Application of bs4c gene in resistance to bacterial wilt and constructed vector thereof

By constructing the Bs4C gene vector in plants and using the ADC1 promoter to drive its expression, the environmental pollution and unstable efficacy problems of bacterial wilt control in existing technologies have been solved, achieving a highly efficient and green disease resistance effect.

CN119823997BActive Publication Date: 2025-11-28CHINA TOBACCO HUNAN IND CORP
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311319726.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-12
Publication Date
2025-11-28
Estimated Expiration
2043-10-12

AI Technical Summary

Technical Problem

Existing technologies for controlling bacterial wilt suffer from environmental pollution and drug resistance issues associated with chemical control, unstable efficacy of biological control, difficulties in implementing agricultural measures, and a lack of efficient and green control methods.

Method used

A vector was constructed using the Bs4C gene, and the Bs4C gene was transferred into plants using Agrobacterium-mediated transformation. The expression of the Bs4C gene was driven by the ADC1 gene promoter, and the recombinant vector ADC1p_Bs4C was constructed to achieve resistance to bacterial wilt.

Benefits of technology

It significantly improved the plant's resistance to bacterial wilt, especially showing good disease resistance in tobacco, without affecting the plant's normal growth and expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119823997B_ABST
    Figure CN119823997B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to application of Bs4C gene in resistance to bacterial wilt and a vector constructed by the Bs4C gene. The application discloses, for the first time, a new application of a disease-resistant protein-encoding gene Bs4C gene in resistance to bacterial wilt. A recombinant vector with ADC1 promoter and Bs4C gene in series expression is constructed, and genetic transformation is carried out in tobacco. In the tobacco plants transformed by the recombinant vector, the Bs4C gene is induced to express by inoculation of a bacterial wilt pathogen Ralstonia solanacearum. After inoculation of bacterial wilt, the tobacco plants with the Bs4C gene induced to express show strong resistance to bacterial wilt compared with a control. Under normal growth conditions, the tobacco plants are not induced to express the Bs4C gene, and there is no obvious difference in growth between the tobacco plants and wild type plants. In conclusion, the Bs4C gene plays an important positive regulation role in the regulation process of tobacco resistance to bacterial wilt, and the bacterial wilt induction expression system constructed by the ADC1 promoter and the Bs4C gene can be applied to gene function research and genetic engineering breeding of tobacco resistance to bacterial wilt.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to application of a Bs4C gene in resistance to bacterial wilt and a vector constructed by the Bs4C gene. BACKGROUND

[0002] Ralstonia solanacearum is a kind of devastating plant pathogenic bacteria, which can infect more than 400 plants of more than 50 families, causing bacterial wilt. The bacterial wilt is particularly serious on important solanaceous crops such as pepper, tomato, potato and eggplant, and has caused serious impact on agricultural production. According to its academic and economic importance, Ralstonia solanacearum is considered to be the second largest plant pathogenic bacteria in the world. Ralstonia solanacearum can survive in soil for many years and is difficult to eradicate. Once the plant is infected with bacterial wilt, the disease will rapidly develop and die with the conditions of high temperature and high humidity. So far, the prevention and control of bacterial wilt is mainly from three aspects of biology, chemistry and agricultural measures. Biological control mainly separates microorganisms with inhibitory effect on Ralstonia solanacearum from the original soil of the pathogen to make microbial organic fertilizer or microbial inoculant. Chemical control mainly uses fumigant to treat soil to prevent and control tobacco bacterial wilt. Agricultural measures include selection of disease-resistant varieties, seedbed disinfection, reasonable crop rotation, early planting, attention to field hygiene and strengthening of field management. Among them, chemical control is an important technical measure for preventing and controlling bacterial wilt, which has the characteristics of rapidness, effectiveness and convenience compared with other control methods. However, chemical control will cause problems such as drug resistance, re-invasion and pesticide residue. In addition to killing harmful bacteria, it will also cause damage to beneficial microorganisms, animals and other plants; agricultural measures have a long prevention and control cycle, difficult operation and unsatisfactory control effect; biological control is affected by environmental conditions and crops, has poor environmental adaptability, decreased colonization ability, immature technology and unstable control effect. Therefore, there are still many problems in the current prevention and control methods of bacterial wilt. Due to the complexity of root infection and vascular colonization, the field control of bacterial wilt is extremely challenging. In addition, Ralstonia solanacearum has many types of variation and complex infection sources, and there is no effective control measure at present. From the perspective of sustainable development, it is an urgent problem for researchers to find an efficient and green method for preventing and controlling bacterial wilt.

[0003] Breeding of disease-resistant varieties is a highly efficient and sustainable prevention and control measure, which has the advantages of low investment and easy popularization, and can reduce the risk of disease at the source. It is one of the more economical, environmentally friendly and effective methods for the prevention and control of bacterial wilt. One way of disease-resistant breeding is to introduce known exogenous disease-resistant genes into disease-susceptible varieties with excellent comprehensive traits, so as to obtain disease-resistant varieties with excellent comprehensive traits. Bs4C gene is a disease-resistant protein derived from Solanaceae pepper, which can be activated by effector protein avrBs4 in Xanthomonas campestris pv. vesicatoria. avrBs4 can bind to the UPT-box on the promoter of Bs4C gene, leading to the transcriptional activation of Bs4C gene, thereby mediating resistance to Xanthomonas campestris (Strauss et al., PNAS, 2012, 109: 19480-19485). However, it is not clear whether Bs4C gene can mediate resistance to bacterial wilt, especially tobacco bacterial wilt. SUMMARY

[0004] The primary object of the present application is to provide the application of Bs4C gene in the resistance to bacterial wilt, wherein the sequence of Bs4C gene is shown as SEQ ID NO. 1. The present application first discovers the new application of Bs4C gene, a disease-resistant protein derived from Solanaceae pepper, in the resistance to bacterial wilt. In particular, the effect in the resistance to tobacco bacterial wilt is very outstanding.

[0005] Further, the Bs4C gene is constructed into a vector, and transformed into plants by Agrobacterium transformation to obtain bacterial wilt-resistant plants.

[0006] Further, the promoter induced by bacterial wilt is cloned upstream of the disease-resistant gene Bs4C to form a transgenic vector in which the promoter drives the expression of Bs4C gene.

[0007] The promoter induced by bacterial wilt is specifically induced by the activation of effector factors of bacterial wilt.

[0008] Further, the ADC1 gene promoter is cloned upstream of the disease-resistant gene Bs4C to form a recombinant vector ADC1p_Bs4C in which the ADC1 gene promoter drives the expression of Bs4C gene.

[0009] The sequence of the ADC1 gene promoter is shown as SEQ ID NO. 2.

[0010] The second aspect of the present application is to provide a vector induced by bacterial wilt, in which the promoter induced by bacterial wilt is cloned upstream of the disease-resistant gene Bs4C to form a recombinant vector in which the inducible promoter drives the expression of Bs4C gene.

[0011] The expression induced by the Ralstonia solanacearum is specifically induced by the activation of the effector of Ralstonia solanacearum.

[0012] Further, the ADC1 gene promoter is cloned to the upstream of the disease resistance gene Bs4C to form a recombinant vector ADC1p_Bs4C in which the Bs4C gene is expressed by the ADC1 gene promoter.

[0013] The gene sequence of the ADC1 gene promoter is shown in SEQ ID NO. 2.

[0014] The beneficial effects of the present application are:

[0015] (1) The present application first confirms that the Bs4C disease resistance gene significantly improves the disease resistance effect of the plant against Ralstonia solanacearum, especially in tobacco.

[0016] (2) The Bs4C gene inducible expression vector constructed in the present application can induce the expression of the Bs4C gene in the transformed tobacco under the specific induction of Ralstonia solanacearum; without the invasion of Ralstonia solanacearum, the gene will not be induced to express, thus avoiding excessive impact on the plant.

[0017] (3) The Bs4C inducible expression vector constructed in the present application will not affect the normal growth of the transgenic plant even if it is induced to express. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Design of the recombinant vector for the Bs4C gene induced by Ralstonia solanacearum;

[0019] Figure 2 PCR identification of the recombinant vector transformed tobacco strain;

[0020] Figure 3 Analysis of the gene expression of Bs4C in the tobacco recombinant vector transformed plants under the inoculation of Ralstonia solanacearum and the control condition;

[0021] Figure 4 Analysis of the resistance of the tobacco Bs4C gene inducible expression tobacco plants and the K326 wild type control to Ralstonia solanacearum;

[0022] Figure 5 Analysis of the biomass of the tobacco Bs4C gene inducible expression tobacco plants and the K326 wild type control;

[0023] Figure 6 Analysis of the leaf number of the tobacco Bs4C gene inducible expression tobacco plants and the K326 wild type control. DETAILED DESCRIPTION

[0024] The application will be further explained and described in connection with the following examples. Before introducing the specific examples, the basic information of the biological materials, experimental reagents, experimental instruments and the like involved in the following examples is briefly introduced as follows.

[0025] Biological materials:

[0026] Tobacco material, Nicotiana tabacum variety K326, purchased from Yuxi Zhuyan Seed Co., Ltd.

[0027] The vector plasmid used for the recombinant gene: pPZP211 was purchased from Shanghai Zeye Biological Technology Co., Ltd.

[0028] Gene sequencing, gene fragment and primer synthesis were completed by Huada Company.

[0029] Experimental reagents:

[0030] The reagents and kits used in the experimental process are as follows:

[0031] Restriction endonuclease, dNTP, PrimerSTAR GXL DNA polymerase, DNA gel recovery kit MiniBEST Agarose Gel DNA Extraction Kit, plasmid DNA small amount purification kit MiniBEST Plasmid purification Kit, RNA extraction TRIZOL reagent were purchased from Invitrogen Company; Reverse transcription kit was purchased from Roche Company; DNAase enzyme was purchased from Fermentas Company; Kanamycin, rifampicin and other antibiotics were purchased from Shanghai Shengong Biological Engineering Co., Ltd.

[0032] Example 1

[0033] This example mainly briefly introduces and describes the process of obtaining the tobacco transformation line of the recombinant expression vector of ADC1p_Bs4C as follows.

[0034] 1. Design of recombinant expression vector of Bs4C gene started by ADC1 promoter

[0035] ADC1(Arginine Decarboxylase 1) gene is a conserved gene in plants. Previous studies have shown that the expression of this gene is induced by the transcriptional activator-like effector protein in P. solanacearum (Wu et al., Cell Host & Microbe, 2019, 26: 638-649). Based on this, the tomato ADC1 gene promoter was cloned upstream of the disease resistance gene Bs4C (SEQ ID NO. 1) to form a recombinant expression vector ADC1p_Bs4C (SEQ ID NO. 3) driven by the tomato ADC1 gene promoter (sequence see SEQ ID NO. 2) to express the Bs4C gene. Figure 1 ).

[0036] 2. Obtaining and identification of tobacco plants transformed by ADC1p_Bs4C recombinant expression vector

[0037] The C-terminal 3*FLAG-tagged ADC1p_Bs4C full-length DNA sequence was artificially synthesized by Huada Gene, and then the primer ADC1p-F: ATGACCATGATTACGAATTCGTGATTATCTTTTGATTAAG and 3*FLAG-R: GATCCCCGGGTACCGAGCTCAGTGACTCCGTCTCTTCA were used to amplify ADC1p_Bs4C_3*FLAG full-length. The reaction system was as follows: 2*Phanta Max Buffer 12.5 μl; ADC1p-F 0.5 μl; 3*FLAG-R 0.5 μl; Plasmid DNA 1 μl; dNTP mix (10 mM each) 0.5 μl; Phanta Max DNA Polymerase 0.5 μl; ddH2O up to 25 μl.

[0038] The above reaction solution was mixed uniformly and placed in a PCR instrument, and the reaction was carried out as follows: Step 1: 95℃, 5min; Step 2: 95℃, 15s; Step 3: 58℃, 15s; Step 4: 72℃, 1min 30s; go to Step 2 for 35 cycles; Step 5: 72℃, 10min; Step 6: 12℃, 5min.

[0039] After the reaction, the PCR product was detected by agarose gel electrophoresis, and the PCR product was recovered using an agarose gel recovery kit. Meanwhile, the vector pPZP211 was double-digested with EcoRI and KpnI, and then detected by agarose gel electrophoresis and recovered. The recovered PCR product and the vector were subjected to homologous recombination, and the E. coli Top10 competent cells were transformed, coated on LB plates containing kanamycin (100 μg / ml) resistance, and cultured in a 37°C incubator overnight. The next day, single colonies were picked for positive PCR detection, and the correct colonies were expanded in liquid LB medium for plasmid extraction and sequencing verification.

[0040] The positive plasmid pPZP211::ADC1p_Bs4C_3*FLAG was transformed into Agrobacterium LBA4404 strain, and the transformation method was as follows: Agrobacterium competent cells stored at -80°C were taken out at room temperature or hand for a moment to partially melt, and were inserted into ice when they were in an ice water mixed state; 0.01-1 μg of plasmid DNA was added to 100 μl of competent cells, and the tube bottom was mixed by hand; it was sequentially placed on ice for 5 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes; 700 μl of YEB liquid medium without antibiotics was added, and the culture was incubated at 28°C for 2-3 hours; the bacteria were centrifuged at 6000 rpm for 1 minute, and about 100 μl of supernatant was taken to resuspend the bacterial clumps by blowing gently and coated on YEB plates containing kanamycin (100 μg / ml) and rifampicin (25 μg / ml) resistance, and placed in a 28°C incubator for 2-3 days; single colonies were picked for colony PCR identification, and the correct colonies were picked in liquid YEB medium and incubated at 28°C on a shaker overnight, and the bacterial liquid was added to an equal proportion of 60% glycerol and stored at -80°C.

[0041] Stable genetic transformation of tobacco was performed using preserved Agrobacterium LBA4404 containing plasmid pPZP211::ADC1p_Bs4C_3*FLAG as follows. Agrobacterium liquid preserved at -80°C was activated on solid YEB medium containing kanamycin (100 μg / ml) and rifampicin (25 μg / ml) and incubated at 28°C for two days under inversion; activated Agrobacterium was picked into 50 mL of liquid YEB medium containing kanamycin (100 μg / ml) and rifampicin (25 μg / ml) and incubated at 28°C with shaking at 180 rpm until the OD600 was close to 0.6; the bacterial liquid was transferred into a 50 mL centrifuge tube previously sterilized and pre-cooled, centrifuged at 4000 rpm for 10 min, and the supernatant was discarded to collect the bacterial cells; the bacterial cells were resuspended in 20 mL of pre-cooled MS liquid medium, centrifuged again at 4000 rpm for 10 min, and the supernatant was discarded to collect the bacterial cells; the bacterial cells were resuspended in pre-cooled MS liquid medium to an OD600 close to 0.6, and then AS was added to a final concentration of 20 mg / L, ready for infection; the edges of the sterile leaves were cut off using scissors on a clean bench, and the leaves were cut into 1.0 x 1.0 cm leaf discs along the main veins and placed in the Agrobacterium infection liquid for infection for 5-6 min; co-culture: the infected leaf discs were removed, the Agrobacterium liquid was absorbed using sterile filter paper, and the leaf discs were placed on the co-culture medium with the leaf surface facing down and placed in an artificial climate chamber (temperature 26°C, humidity 40%) for dark culture for 3 days; S1 subculture: the leaf discs after co-culture for 3 days were transferred to the S1 differentiation medium with the leaf surface facing up. If the explants had a large number of Agrobacterium, they were washed with sterile water, dried using sterile filter paper, and then transferred to the S1 medium. 5-8 leaf discs were placed in each dish, and cultured in the dark in an artificial climate chamber for about 1 week, and then cultured under light until the leaf disc edges grew into a cluster of buds, and the buds grew to about 0.5 cm long; S2 subculture: the cluster of buds grown on the S1 medium were transferred to the S2 differentiation medium using tweezers. The cluster of buds was directly inoculated if it could be picked, or the cluster of buds was inoculated together with the leaf, and the part of the leaf without the cluster of buds was removed. The culture was cultured under light for 1-2 weeks until the cluster of buds grew into seedlings; S3 subculture: the seedlings on the S2 medium were transferred to the S3 differentiation medium and cultured under light for 1-2 weeks. The seedlings grew more robustly in this process; rooting culture: the robust seedlings on the S3 medium were removed from the bottom of the swollen part and the lower yellow leaves, and then inoculated into a tissue culture bottle containing rooting culture medium R and cultured under light for 2 weeks to make the seedlings root as soon as possible; obtaining transformed tobacco: when the seedlings had 3-10 roots and the root length was about 2-3 cm, the lid of the culture bottle was opened to acclimate the seedlings. After about 3 days, the seedlings were transplanted into a sterile soil-containing nutrient pot and covered with plastic film for moisture retention. After about a week, the plastic film was removed according to the growth status of the seedlings to allow them to grow rapidly under natural conditions, and the T0 generation of transformed tobacco was obtained.The T0 generation tobacco is harvested and sown as T1 generation plants. After collecting the T1 generation transformed tobacco seeds, they are sown in soil. When the plants grow to about four weeks, the DNA of the transformed tobacco leaves is extracted, and PCR identification is performed. The primers for PCR identification are pPZP211-F: GCGGATAACAATTTCACACA and pPZP211-R: CGTTGTCGAAACCGATGATA.

[0042] The above transformation tissue culture method and process are referred to the literature (Li et al., Frontiers in Plant Science, 2022, 13:817106)

[0043] Results and analysis: A total of 7 ADC1p_Bs4C transformed lines were detected, and it was found that line No. 3 showed obvious positive PCR bands, while the wild type and the other 5 lines did not show bands Figure 2 ), and line No. 3 transformed line was used as the experimental object for subsequent research.

[0044] Example 2

[0045] This example mainly introduces the gene expression pattern of Bs4C of the tobacco transformed line of the ADC1p_Bs4C recombinant expression vector in Example 1, which is described as follows.

[0046] The No. 3 transformed line of the recombinant vector pPZP211::ADC1p_Bs4C was sown in soil, and when it grew to four weeks, P. solanacearum was inoculated into the tobacco leaves by injection. The specific method of inoculation was as follows: OD 600 = 0.1 of P. solanacearum CQPS-1 suspension was injected into the left half of the tobacco leaf as the experimental group, and ddH2O was injected into the right half of the leaf at the same position as the control group. Each group had three plants, and each plant had two pieces of suitable size leaves injected. The injected tobacco was placed in a growth chamber at 28°C under long day conditions. After 24 hours, the leaf tissues injected with ddH2O or P. solanacearum were removed, frozen in liquid nitrogen, and RNA was extracted. cDNA was synthesized by reverse transcription, and the expression of Bs4C was detected using the Bs4C gene-specific quantitative primers qBs4C-F: TGGATTGGCAATACATGGGC and qBs4C-R: CGAGCAGGCGATTTGTTTGA.

[0047] Results and analysis: The control group had very little expression of the Bs4C gene when injected with ddH2O (Mock), and the expression of the Bs4C gene significantly increased Figure 3 ) 24 hours after injection of P. solanacearum CQPS-1 in the experimental group, indicating that the expression of the Bs4C gene in the ADC1p_Bs4C transformed tobacco plants depends on the infection of P. solanacearum, which is consistent with the experimental expectation.

[0048] Example 3

[0049] This example mainly introduces and illustrates the Ralstonia solanacearum resistance identification and comprehensive traits of the tobacco transformation lines of the ADC1p_Bs4C recombinant expression vector in Example 1 as follows.

[0050] The positive ADC1p_Bs4C transformation lines and wild-type tobacco were sowed in soil, and when they grew to 18 days, Ralstonia solanacearum CQPS-1 was inoculated by root irrigation. The specific inoculation method was as follows: the OD600 of the Ralstonia solanacearum suspension was adjusted to 0.2, 15 mL of the Ralstonia solanacearum suspension was irrigated to the root of each tobacco, and the inoculated tobacco was placed in a 28°C greenhouse. The disease incidence of the tobacco was observed every day, and the disease phenotype was recorded by taking photos on the 12th day. The positive ADC1p_Bs4C transformation lines were the experimental group, and the wild-type tobacco was the control group. There were 16 tobaccos in each group. 600

[0051] Results and analysis: on the 14th day after inoculation, almost all the tobaccos in the control group were diseased and wilted, while the Bs4C transformation lines in the experimental group showed obvious resistance to Ralstonia solanacearum, and only a few plants showed wilting and other disease characteristics. Figure 4 Therefore, the ADC1p_Bs4C transformed tobacco can significantly improve the resistance of tobacco to Ralstonia solanacearum.

[0052] Example 4

[0053] This example mainly introduces and illustrates the growth of the tobacco transformation lines of the ADC1p_Bs4C recombinant expression vector in Example 1 as follows.

[0054] The recombinant vector ADC1p_Bs4C transformed tobacco and wild-type tobacco were sowed in soil, and when they grew to four weeks, the growth vigor of the tobacco was observed, and the fresh weight of a single plant was measured. The recombinant vector transformed tobacco was the experimental group, and the wild-type tobacco was the control group. There were 10 seedlings in each group as experimental repeats.

[0055] Results and analysis: the growth vigor of the positive lines of the ADC1p_Bs4C recombinant vector transformed tobacco and the wild-type tobacco was basically the same. Statistical analysis of the fresh weight of a single plant and the number of leaves found that there was no significant difference between the recombinant vector transformed tobacco and the wild-type tobacco. Figure 5 Figure 6 Therefore, it does not affect the normal growth of tobacco.

[0056] Sequence Listing

[0057] SEQ ID NO: 1

[0058] (Bs4C_CDS)

[0059] ​​ATGGAGTTTGATCTCAGATACTTGATCTTGATTTTGGCTAACATGCTCAAATCAATATTATCCATTTCTGATAACTGGGATCCTTTCCATATATTTCATGACCATCCCAGTTTCATCGTCTTCATCAATAAGCTCTTCTTTCTTTTCATATTTTCCTTTATTTTCTCCATCACTCGTATAACACTTCATCATCCAAATATACGAATACGTGTACGTACTACTACTTCAGCAGATCTCTCCAAGTCCTTTAATATCTTGTGTCTAGCTTCTCTTCTACTCCCACAAATGTTGTTCTGGTACTTTTTCGTCATTATCATTGCACTTTCCTCATGTTCTTCTTGGATTGGCAATACATGGGCTAGTTTTCGACAACGGATTCTGCATATTTTCTCAACAATAATATTTCCAGCAGTCAGCATTTTCATCAATGTGGAGTTTGACAGAAATAATGTGAGCCAGCAACATGAAACTCAAACAAATCGCCTGCTCGTC

[0060] SEQ ID NO. 1

[0061] (ADC1_Pmt)

[0062] GTGATTATCTTTTGATTAAGTTCTTTTTTTGCTTCTTTTGAGGGGGTAGCCGGGGCTCTGGCCTCGGCGGGTTCTAAAGCCCCCAGCTATTACAACATTGGTCAACAAATCATTTCTGTATAATTAGTTTTACACATTCTTTGATTCTTTTTTTTTTGTGAAGATTTTACGAG.

Claims

1. Bs4C Application of the gene in the resistance to tobacco bacterial wilt, the gene sequence is shown as SEQ ID NO.

1. Bs4C Application of the gene in the resistance to tobacco bacterial wilt, the gene sequence is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The Bs4C The recombinant vector is prepared by constructing the gene into the vector, and the recombinant vector is transformed into tobacco by using an agrobacterium transformation method to obtain a plant resistant to bacterial wilt.

3. Use according to claim 2, characterized in that, Will ADC1 Gene promoter cloned into disease resistance gene Bs4C The upstream, constituting a ADC1 Gene promoter drive Bs4C The recombinant expression vector ADC1p_Bs4C for gene expression; ADC1 The nucleic acid sequence of the promoter is shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • Application of R2 gene in improving bacterial wilt resistance of plants

    CN115851752A

  • XA1-mediated resistance to tale-containing bacteria

    US20180127770A1