, defective or present at suboptimal levels in RGCs, providing polypeptides and / or enzyme activities that indirectly offset imbalances in RGCs. The therapeutic polypeptide may also be used to reduce the activity of a polypeptide by, for example, acting as a dominant negative polypeptide. Preferably, the therapeutic polypeptide provides a polypeptide and / or enzyme activity that is absent, deficient, or present at suboptimal levels in RGCs, more preferably a polypeptide and / or enzyme activity that is absent or deficient in RGCs.

[0085] Examples of therapeutic genes include, but are not limited to, nucleic acids used to replace deleted or mutated genes known to cause retinal diseases, such as MT-ND4 (Gene ID: 4538), MT-ND1 (Gene ID: 4535), MT-ND6 (Gene ID: 4541), MT-CYB (Gene ID: 4519), MT-CO3 (Gene ID: 4514), MT-ND5 (Gene ID: 4540), MT-ND2 (Gene ID: 4536), MT-COI (Gene ID: 4512), MT-ATP6 (Gene ID: 4508), MT-ND4L (Gene ID: 4539), OPA1 (Gene ID: 4976), OPA3 (Gene ID: 80207), OPA7 (Gene ID: 84233) and ACO2 (Gene ID: 50).

[0086] The therapeutic gene can also encode neurotrophic factors, such as GDNF (Gene ID: 2668), CNTF (Gene ID: 1270), FGF2 (Gene ID: 2247), BDNF (Gene ID: 627) and EPO (Gene ID: 2056), anti-apoptotic genes such as BCL2 (Gene ID: 596) and BCL2L1 (Gene ID: 598), anti-angiogenic factors such as endostatin, angiostatin and sFlt, anti-inflammatory factors such as IL10 (Gene ID: 3586), IL1R1 (Gene ID: 3554), TGFBI (Gene ID: 7045) and IL4 (Gene ID: 3565), or rod-derived cone activity factor (RdCVF) (Gene ID: 115861).

[0087] Additional signal peptides may be added to therapeutic proteins, in particular in order to import them into certain organelles (eg mitochondria), to secrete them from the cell, or to insert them into the cell membrane.

[0088] In one embodiment, the target polypeptide is an optogenetic driver protein. The term "optogenetic driver protein" as used herein refers to a photochemically reactive polypeptide that uses vitamin A or its isoforms as a chromophore. Optogenetic driver proteins are light-gated ion pumps or channels that absorb light and are activated by light. The optogenetic driver protein can be from a prokaryotic organism or a eukaryotic organism. In particular, it can be a microbial opsin or a vertebrate opsin. The optogenetic driver protein can be an optogenetic activator or an optogenetic inhibitor.

[0089] Optogenetic activators cause cells to depolarize after being exposed to light. When cells depolarize, the internal negative charge of cells becomes positive in a short term. The transition of the cell's internal environment from negative to positive allows both transmission of electrical pulses in cells and optionally between cells. The example of optogenetic activators includes but is not limited to rhodopsin, photopsin, melanopsin, pinealopsin, pinealopsin, VA opsin, periopsin, neuroopsin, brainopsin, retinal pigment, RGR opsin, microbial opsin (such as ReaChR, Chrimson or ChrimsonR) with red-shifted spectral properties, vertebrate opsin (such as short-wavelength vertebrate opsin or long-wavelength vertebrate opsin) summoning Gi / o signal transduction, channelrhodopsin (such as channelrhodopsin-1 and channelrhodopsin-2, from Chlamydomonas reinhardtii) and variants of the above-mentioned proteins from Chlamydomonas microalgae. A large number of variants of channelrhodopsin (such as codon-optimized variants, mutants, chimeras) are constantly produced to improve some features of these proteins. Examples of such variants include, but are not limited to, hChR2(L132C), ChR2(H134R), ChETA(E123T), C1V1(E122T), C1V1(E162T), C1V1(E122 / 162T), hChR2(C128A), hChR2(C128S), hChR2(C128T), hChR2(C128A / H134R), hCatch(T 159S), hChief, hChR2(C128S / D156A), hChR2(T159C), hChR2(E123T / T159C), hChR2c(C128T), ChR2c(C128T), ChR2e(Q117C) and SwitChR (for review, see Prakash et al., Nat Methods. 2012 Dec;9(12):1171-9).

[0090] Optogenetic inhibitors cause cell hyperpolarization after exposure to light. When a cell hyperpolarizes, the internal negative charge of the cell becomes more negative in the short term. The shift to a more negative level inhibits the action potential by increasing the stimulus required to shift the membrane potential toward the action potential threshold. In a particular embodiment, the optogenetic inhibitor is a light-gated ion pump that transports chloride ions inward and / or cations outward after absorbing photons. Any suitable light-gated, retina-dependent ion pump that transports chloride ions inward or cations outward after absorbing photons can be used as an optogenetic inhibitor. Examples of optogenetic inhibitors include, but are not limited to, halorhodopsins such as halorhodopsin (NpHR), enhanced halorhodopsin (eNpHR2.0 and eNpHR3.0) and red-shifted halorhodopsin Halo57, archaeal rhodopsin-3 (AR-3), archaeal rhodopsin (Arch), bacterial rhodopsins such as enhanced bacterial rhodopsin (eBR), proteobacterial rhodopsin, xanthomonas rhodopsin, Microcystis punctata fungal opsin (Mac), great white shark cross halorhodopsin, and variants of the above proteins.

[0091] In a particularly preferred embodiment, the optogenetic driver protein is an optogenetic activator, preferably selected from channelrhodopsin, ChrimsonR and variants thereof.

[0092] In one embodiment, the target polypeptide is a reporter protein. Preferably, the reporter protein is detectable in living RGCs. The expression of the reporter protein under the control of the promoter of the present invention allows specific detection or identification of RGCs. The reporter protein can be, for example, a fluorescent protein (such as GFP), a calcium indicator (such as GCamP), a luciferase, an alkaline phosphatase, a β-galactosidase, a β-lactamase, a horseradish peroxidase and variants thereof. In a specific embodiment, the reporter protein is selected from a fluorescent protein, a calcium indicator, an alkaline phosphatase, a β-galactosidase, a β-lactamase, a horseradish peroxidase and variants thereof.

[0093] In one embodiment, the target nucleic acid encodes any nucleic acid that needs to be expressed, for example, any nucleic acid that needs to be expressed in RGCs. In particular, the nucleic acid that needs to be expressed can be a therapeutic nucleic acid. In one embodiment, the therapeutic nucleic acid is selected from siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozymes and deoxyribozymes (DNAzyme). In a specific embodiment, the target nucleic acid, when transcribed by the promoter of the present invention, can treat or prevent the disease by interfering with the translation or transcription of the abnormal or excessive protein associated with eye diseases. For example, the target nucleic acid can encode an RNA that treats the disease by highly specifically eliminating or reducing the mRNA encoding abnormal and / or excessive protein.

[0094] In a third aspect, a vector is provided, comprising a promoter or an expression cassette according to the present invention.

[0095] The term "vector" as used herein refers to a nucleic acid molecule used as a medium to transfer genetic material in vitro or in vivo, particularly to deliver nucleic acids into a host cell. Vectors include, but are not limited to, plasmids, phagemids, cosmids, transposable elements, viruses, and artificial chromosomes (e.g., YACs). Preferably, the vector of the present invention is a vector suitable for gene or cell therapy, particularly suitable for targeting RGCs.

[0096] The vector of the present invention is preferably a viral vector, which includes any elements required to establish expression of the target polypeptide in a host cell, such as the promoter, ITR, ribosome binding element, terminator, enhancer, selection marker, intron, polyA signal and / or replication origin of the present invention.

[0097] In certain embodiments, the vector is a viral vector, such as a vector derived from Moloney murine leukemia virus (MoMLV), MSCV, SFFV, MPSV or SNV, a lentiviral vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)), an adenovirus (Ad) vector, an adeno-associated virus (AAV) vector, a simian virus 40 (SV-40) vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, a herpes virus vector, a vaccinia virus vector, a Harvey murine sarcoma virus vector, a mouse mammary tumor virus vector or a Rous sarcoma virus vector. In a specific embodiment, the vector is a retroviral vector, preferably a lentiviral vector, or a non-pathogenic parvoviral vector. As is known in the art, depending on the specific viral vector considered for use, appropriate sequences should be introduced into the vector of the invention to obtain a functional viral vector, such as AAV ITRs for AAV vectors or LTRs for lentiviral vectors. In one embodiment, the vector is an adeno-associated virus (AAV) vector.

[0098] Human parvovirus adeno-associated virus (AAV) is a dependent virus that is naturally defective in replication and can be integrated into the genome of infected cells to establish a latent infection. The last property seems to be unique among mammalian viruses because the integration occurs at a specific site (19q13.3-qter) called AAV S1 on chromosome 19 in the human genome. Therefore, AAV has aroused considerable interest as a potential vector for human gene therapy. The favorable properties of the virus include its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the ability to infect a wide range of cell lines derived from different tissues. The term "AAV vector" used herein refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequences that are not AAV-derived), and the heterologous sequence is flanked by at least one AAV terminal inverted repeat sequence (ITR), preferably two ITRs. This AAV vector can be replicated and packaged in infectious virus particles when present in a host cell that has been infected with a suitable helper virus (or a virus expressing a suitable helper virus function) and expresses AAVrep and cap gene products (i.e., AAV Rep and Cap proteins). "Terminal inverted repeats" or "ITR" sequences are well-known terms in the art and refer to relatively short sequences that are present at the ends of the viral genome and in opposite directions. The "AAV terminal inverted repeat (ITR)" sequence is a sequence of about 145 nucleotides present at both ends of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can exist in either of two optional orientations, causing heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter self-complementary regions (referred to as A, A', B, B', C, C and D regions), allowing intrachain base pairing to occur within this portion of the ITR. The AAV ITR used in the vector of the present invention may have a wild-type nucleotide sequence, or may be altered by insertion, deletion or substitution. The serotype of the inverted terminal repeat sequence (ITR) of the AAV vector may be selected from any known human or non-human AAV serotype. The promoter or expression cassette of the present invention may be introduced into the vector by any method known to the skilled person.

[0099] The vector may also include one or more nucleic acid sequences encoding selectable markers such as auxotrophic markers (e.g., LEU2, URA3, TRP 1 or HIS3), detectable tags such as fluorescent or luminescent proteins (e.g., GFP, eGFP, DsRed, CFP) or proteins providing resistance to chemical / toxic compounds (e.g., the MGMT gene providing resistance to temozolomide). These markers may be used to select or detect host cells comprising the vector and may be easily selected by a skilled person according to the host cell.

[0100] In a fourth aspect, a viral particle is provided, comprising the vector according to the present invention.

[0101] In a specific embodiment, the vector is an AAV vector and is packaged in an AAV-derived capsid to produce an "adeno-associated virus particle" or "AAV particle". Therefore, the term "AAV particle" used herein refers to a virus particle composed of at least one AAV capsid protein and an encapsidated AAV vector genome. AAV serotypes include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, and AAVdj, etc. In addition, non-natural engineered variants and chimeric AAVs may also be useful. In particular, the capsid protein may be a variant comprising one or more amino acid substitutions that enhance transduction efficiency. In one embodiment, the capsid is preferably selected from AAV-2, AAV-5, AAV2-7m8, AAV-9 and AAV-8 serotype capsids, more preferably an AAV-2 derived capsid such as an AAV-2 or AAV2-7m8 capsid.

[0102] Different AAV serotypes are used to optimize the transduction of specific target cells or to target specific cell types (e.g., RGCs) within specific target tissues. AAV particles can contain viral proteins and viral nucleic acids of the same serotype or any natural or artificial sequence variants of AAV. For example, the AAV particles can contain AAV2 capsid proteins and at least one, preferably two AAV2 ITRs. Any combination of AAV serotypes for producing AAV particles is provided herein. AAV viruses can be engineered using conventional molecular biology techniques so that these particles can be optimized for cell-specific delivery of nucleic acid sequences, for minimizing immunogenicity, for regulating stability and particle lifespan, for efficient degradation, and for accurate delivery to the cell nucleus.

[0103] A number of methods are known in the art for producing viral particles, particularly AAV particles, including transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpes virus-AAV hybrids (Conway, JE et al., (1997) Virology

[0104] 71(11):8780-8789) and baculovirus-AAV hybrids. AAV production cultures for the production of AAV viral particles require: 1) suitable host cells, including, for example, cell lines of human origin such as HeLa, A549 or 293T cells, or in the case of baculovirus production systems, cell lines of insect origin such as SF-9; 2) suitable helper virus functions, which are provided by wild-type or mutant adenovirus (e.g., temperature-sensitive adenovirus), herpes virus, baculovirus, or plasmid constructs that provide helper virus functions; 3) AAV rep and cap genes and gene products; 4) a target nucleic acid flanked by at least one AAV ITR sequence, such as a vector of the present invention; and 5) suitable culture media and culture media components that support AAV production as is known in the art.

[0105] In the present invention, host cells for producing AAV particles include mammalian cells, insect cells, plant cells, microorganisms and yeast. The host cell can be a packaging cell in which the AAV rep and cap genes are stably maintained in the host cell or a production cell in which the AAV vector genome is stably maintained. Exemplary packaging and production cells are derived from 293T, A549 or HeLa cells. The AAV particles are then purified and formulated using standard techniques known in the art.

[0106] In a fifth aspect, a cell is provided, comprising or transformed with an isolated nucleic acid, expression cassette, vector or viral particle according to the invention. The cell may be any animal cell, plant cell, bacterial cell or yeast. Preferably, the cell is a mammalian cell or an insect cell. More preferably, the cell is a human cell. In one embodiment, the cell is a retinal ganglion cell.

[0107] The nucleic acid, expression cassette, vector or viral particle of the invention can be transferred into the host cell using any known technique, including but not limited to calcium phosphate-DNA precipitation, DEAE-Dextran transfection, electroporation, microinjection, gene gun, lipofection or viral infection, and the nucleic acid, expression cassette, vector or viral particle of the invention can be maintained in the host cell in an ectopic form, or can be integrated into the genome. In a preferred embodiment, the nucleic acid, expression cassette, vector or viral particle of the invention is transferred into the cell by viral infection, preferably using the viral particle of the invention, more preferably using the AAV particle of the invention.

[0108] In a sixth aspect, a pharmaceutical composition is provided, comprising the isolated nucleic acid, expression cassette, vector, viral particle or cell according to the present invention, and a pharmaceutically acceptable excipient.

[0109] As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency or recognized pharmacopoeia for use in animals and / or humans. The term "excipient" refers to a diluent, adjuvant, carrier or vehicle with which a therapeutic agent is administered.

[0110] As is well known in the art, pharmaceutically acceptable excipients are relatively inert substances that facilitate the administration of pharmacologically effective substances, and can be provided as liquid solutions or suspensions, emulsions, or solid forms suitable for dissolving or suspending in liquids before use. For example, excipients can provide shape or consistency, or act as diluents. Suitable excipients include, but are not limited to, stabilizers, wetting and emulsifying agents, salts for changing osmotic pressure, encapsulating agents, pH buffer substances, and buffers. Suitable excipients include any medicament suitable for direct delivery to the eye, which can be administered without excessive toxicity. Pharmaceutically acceptable excipients include, but are not limited to, any one of sorbitol, various tween compounds, and liquids such as water, saline, glycerol, and ethanol. Pharmaceutically acceptable salts can be included, such as inorganic acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, etc., and salts of organic acids such as acetates, propionates, malonates, benzoates, etc. A full discussion of pharmaceutically acceptable excipients can be obtained in Remington's Pharmaceutical Sciences, 15th edition.

[0111] Preferably, the composition is formulated for administration to the eye, in particular by intraocular injection, such as by subretinal and / or intravitreal administration. Thus, the composition can be administered with a pharmaceutically acceptable excipient such as saline, Ringer's balanced salt solution (pH 7.4), etc.

[0112] The pharmaceutical compositions described herein may be packaged in unit-dose or multi-dose form.

[0113] In another embodiment, the pharmaceutical composition comprises cells of the present invention, preferably human cells of the present invention, i.e. cells transformed or transfected with expression cassettes, vectors or viral particles of the present invention, preferably AAV particles. Optionally, the composition comprising cells can be stored frozen at any temperature suitable for storing cells. For example, the cells can be frozen at about -20°C, -80°C or any other suitable temperature. Cryogenically frozen cells can be stored in suitable containers and prepared for storage to reduce the risk of cell damage and maximize the possibility of survival when the cells are thawed. Alternatively, the cells can also be maintained at refrigerated room temperature, such as about 4°C.

[0114] The amount of the pharmaceutical composition to be administered can be determined by standard procedures known to those skilled in the art. To determine a suitable dose, the patient's physiological data (e.g. age, size and weight) and the type and severity of the disease to be treated must be taken into account. In a specific embodiment, the composition comprises the viral particles of the invention, and each unit dose comprises 10 8 Up to 10 13 Virus particles, preferably 10 9 Up to 10 12 The pharmaceutical composition may further comprise one or more other active compounds such as corticosteroids, antibiotics, analgesics, immunosuppressants, nutritional factors or any combination thereof.

[0115] In a seventh aspect, a method for treating an eye disease is provided, comprising administering to a patient in need thereof a therapeutically effective amount of an isolated nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition according to the present invention.

[0116] In one embodiment, the ocular disease is a disease associated with retinal ganglion cell degeneration.

[0117] Examples of diseases associated with retinal ganglion cell degeneration include, but are not limited to, hereditary optic neuropathies (Leber's hereditary optic neuropathy, dominant optic neuropathy), compressive optic neuropathies (orbital pseudotumor, thyroid eye disease), autoimmune optic neuropathies (lupus), diabetic retinopathy, glaucomatous optic neuropathy (GOND), including glaucoma, arterial ischemic optic neuropathy (giant cell arteritis), non-arteritic ischemic optic neuropathy, infiltrative optic neuropathies (sarcoidosis), infectious optic neuropathies (syphilis, Lyme disease, toxoplasmosis, herpes zoster), optic neuritis from demyelinating diseases, and post-irradiation optic neuropathy.

[0118] In a preferred embodiment, the eye disease is selected from Leber's hereditary optic neuropathy and dominant optic neuropathy, preferably selected from optic atrophy, optic atrophy and cataract, and optic atrophy with or without auditory neuropathy, and the target polypeptide is selected from MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7 and ACO2.

[0119] In diseases where photoreceptor cells are lost due to hereditary or acquired diseases, RGCs remain for a long time after photoreceptor cell degeneration. Therefore, RGCs constitute a therapeutic target for restoring the retina using optogenetics. In this case, RGCs are cellular targets independent of degenerated cells, in which the expression of light-sensitive proteins, i.e., optogenetic drivers, in a strong and limited manner is essential for the success of visual restoration. Therefore, in another embodiment, the eye disease is a disease associated with photoreceptor cell degeneration. Preferably, in this embodiment, the target polypeptide is an optogenetic driver as described above, and the treatment is optogenetic therapy. Examples of diseases associated with photoreceptor cell degeneration include, but are not limited to, retinitis pigmentosa, age-related macular degeneration, Stargardt's disease, cone-rod dystrophy, Leber's congenital amaurosis, diabetic retinopathy, retinal detachment, Best's disease, choroideremia, and tapetal retinal degeneration.

[0120] Alternatively, the eye disease is selected from diseases that are not necessarily or specifically associated with retinal ganglion cell or photoreceptor cell degeneration but can be treated or prevented by specifically expressing a nucleic acid encoding a target polypeptide or target nucleic acid in retinal ganglion cells (e.g., glaucoma).

[0121] The term "treatment" used herein refers to any action intended to improve the health status of the patient, such as therapy, prevention, prevention and retardation of the disease. In certain embodiments, this term refers to the improvement or eradication of a disease or a symptom associated with the disease. In other embodiments, the term refers to the minimization of the spread or deterioration of the disease caused by administering one or more therapeutic agents to an object suffering from the disease. In particular, the term "treatment of eye diseases" may refer to providing improved vision, preventing the disease from developing to complete blindness, preventing damage from spreading to uninjured eye cells, improving damage in injured eye cells, preventing the occurrence of retinal damage or saving the treatment of an eye with mild or advanced disease. In certain embodiments, the term refers to preventing, alleviating or stopping the treatment of RGCs degeneration by providing a therapeutic protein that corrects the patient's genetic defects. In certain other embodiments, the term refers to the treatment of restoring the retina or restoring vision using optogenetics.

[0122] As used herein, "therapeutically effective amount" means an amount of a nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition of the invention administered to a subject sufficient to constitute a treatment for an eye disease as defined above. The nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition may be administered as a single dose or in multiple doses.

[0123] In the method for treating an eye disease of the present invention, the nucleic acid, expression cassette, vector, viral particle, cell or pharmaceutical composition of the present invention is preferably administered intraocularly, more preferably by subretinal or intravitreal administration.

[0124] The method of the present invention may further comprise administering to the subject at least one additional therapeutic agent. In particular, the therapeutic agent may be selected from corticosteroids, antibiotics, analgesics, immunosuppressants or nutritional factors or any combination thereof.

[0125] The nucleic acids, expression cassettes, vectors, viral particles, cells or pharmaceutical compositions of the invention can be administered before or after the disease becomes symptomatic, e.g., before or after partial or complete degeneration of RGCs or photoreceptor cells and / or before or after partial or complete loss of vision.

[0126] Retinal neurodegenerative diseases such as retinitis pigmentosa and age-related macular degeneration eventually end with the degeneration and apoptosis of retinal photoreceptor cells, resulting in irreversible damage to vision. Ganglion cell-specific promoters play an important role in the study and treatment of retinal neurodegenerative diseases. These promoters have the ability to specifically initiate gene expression in RGCs and can be used to precisely regulate the expression of therapeutic genes. By utilizing these specific promoters, it is expected to play an important role in the treatment of retinal neurodegenerative diseases. Optogenetic gene therapy is a therapeutic strategy that has attracted widespread attention in recent years, especially showing great potential in the study of retinal neurodegenerative diseases. This method uses light-sensitive proteins, such as light-sensitive ion channels or receptors, to introduce their encoded genes into RGCs and regulate the activity of these proteins through light stimulation. This strategy can achieve precise manipulation of RGCs in vivo and is expected to make breakthrough progress in restoring visual function.

[0127] A cell-specific promoter is an element that plays a key role in the regulation of gene expression, and its function is to ensure the expression of genes in specific cell types. The discovery of this promoter is crucial for understanding the mechanisms of cell fate determination, developmental processes, and disease occurrence. The inventors designed a human sox4 promoter with a nucleotide sequence shown in SEQ ID NO: 1-7 in combination with bioinformatics prediction and transcriptomics data analysis, and verified the activity of the selected promoter by experiments. This can be achieved by the construction method of promoter + reporter gene (EGFP). Human sox4 promoter-EGFP was transfected in cell lines or model organisms, and imaging proved that it could be efficiently and relatively specifically expressed in retinal ganglion cells, and the promoter was expressed in mouse retinal ganglion cells using the promoter, and the waveform and amplitude of the mouse electroretinogram (ERG) and visual evoked potential (VEP) did not cause significant changes, indicating that its activity did not cause functional changes in RGCs.

[0128] Using gene therapy techniques, under the control of the human sox4 promoter, a light-sensitive protein, such as a new type of light-sensitive ion channel protein ChRmine (SEQ ID NO: 8), is efficiently and specifically expressed in retinal ganglion cells using adeno-associated virus (AAV) as a delivery vector, so that it retains its own physiological functions while also having the ability to sense exogenous light. The inventor used this treatment strategy to express ChRmine in photoreceptor cell degeneration blind C3H adult mice (> 6 weeks), not only to achieve the improvement of the visual pathway in the eye, that is, specific electroretinograms (ERG) b-wave signals such as bipolar cells in the middle layer of the retina can be detected, indicating that after obtaining light-sensitive ion channel proteins, retinal ganglion cells can feel the visual information from the outside world, and further integrate this information to downstream retinal neurons for transmission. And visual evoked potential (VEP) nerve impulse signals are also detected in the visual cortex, indicating that the signal is further successfully transmitted to the brain, that is, blind mice can achieve the repair of the entire visual pathway of the eye-brain after expressing ChRmine using this promoter.

[0129] The following examples partly provide further details about various specific embodiments. It will be appreciated by those skilled in the art that the disclosed technology in the following examples represents the technology and / or composition that the inventor has found to work well. However, according to the present invention, it will be appreciated by those skilled in the art that many modifications may be made to the disclosed specific embodiments without departing from the spirit and scope of the present invention, and these modifications still may obtain similar or approximate results. These embodiments are merely for illustrative purposes, rather than to limit the scope of the present invention.

[0130] Example 1: Expression vector construction

[0131] The human sox4 promoter sequence SEQ ID NO: 1-7 was synthesized at Nanjing GenScript Biotechnology Co., Ltd., and the reporter gene EGFP was cloned into the AAV2 expression vector driven by the promoter. The schematic diagram of the construct is shown in Figure 1 .

[0132] In the following examples, the promoter sequence SEQ ID NO: 3 is used as an example, but other promoters of the present invention have been similarly verified (data not provided).

[0133] Example 2: Verification of promoter activity in HEK293T cells

[0134] HEK293T cells (human embryonic kidney cell line) were transfected in vitro with AAV-human sox4 promoter-EGFP plasmid. Two days later, imaging revealed that the reporter gene EGFP was highly expressed in this cell line (see Figure 2 ), indicating that the promoter sequence has the potential to express certain genes, especially in humans.

[0135] Example 3: Verification of promoter activity in mice

[0136] AAV-human sox4 promoter-EGFP AAV particles (AAV2 / 7m8) were produced by Heyuan Biotechnology (Shanghai) Co., Ltd. Wild-type C57 mice (12 weeks old, male) were selected for subvitreous injection, and the dosage was 1.5×10^9VG / eye (1.5ul, 1×10^12VG / ml). Imaging after 2 weeks showed that EGFP was highly and relatively specifically expressed in retinal ganglion cells (see Figure 3 A and D), whose axons converge in the optic nerve ( Figure 3 B), the infection efficiency of RGCs is about 43% ( Figure 3 C), which is more than twice the infection efficiency of the SNCG promoter, and is also expressed in retinal amacrine cells ( Figure 3 E, dashed box).

[0137] Example 4: Effects of promoter expression of reporter gene on mouse ERG and VEP

[0138] Using the AAV particles described in Example 3, wild-type C57 mice were injected with the AAV particles into the vitreous cavity for more than 7 weeks, and then ERG and VEP tests were performed. The results showed that the expression of the reporter gene using this promoter did not cause changes in the waveform and amplitude of the mouse's own ERG (a wave + b wave) and VEP (N1) (see Figure 4 ), indicating that when using this promoter to express the target protein in retinal ganglion cells, regardless of the protein gene factor, the promoter activity itself is safe.

[0139] Example 5: Promoter expression of ChRmine restores visual pathways in the eyes of blind C3H mice

[0140] The promoter of the present invention was used to express the light-sensitive ion channel ChRmine. AAV particles (AAV2 / 7m8) of AAV-human sox4 promoter-ChRmine were produced by Heyuan Biotechnology (Shanghai) Co., Ltd. After subvitreal injection of AAV particles into C3H blind mice for 7 weeks, 0.1 cd*s / m 2 and 2cd*s / m 2 ERG data (electroretinogram) were collected at two light intensities. It was found that under the two light intensities, the experimental group expressing ChRmine was able to record ERG signals (specific b waves of bipolar cells in the middle layer of the retina), and as the light intensity increased, the ERG signal also increased, which is consistent with normal physiological phenomena (see Figure 5 ). Figure 5 The left figure shows the ERG positive group signal of normal C57 mice. Figure 5 The middle panel shows the control signal of blind C3H mice administered a control AAV without the ChRmine gene. Figure 5 The right image shows the experimental group signal of blind C3H mice administered with AAV containing the ChRmine gene. This indicates that after the retinal ganglion cells of C3H mice expressed the light-sensitive ion channel protein ChRmine, they also had the ability to sense exogenous light and restored the visual pathway in the eye.

[0141] Example 6: Promoter expression of ChRmine restores the complete visual pathway of the eye-brain of blind C3H mice

[0142] As described in Example 5, the recording electrodes were subsequently inserted into the visual cortex of the mouse brain to perform VEP testing (visual evoked potentials), and it was found that blind C3H mice expressing ChRmine were also able to record nerve impulses in the visual cortex (see Figure 6 , the meaning of each figure is as described in Example 5), indicating that blind C3H mice can use this promoter to express ChRmine in retinal ganglion cells, thereby improving and repairing the entire visual pathway.

[0143] Sequence information:

[0144] Promoter 1, SEQ ID NO: 1 (2900 bp):

[0145]

[0146] Promoter 2, SEQ ID NO: 2 (1698 bp):

[0147]

[0148] Promoter 3, SEQ ID NO: 3 (2078 bp):

[0149]

[0150] Promoter 4, SEQ ID NO:4 (906bp):

[0151] tgctgtacctagagttgttaaaataattgtgatgacaggtgtctaggtaccactttcttaatggttttcaatatccattgatttattgttttgtggctttctcttcccctttacagctttggctttaagaaagagctggggaacagattttgcaccagaggctgattctttattccaatgctgaaaagaactaataaaaataatcacttggcttttaagcagaaagcttccatttacagtatttcacccttaccccgccccgttccaagccccttgttatctaacataatggttagaatacatttccgtctctccccttaataatttcatgcattaacatcctcttcacacactatacacacacgcacgcgcgcacacacacgcgcgcgcacacacacagcaaaaggaaaaaagaggcagcagaaatctcagctgtacttctagcccttttaaaaagtttgctctgtaaattggaatgaggtcagatttggagcttctcattgcacgcggagattattattgcatcgggttccaagccaatgggaagcccgggggaggggtttggcatgaggaagcgttggttacagcagctgattggctgcagccaagactgtgaaaggataaagaggcgcgaggcggaattggggtctgctctaagctgcagcaagagaaactgtgtgtgaggggaagaggcctgtttcgctgtcgggtctctagttcttgcacgctctttaagagtctgcactggaggaactcctgccattaccagctcccttcttgcagaagggagggggaaacatacatttattcatgccagtctgttgcatgcaggctttttggcttcctaccttgcaacaaaataattgcaccaactccttagtgccgattccgcccacagagagtcct

[0152] Promoter 5, SEQ ID NO: 5 (1286):

[0153]

[0154] Promoter 6, SEQ ID NO: 6 (1506 bp):

[0155]

[0156] Promoter 7, SEQ ID NO: 7 (1886 bp):

[0157]

[0158] The nucleotide sequence of ChRmine, SEQ ID NO:8:

[0159]

Claims

1. An isolated nucleic acid having promoter activity in retinal ganglion cells, characterized in that the isolated nucleic acid comprises a nucleotide sequence of any one of SEQ ID NOs: 1-7, or a functional variant having at least 80% identity with any one of SEQ ID NOs: 1-7.

2. The isolated nucleic acid according to claim 1, characterized in that the isolated nucleic acid consists of the nucleotide sequence of any one of SEQ ID NOs: 1-7, or a functional variant having at least 80% identity with any one of SEQ ID NOs: 1-7.

3. The isolated nucleic acid according to claim 1, characterized in that the isolated nucleic acid has retinal ganglion cell-specific promoter activity.

4. An expression cassette, characterized in that the expression cassette comprises the isolated nucleic acid according to any one of claims 1 to 3.

5. The expression cassette according to claim 4, characterized in that the expression cassette further comprises a target nucleic acid operably linked to the isolated nucleic acid according to any one of claims 1 to 3. The expression cassette according to claim 5 , characterized in that the target nucleic acid is a nucleic acid encoding a target polypeptide. 7 . The expression cassette according to claim 6 , characterized in that the target polypeptide is a therapeutic protein, an optogenetic driver protein or a reporter protein.

8. The expression cassette according to claim 7, characterized in that The therapeutic protein is selected from the group consisting of MT-ND4, MT-ND1, MT-ND6, MT-CYB, MT-CO3, MT-ND5, MT-ND2, MT-COI, MT-ATP6, MT-ND4L, OPA1, OPA3, OPA7, ACO2, GDNF, VEGF, CNTF, FGF2, BDNF, EPO, BCL2, BCL2L1, endostatin, angiostatin, sFlt, IL10, IL1R1, TGFBI, IL4, and RdCVF; The optogenetic driver protein is an optogenetic activator, which is preferably selected from rhodopsin, photopsin, melanopsin, pinealopsin, parapinealopsin, VA opsin, periopsin, neuroopsin, brain opsin, retinal pigment, RGR opsin, microbial opsin with red-shifted spectral properties, vertebrate opsin that summons Gi / o signaling, channel rhodopsin from Chlamydomonas microalgae, and variants of the above proteins; or an optogenetic inhibitor, which is preferably selected from halophilic rhodopsin, archaeal rhodopsin, bacterial rhodopsin, sphaerocystis fungal opsin, great white shark cross halophilic rhodopsin, and variants of the above proteins; and / or The reporter protein is selected from fluorescent protein, calcium indicator, alkaline phosphatase, β-galactosidase, β-lactamase, horseradish peroxidase and variants of the above proteins.

9. The expression cassette according to claim 5, characterized in that the target nucleic acid encodes a nucleic acid selected from the group consisting of siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozyme and deoxyribozyme.

10. A vector, characterized in that the vector comprises the isolated nucleic acid according to any one of claims 1 to 3 or the expression cassette according to any one of claims 4 to 9.

11. The carrier according to claim 10, characterized in that The vector is a viral vector; The vector is a retroviral vector or a parvoviral vector; or The vector is a MoMLV vector, an MSCV vector, an SFFV vector, an MPSV vector, an SNV vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a simian virus 40 vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, a herpes virus vector, a vaccinia virus vector, a Harvey rat sarcoma virus vector, a mouse mammary tumor virus vector or a Rous sarcoma virus vector.

12. A viral particle, characterized in that the viral particle comprises the vector according to any one of claims 10-11.

13. The viral particle according to claim 12, characterized in that The vector is an AAV vector, preferably wherein the AAV serotype is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74 and AAVdj, more preferably selected from AAV-2, AAV-5, AAV2-7m8, AAV-9 and AAV-8, more preferably AAV-2 or AAV2-7m8.

14. A cell, characterized in that the cell comprises the isolated nucleic acid according to any one of claims 1 to 3, the expression cassette according to any one of claims 4 to 9, the vector according to any one of claims 10 to 11 or the viral particle according to any one of claims 12 to 13.

15. The cell according to claim 14, characterized in that the cell is a retinal ganglion cell.

16. A pharmaceutical composition, characterized in that the pharmaceutical composition comprises the isolated nucleic acid according to any one of claims 1 to 3, the expression cassette according to any one of claims 4 to 9, the vector according to any one of claims 10 to 11, the viral particle according to any one of claims 12 to 13 or the cell according to any one of claims 14 to 15, and a pharmaceutically acceptable excipient.

17. Use of the isolated nucleic acid according to any one of claims 1 to 3, the expression cassette according to any one of claims 4 to 9, the vector according to any one of claims 10 to 11, the viral particle according to any one of claims 12 to 13, the cell according to any one of claims 14 to 15 or the pharmaceutical composition according to claim 16 in the preparation of a medicament for treating an eye disease.

18. The use according to claim 17, characterized in that The eye disease is a disease associated with retinal ganglion cell degeneration; The eye disease is selected from hereditary optic neuropathy, compressive optic neuropathy, autoimmune optic neuropathy, diabetic retinopathy, glaucomatous optic neuropathy, arterial ischemic optic neuropathy, non-arteritic ischemic optic neuropathy, infiltrative optic neuropathy, infectious optic neuropathy, optic neuritis from demyelinating disease and post-radiation optic neuropathy; The eye disease is a disease associated with photoreceptor cell degeneration; or The eye disease is selected from the group consisting of retinitis pigmentosa, age-related macular degeneration, Stargardt's disease, cone-rod dystrophy, Leber's congenital amaurosis, diabetic retinopathy, retinal detachment, Best's disease, choroideremia, and tapetal retinal degeneration.

19. An in vitro method for expressing a target polypeptide or nucleic acid in retinal ganglion cells, characterized in that the method comprises introducing the isolated nucleic acid according to any one of claims 1 to 3, the expression cassette according to any one of claims 4 to 9, the vector according to any one of claims 10 to 11 or the viral particle according to any one of claims 12 to 13 into retinal ganglion cells.

Images