Gene for improving salt tolerance of pyridine-degrading bacteria and its application

Abstract

The present invention relates to a gene for improving the salt tolerance of pyridine-degrading bacteria and its application, which solves the technical problem that the degradation efficiency of existing strains is limited by salinity. The nucleotide sequence of the salt-tolerant gene is shown as SEQ ID NO.1. The present invention also provides a protein, a recombinant plasmid and a host cell containing the gene. The present invention can be widely applied to the degradation of high-salt pyridine wastewater.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a gene for improving the salt tolerance of pyridine-degrading bacteria and its application. Background Art

[0002] Microbial salt-tolerance genes refer to genes that enable microorganisms to maintain normal physiological functions in a high-salt environment. These genes help microorganisms adapt to high-salt stress through a variety of mechanisms, including regulating intracellular ion balance, accumulating compatible solutes, and enhancing membrane stability. The study of salt-tolerance genes not only helps to reveal the adaptation mechanism of microorganisms, but also has important application value in agriculture, environmental remediation, and biotechnology. The expression and stability of salt-tolerance genes under different environmental conditions need further study to ensure their reliability and effectiveness in practical applications. At the same time, the construction of salt-tolerant genetically engineered bacteria faces many technical limitations, and it is necessary to comprehensively consider multiple factors such as gene selection, expression regulation, host bacteria selection, and environmental adaptability to achieve efficient and stable salt tolerance. Salt tolerance is usually a complex trait controlled by multiple genes. The modification of a single gene is often difficult to significantly improve salt tolerance and may not be able to completely overcome salt stress.

[0003] Currently, the screening of salt-tolerant strains mostly relies on natural isolation, but their degradation efficiency is still limited by salinity. Summary of the invention

[0004] In order to solve the technical problem that the degradation efficiency of existing strains is limited by salinity, the present invention provides a gene and application capable of improving the pyridine degradation efficiency and salt tolerance of the strain.

[0005] To this end, the present invention provides a salt-tolerant gene hj102, whose nucleotide sequence is shown in SEQ ID NO.1.

[0006] The present invention also provides a protein encoded by the salt-tolerant gene hj102, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0007] The invention also provides a recombinant plasmid, which contains the gene sequence of the salt-tolerant gene hj102.

[0008] The present invention also provides a host cell, wherein the host cell contains the recombinant plasmid, and the recombinant plasmid contains the gene sequence of the salt-tolerant gene hj102.

[0009] The present invention also provides the use of the salt-tolerant gene, the protein, the recombinant plasmid or the host cell in improving the salt tolerance of microorganisms.

[0010] Preferably, the host cell includes Escherichia coli and Rhodococcus, and also includes applications in enhancing the salt tolerance of other microorganisms as host cells.

[0011] Preferably, the host is Rhodococcus, and the salt tolerance and degradation ability are enhanced by expressing the salt tolerance gene hj102 described in claim 1.

[0012] Advantages of the present invention:

[0013] 1. The salt tolerance gene provided by the invention can be used to transform the salt stress tolerance of microorganisms, providing a new idea and strategy for improving the salt stress tolerance of microorganisms and enriching the salt tolerance gene pool;

[0014] 2. The present invention applies the salt tolerance gene to the pyridine-degrading bacterium Rhodococcussp. PD04, enhancing the growth and pyridine degradation ability of the strain under high-salt conditions. Description of the drawings

[0015] Figure 1 Shows the effect of the salt tolerance gene hj102 on the growth of Escherichia coli BW25113 under 35 g / L NaCl salt stress;

[0016] Figure 2 Shows the effect of the salt tolerance gene hj102 on Rhodococcus the growth and pyridine degradation of sp. PD04 under 40 g / L NaCl salt stress. Detailed implementation manners

[0017] To make the above objects, features, and advantages of the present invention more obvious and understandable, the following detailed description of the specific implementation manners of the present invention is made in conjunction with the embodiments of the specification.

[0018] Some of the reagents and culture medium preparations used in the present invention are as follows:

[0019] LB medium (g / L): yeast powder 5.0, tryptone 10.0, NaCl 10.0. When preparing a solid medium, 2% agar powder is added to the above formula.

[0020] M9 medium (g / L): glucose 4.0, Na2HPO4·12H2O 17.09, KH2PO4 3.0, NH4Cl 1.0, NaCl 0.5, MgSO4·7H2O 0.492, CaCl2 0.01.

[0021] MSM medium (g / L): K2HPO4·3H2O 0.3, NaH2PO4·2H2O 0.2, MnSO4·4H2O 0.01, MgSO4·7H2O 0.05, FeSO4·7H2O 0.01. Add solid NaCl as needed to prepare media with different salinities.

[0022] Example 1: Mining of salt-tolerant genes

[0023] The salt-tolerant gene hj102 is derived from the granular sludge metagenome. The granular sludge metagenome data has been submitted to the NMDC database with the accession number NMDC40061105 and the publication date of October 18, 2024.

[0024] The specific process for obtaining the salt-tolerant gene hj102 is as follows: Using the publicly reported salt-tolerant gene sequences as query sequences, the Blastx alignment tool was used to conduct in-depth alignment analysis on the granular sludge metagenome data, screening out a series of potential salt-tolerant elements, and finally constructing a potential salt-tolerant element library. Through Blastx / Blastp alignment and its conservation analysis in the NCBI database, no functional association between gene hj102 and salt tolerance was found. Further, the hj102 gene was cloned from the granular sludge metagenome, and its salt-tolerant function was verified through molecular biology experiments.

[0025] Example 2: Construction of an Escherichia coli recombinant expression vector

[0026] To construct a recombinant expression vector for the heterologous expression of hj102 in Escherichia coli, referring to the coding sequence of the target gene provided in SEQ ID NO.1, primers F1 / R1 were designed to amplify the full-length coding sequence of hj102, and at the same time, primers F2 / R2 were used to perform PCR amplification on the pFsBADG plasmid vector to linearize it (the underlined parts in the primers are homologous arms). The amplified target fragment and the linearized plasmid vector were purified and then fused using Gibson assembly technology, and transformed into Escherichia coli Top10 competent cells. After picking positive clones, sequencing was performed to obtain the correct recombinant expression vector pFsBADG-hj102.

[0027] F1 (SEQ ID NO.3): gctaacaggaggaattaaccATG GCAGCTGCTGGCTTCTTGG

[0028] R1 (SEQ ID NO.4): ctgcgttctgatttaatctgTTAATTTTCACCATTGGTTTCACCAAGCG

[0029] F2 (SEQ ID NO.5): TAACAGATTAAATCAGAACGCAGAAGCGG

[0030] R2 (SEQ ID NO.6): CATggttaattcctcctgttagc aaagttaaac

[0031] Example 3 Heterologous Expression and Functional Verification of Salt-Tolerant Genes in Escherichia coli

[0032] The correctly sequenced recombinant expression vector pFsBADG-hj102 and the empty plasmid vector pFSBADG were respectively transformed into Escherichia coli BW25113 (this strain is a commonly used strain and can be purchased from the open market) to obtain recombinant bacteria E. coli BW25113 / pFsBADG-hj102 and the control strain E. coli BW25113 / pFsBADG.

[0033] Single colonies with good growth were picked and inoculated into a test tube containing 5 mL of LB liquid medium (Gm R , 50 μg / mL), and cultured overnight at 37°C and 200 rpm. The next day, the seed culture was transferred to a 250 mL shake flask containing 50 mL of fresh LB liquid medium (Gm R , 50 μg / mL) at an inoculation amount of 1%. When the cell concentration OD 600 reached 0.6 - 0.8, an arabinose solution with a final concentration of 0.2% was added, and induced expression was carried out at 25°C and 200 rpm for 15 h.

[0034] The bacterial solution was centrifuged at 5000 rpm and 4°C for 5 min to collect the bacteria. After washing the bacteria twice with 0.9% NaCl solution, the bacteria were resuspended with an appropriate amount of 0.9% NaCl solution to make the cell concentration OD 600 = 10. The concentrated bacterial solution was transferred to a 100 mL shake flask containing 25 mL of M9 medium (Gm R , 50 μg / mL, 35 g / L NaCl) at an inoculation amount of 4%. At the same time, an arabinose solution with a final concentration of 0.2% was added, and cultured at 37°C and 200 rpm. OD 600 was measured every 4 h and the growth curve was recorded. The results are as Figure 1 shown.

[0035] It can be seen that Escherichia coli BW25113 heterologously expressing the hj102 gene showed stronger growth ability under the same concentration of salt stress. Its growth lag period was shortened from the original 12 h to 4 h, and the maximum growth OD 600 could reach 3.59 (20 h), which was higher than the maximum OD 6000.91 (36 h) was increased by 2.95 times. These results indicate that the hj102 gene is an effective salt-tolerant gene.

[0036] Example 4 Construction of the Rhodococcus recombinant expression vector

[0037] To construct a recombinant expression vector for the heterologous expression of hj102 in Rhodococcus pyridinivorans, referring to the coding sequence of the target gene provided in SEQ ID NO.1, primers F3 / R3 were designed to amplify the full-length coding sequence of hj102. At the same time, primers F4 / R4 were used to perform PCR amplification on the pNV18 plasmid vector to linearize it (the underlined parts in the primers are homologous arms). The amplified target fragment and the linearized plasmid vector were purified and then fused using Gibson assembly technology, and transformed into Escherichia coli Top10 competent cells. After picking positive clones, sequencing was performed to obtain the correct recombinant expression vector pNV18-hj102.

[0038] F3 (SEQ ID NO.7): GCTATGACCATGATTACATG GCAGCTGCTGGCTTCTTGG

[0039] R3 (SEQ ID NO.8): AAACGACGGCCAGTGCCTTA ATTTTCACCATTGGTTTCACCAAGCG

[0040] F4 (SEQ ID NO.9): TAAGGCACTGGCCGTCGTTT TACAAC

[0041] R4 (SEQ ID NO.10): CATGTAATCATGGTCATAGC TGTTTCCTGTGTG

[0042] Example 5 Role of the salt-tolerant gene in the high-salt degradation of pyridine by Rhodococcus

[0043] Using the pyridine-degrading bacterium Rhodococcus sp. PD04 as the host cell (Reference: Huo D, Hu Y, Li L, Gao H, Wang M, Guan H, Zhang Q, Yu B. (2024), Complete genome sequence of Rhodococcussp. strain PD04, a pyridine-degrading bacterium under hypersaline condition. Microbiol Resour Announc, 13:e00103-24. (The applicant guarantees to make the strain available to the public within 20 years from the filing date), and to explore the effect of the salt-tolerant gene hj102 on the growth and pyridine degradation of this strain under high-salt conditions.

[0044] Using the electrotransformation method, the correctly sequenced recombinant expression vector pNV18-hj102 and the empty plasmid vector pNV18 were respectively transformed into the pyridine-degrading bacterium Rhodococcus sp. PD04 to obtain the recombinant bacterium Rhodococcus sp. / pNV18-hj102 and the control strain Rhodococcus sp. / pNV18.

[0045] Single colonies with good growth were picked and inoculated into a test tube containing 5 mL of LB liquid medium, and cultured overnight at 30 °C and 200 rpm. The next day, the seed liquid was transferred to a 250 mL shake flask containing 50 mL of fresh LB liquid medium at an inoculation amount of 1% for further expansion culture. When the bacteria grew to the late logarithmic growth phase, the bacteria were collected by centrifugation at 5000 rpm for 10 min, washed three times with 0.9% NaCl solution, and a small amount of supernatant was retained for resuspending the bacteria to prepare the bacterial suspension.

[0046] An appropriate amount of the bacterial suspension was added to the MSM medium (40 g / L NaCl) respectively, the initial OD 600 was adjusted to 0.1, and pyridine with a final concentration of about 500 mg / L was added, and then cultured on a shaker at 30 °C and 200 rpm. Samples were taken at intervals of 24 h, and a control group without adding any strains was set.

[0047] As Figure 2 shown, compared with the control strain Rhodococcus sp. / pNV18, the recombinant strain Rhodococcus sp. / pNV18-hj102 heterologously expressing the salt-tolerant gene hj102 showed a faster growth rate and pyridine degradation rate in the medium with a salinity of 4%. It can be seen that the recombinant strain Rhodococcus sp. / pNV18-hj102 quickly entered the logarithmic growth phase after a 24 h lag phase and rapidly degraded pyridine. When the strain grew to OD 600The maximum value is 0.639. Meanwhile, the pyridine content decreases from the initial 491.7 mg / L to 3.0 mg / L finally, and the degradation rate is as high as 99.4%. These results highlight the important role played by the salt-tolerant gene in the high-salt degradation of pyridine by Rhodococcus, providing an effective solution for the efficient degradation of pyridine pollutants in high-salt environments.

[0048] The above description is only for the preferred embodiments of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the scope defined by the claims of the present invention shall fall within the protection scope of the present invention.

Claims

1. A salt-tolerance gene, characterized in that: The nucleotide sequence of the salt-tolerant gene is shown in SEQ ID NO.

1.

2. A protein encoded by the salt-tolerant gene according to claim 1, wherein the amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the salt-tolerance gene according to claim 1.

4. A host cell, characterized in that: The host cell contains the recombinant plasmid according to claim 3.

5. Use of the salt-tolerant gene according to claim 1, the protein according to claim 2, the recombinant plasmid according to claim 3, or the host cell according to claim 4 in improving the salt tolerance of microorganisms.

6. The use according to claim 5, characterized in that: The host cells include Escherichia coli and Rhodococcus, and also include the use of other microorganisms as host cells to enhance their salt tolerance.

7. The use according to claim 5 or 6, characterized in that: The host cell is Rhodococcus, and the salt tolerance and degradation capabilities are improved by expressing the salt tolerance gene described in claim 1.

Images