Pseudosciaena crocea SOCS1 gene promoter and application thereof

Abstract

The invention belongs to the field of gene engineering, and particularly relates to a large yellow croaker SOCS1 gene promoter and application thereof. The nucleotide sequence of the large yellow croaker SOCS1 gene promoter is as shown in SEQ ID NO. 1. The large yellow croaker SOCS1 gene promoter is constructed to a pGL3.0 vector and transfected to a carp epithelioma cell (EPC), so that the large yellow croaker SOCS1 gene promoter has relatively high basic activity, and the activity of the large yellow croaker SOCS1 gene promoter is remarkably reduced by a mutated interferon stimulus response element (ISRE) motif; under the stimulation of a virus analogue poly (I: C), the activity of the large yellow croaker SOCS1 gene promoter is further improved, and the activity of a mutated promoter is reduced. The large yellow croaker SOCS1 gene promoter provided by the invention can be used for promoting target gene expression, researching a fish antiviral immune mechanism and breeding fish transgenosis.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to a large yellow croaker SOCS1 gene promoter and its application. Background Art

[0002] Suppressor of cytokine signaling 1 (SOCS1) is one of the negative regulators of type I interferon (IFN) signaling. By negatively regulating the JAK-STAT signaling pathway mediated by type I IFN, it inhibits the antiviral immune response. Existing studies have shown that viruses such as respiratory syncytial virus and flavivirus utilize SOCS1 to negatively regulate the host's antiviral immune response (Seong R, et al 2020. Zika Virus-Induction of the Suppressor of Cytokine Signaling 1 / 3 Contributes to the Modulation of Viral Replication. Pathogens 9.). SOCS1 in fish such as Sebastes schlegelii ( Sebastes schlegeli ), Miichthys miiuy ( Miichthys miiuy ) also plays a negative regulatory role in antiviral immunity (Wang G, et al. 2022. Molecular characterization and immunoregulatory analysis of suppressors of cytokine signaling 1 (SOCS1) in black rockfish, Sebastes schlegeli . Dev Comp Immunol. 130: 104355; Zhao X, et al. 2018. Characterization and role of suppressor of cytokine signaling 1a (SOCS1a) in a teleost fish, Miichthys miiuy . Dev Comp Immunol. 78:124-131.). During the transcription process of eukaryotic genes, precise regulation occurs at multiple levels. Promoters and the cis-acting elements they contain directly affect gene transcription and expression. The large yellow croaker SOCS1 gene promoter sequence, activity and its application provide an important tool for studying the gene regulation mechanism and antiviral immune mechanism of the large yellow croaker SOCS1 gene. Summary of the Invention

[0003] The purpose of the present invention is to provide a large yellow croaker SOCS1 gene promoter and its application.

[0004] To achieve the above object, the present invention adopts the following technical solutions: A first aspect of the present invention provides a large yellow croaker SOCS1 Gene promoter, the large yellow croaker SOCS1 The nucleotide sequence of the gene promoter is shown in SEQ ID NO.1: 5'-ATCTGCGCCCCAAACATTAGTAATCTAAAGTAGAGCGATGCTTTACTAAATAAAGCTGCCATCTGTCATGTCTGTCTTTCCGTAAACGTCTCGCAGTCACGTGGTTTTGCGGTTTACTTGAAATCCTCCTCTTGAAAACGTACGGCTGCGTTTAGTTTCACTTTCGTTTGGTGTTTATAAGAAATTCGGTGACTGCACTTGAACTCAGCCTCGCTGCTCTTCCAGGAAGCGGATCGCTATATAAACGGAGAGTCTGTGTGTTCACGCA-3'; wherein, the 155-166 bp are the interferon stimulated response element (ISRE) motif, and the 268 bp are the large yellow croaker. SOCS2 The transcription start site of a gene promoter.

[0005] The second aspect of the present invention provides a kind of large yellow croaker containing the above SOCS1 Recombinant vector of gene promoter; Furthermore, the recombinant vector is composed of large yellow croaker SOCS1 The gene promoter and pGL3.0 vector were recombined.

[0006] The third aspect of the present invention provides a recombinant cell containing the above-mentioned recombinant vector; Furthermore, the recombinant cell is a recombinant carp epithelioma cell.

[0007] A fourth aspect of the present invention provides the above-mentioned large yellow croaker SOCS1 The application of gene promoters, recombinant vectors and recombinant cells in initiating the expression of target genes.

[0008] A fifth aspect of the present invention provides the above-mentioned large yellow croaker SOCS1 The application of gene promoters, recombinant vectors and recombinant cells in the study of fish gene regulation mechanisms.

[0009] A sixth aspect of the present invention provides the above-mentioned large yellow croaker SOCS1 Application of gene promoters, recombinant vectors and recombinant cells in the study of fish antiviral immune mechanisms.

[0010] A seventh aspect of the present invention provides the above-mentioned large yellow croakerSOCS1 The application of gene promoters, recombinant vectors and recombinant cells in transgenic breeding of fish.

[0011] The significant advantages of the present invention are: The invention takes the lead in providing a large yellow croaker SOCS1 The gene promoter was constructed into the pGL3.0 vector to obtain a recombinant vector, which was transfected into EPC cells to initiate the transcription of the reporter gene. It had a high basal activity, and the activity of the mutant promoter was significantly lower than that of the wild type. Under the stimulation of the virus analog poly(I:C), large yellow croaker SOCS1 The activity of the gene promoter is further improved, while the activity of the mutant vector is reduced. The above results show that the large yellow croaker provided by the present invention SOCS1 Gene promoter sequence and large yellow croaker containing the same SOCS1 The recombinant vector of gene promoter can be used for the study of gene regulation mechanism and antiviral immunity mechanism of large yellow croaker. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 : Large yellow croaker SOCS1 Basal activity of gene promoters.

[0013] Figure 2 : Large yellow croaker SOCS1 Activity of gene promoter mutants.

[0014] Figure 3 :Pseudosciaena crocea stimulated by poly(I:C) SOCS1 Changes in gene promoter activity. DETAILED DESCRIPTION

[0015] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0016] The methods used in the following implementations are conventional methods unless otherwise specified, and the materials used are commercially available unless otherwise specified. The carp epithelioma cells (EPC) involved in the following implementations were purchased from the China Center for Type Culture Collection, with the new number of the CCTCC library: GDC0174. The homologous recombination kit (C112-01) involved in the following implementations was purchased from Novazonics. The pGL3.0 vector involved in the following implementations was purchased from Promega. The fishtrans transfection reagent involved in the following implementations was purchased from Mesent. The pRL-TK vector involved in the following implementations was purchased from Promega. The dual luciferase assay kit involved in the following implementations was purchased from Promega.

[0017] Embodiment 1: Using large yellow croaker genomic DNA as a template, SOCS1 The gene promoter was amplified by PCR to obtain the nucleotide sequence shown in SEQ ID NO.1; the large yellow croaker was cloned by homologous recombination kit. SOCS1 The gene promoter was inserted into the pGL3.0 vector Kpn I and Hind III The expression of downstream luciferase reporter gene was initiated between the restriction sites to obtain the recombinant vector pGL3.0-SOCS1. SOCS1 The gene promoter mutant was amplified by PCR to obtain its nucleotide sequence as shown in SEQ ID NO.2; the large yellow croaker was cloned using a homologous recombination kit SOCS1 The gene promoter mutant was inserted into the pGL3.0 vector Kpn I and Hind III The restriction sites were separated to initiate the expression of the downstream luciferase reporter gene, and the recombinant vector pGL3.0-SOCS1-MUT was obtained.

[0018] Embodiment 2: EPC cells were cultured at 2×10 5 Each well was inoculated into a 24-well plate, and 0.5 mL of M199 complete medium containing 10 vol% fetal bovine serum and 1 vol% penicillin / streptomycin double antibody solution (the concentration of penicillin in the penicillin / streptomycin double antibody solution was 100 U / mL, and the concentration of streptomycin was 0.1 mg / mL) was added, and cultured in an incubator at 28°C and 5% carbon dioxide; when the cells grew to 60%-80%, 200 ng of pGL3.0 vector, pGL3.0-SOCS1 recombinant vector or pGL3.0-SOCS1-MUT recombinant vector and 20 ng of pRL-TK vector were co-transfected into EPC cells using fishtrans transfection reagent; 48 h after transfection, the cells were collected and large yellow croaker was detected using a dual luciferase detection kit SOCS1 Pseudosciaena crocea SOCS1 Activity of gene promoter mutants.

[0019] The results are as follows Figure 1 and Figure 2 As shown in the figure, the luciferase activity of EPC cells transfected with the pGL3.0-SOCS1 recombinant vector was significantly higher than that of EPC cells transfected with the pGL3.0 vector. However, the luciferase activity of EPC cells transfected with the pGL3.0-SOCS1-MUT recombinant vector was lower than that of EPC cells transfected with the pGL3.0-SOCS1 recombinant vector, indicating that large yellow croaker SOCS1The gene promoter has basic activity and can initiate the transcription of downstream genes. The transcription factor binding site ISRE is important for large yellow croaker. SOCS1 The activity of gene promoters is crucial.

[0020] Embodiment 3: EPC cells were cultured at 2×10 5 Each well was inoculated into a 24-well plate, and 0.5 mL of M199 complete medium containing 10 vol% fetal bovine serum and 1 vol% penicillin / streptomycin double antibody solution (the concentration of penicillin in the penicillin / streptomycin double antibody solution was 100 U / mL, and the concentration of streptomycin was 0.1 mg / mL) was added, and cultured in an incubator at 28°C and 5% carbon dioxide; when the cells grew to 60%-80%, 200 ng of pGL3.0 vector, pGL3.0-SOCS1 recombinant vector or pGL3.0-SOCS1-MUT recombinant vector and 20 ng of pRL-TK vector were co-transfected into EPC cells using fishtrans transfection reagent; 24 hours after transfection, 10 μg / mL of poly(I:C) (InvivoGen) was added to stimulate the cells, and the cells were collected after 24 hours, and large yellow croaker was detected using a dual luciferase detection kit SOCS1 Pseudosciaena crocea SOCS1 Changes in gene promoter activity of mutants.

[0021] The results are as follows Figure 3 As shown in the figure, after poly(I:C) stimulation, the luciferase activity of EPC cells transfected with the pGL3.0-SOCS1 recombinant vector was further increased, while the luciferase activity of EPC cells transfected with the pGL3.0-SOCS1-MUT recombinant vector did not change significantly. These results indicate that large yellow croaker SOCS1 Gene promoters can respond to exogenous stimuli and can be used to study the gene regulation mechanism and antiviral immune mechanism of large yellow croaker.

[0022] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A large yellow croaker SOCS1 A gene promoter, characterized in that: The large yellow croaker SOCS1 The nucleotide sequence of the gene promoter is shown in SEQ ID NO.

1.

2. A kind of large yellow croaker containing the large yellow croaker according to claim 1 SOCS1 Recombinant vector of gene promoter.

3. The recombinant vector according to claim 2, characterized in that: The recombinant vector is croaker SOCS1 The gene promoter and pGL3.0 vector were recombined.

4. A recombinant cell containing the recombinant vector according to claim 2.

5. The recombinant cell according to claim 4, characterized in that: The recombinant cell is a recombinant carp epithelioma cell.

6. The large yellow croaker according to claim 1 SOCS1 Use of a gene promoter, the recombinant vector according to claim 2, and the recombinant cell according to claim 4 in initiating expression of a target gene.

7. The large yellow croaker according to claim 1 SOCS1 Application of the gene promoter, the recombinant vector described in claim 2, and the recombinant cell described in claim 4 in the study of fish gene regulation mechanism.

8. The large yellow croaker according to claim 1 SOCS1 Application of the gene promoter, the recombinant vector described in claim 2, and the recombinant cell described in claim 4 in the study of antiviral immune mechanism of fish.

9. The large yellow croaker according to claim 1 SOCS1 Use of the gene promoter, the recombinant vector according to claim 2, and the recombinant cell according to claim 4 in transgenic breeding of fish.

Images