Application of ClpS1 gene in creating cyanobacteria strain with high temperature resistance

By overexpressing the ClpS1 gene in cyanobacteria, a heat-resistant strain was constructed, which solved the stability problem of cyanobacteria in photosynthesis under high temperature conditions and enabled cyanobacteria to grow rapidly and biosynthesize at high temperatures.

CN119824024BActive Publication Date: 2025-12-16BEIJING FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411433339.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-15
Publication Date
2025-12-16
Estimated Expiration
2044-10-15

AI Technical Summary

Technical Problem

There is currently no high-temperature stress-resistant photosynthetic cyanobacteria chassis. Under high-temperature conditions, the stability and redox balance of photosynthetic pigments and thylakoid membranes are disrupted during photosynthesis, causing cyanobacteria to lose their ability to synthesize downstream products.

Method used

By overexpressing the ClpS1 gene or its derivatives, including overexpression vectors and complementation vectors of the ClpS1 gene, and using the RbcL1A promoter to initiate the expression of the ClpS1 gene, a heat-resistant cyanobacterial strain was constructed. The ClpS1 adaptor protein or the ClpS1 gene was recombinantly expressed to enhance the growth ability of cyanobacteria under high-temperature stress.

Benefits of technology

Under high temperature conditions, cyanobacterial strains overexpressing the ClpS1 gene exhibited excellent growth characteristics, significantly improving their high temperature resistance and enhancing their application potential in biosynthetic chassis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119824024B_ABST
    Figure CN119824024B_ABST
Patent Text Reader

Abstract

The application provides application of a ClpS1 gene in creating a heat-resistant cyanobacterial strain, and belongs to the technical field of genetic engineering. The application identifies, for the first time, a core function of a ClpS1 adaptor protein in high-temperature stress resistance of Synechocystis, and finds that the ClpS1 adaptor protein, as a heat shock-induced protein, has a long-acting effect in delaying the process of cell resistance to high-temperature stress. A better engineered strain (ΔClpS1-OE) than a wild strain is obtained by constitutively overexpressing the ClpS1 protein in a ΔClpS1 mutant, so that a more excellent cyanobacterial engineered chassis cell is created for photosynthetic organism synthesis.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of a ClpS1 gene in creating a cyanobacterium heat-resistant strain. BACKGROUND

[0002] Cyanobacteria can directly use carbon dioxide, light energy and inorganic nutrients to synthesize various organic compounds, and are widely used in biological energy, health care and plant secondary metabolites and intermediate compounds, and thus have developed into an excellent photosynthetic biological synthesis chassis. Using single-cell cyanobacteria as a synthetic biology chassis has the traditional advantages of microbial cell factories, can be intensively and large-scale cultured in a bioreactor, does not compete with arable land, and is of great significance in ensuring food security in the face of global population growth; the growth cycle is short, gene transformation is simple and efficient, and a large number of synthetic biology molecular tools have been developed; as a single-cell organism, it can be developed into a green and sustainable cell factory by constructing a transmembrane transport system of the target product. As a photosynthetic autotrophic organism, cyanobacteria not only have the same normal metabolic pathways disturbed as heterotrophic microorganisms under high-temperature stress, but also have multiple parts of the cell that provide basic substances and energy metabolism processes, such as the stability of photosynthetic pigments and thylakoid membranes, enzymes and proteins involved in the process of photosynthesis, and the balance of the redox state in the cell, which are all destroyed under high-temperature stress, making it lose the ability to synthesize downstream products and the source of substrates. Currently, there is no report on the development of a high-temperature-resistant cyanobacterial chassis. SUMMARY

[0003] Therefore, the application aims to provide application of a ClpS1 gene in creating a cyanobacterium heat-resistant strain, so that cyanobacteria can exhibit stronger growth under high-temperature stress by overexpressing the ClpS1 gene.

[0004] The application provides application of a ClpS1 linker protein, a ClpS1 gene or a gene derivative product of the ClpS1 gene in creating a cyanobacterium heat-resistant strain.

[0005] Preferably, the gene derivative product of the ClpS1 gene includes an overexpression vector containing the ClpS1 gene, a complementation vector containing the ClpS1 gene or a gene expression cassette containing the ClpS1 gene.

[0006] Preferably, the nucleotide sequence of the ClpS1 gene in the overexpression vector containing the ClpS1 gene is shown in SEQ ID NO: 1.

[0007] Preferably, the ClpS1 gene in the overexpression vector containing the ClpS1 gene is expressed by using an RbcL1A promoter.

[0008] Preferably, the nucleotide sequence of the ClpS1 gene in the complementation vector containing the ClpS1 gene is shown as SEQ ID NO: 2.

[0009] Preferably, the cyanobacteria include wild-type cyanobacteria and / or cyanobacteria mutants lacking the ClpS1 gene.

[0010] Preferably, the suitable growth temperature of the cyanobacteria heat-resistant strain includes 28-44°C.

[0011] The present application provides a cyanobacteria heat-resistant strain, recombinantly expressing a ClpS1 adaptor protein or a ClpS1 gene or a gene-derived product containing the ClpS1 gene.

[0012] Preferably, the cyanobacteria engineering strain (OE) overexpressing the ClpS1 adaptor protein or the ClpS1 gene or the cyanobacteria ClpS1 gene deletion mutant (ΔClpS1-OE) containing the ClpS1 gene overexpression vector.

[0013] The present application provides the use of the cyanobacteria heat-resistant strain in preparing a biosynthetic chassis.

[0014] The application provides application of a ClpS1 linker protein, a ClpS1 gene or a genetic derivative product of the ClpS1 gene in creating a cyanobacteria heat-resistant strain. The application firstly studies the effects of two homologous genes ClpS1 and ClpS2 in a Clp protease degradation system on a high-temperature stress environment of cyanobacteria, determines the growth of mutant strains in normal environment and high-temperature stress environment by knocking out the ClpS1 and / or ClpS2 gene of cyanobacteria, and the results show that the ClpS2 protein is not critical for the high-temperature adaptation of Synechocystis, and the ClpS1 protein is a necessary cell component for the high-temperature stress adaptation of cyanobacteria. The application further proves by a Western-blot protein hybridization experiment that the ClpS1 protein is not expressed in normal environment, is induced and expressed in a high-temperature stress environment of cyanobacteria, and shows stress delay, so the ClpS1 protein is a heat-induced protein with stress delay and continuous accumulation. In order to further verify that the ClpS1 protein is the only key protein for the high-temperature stress resistance of cyanobacteria, the application finds that the expression of the back-supplemented ClpS1 gene makes the growth level of the cyanobacteria mutant strain with the ClpS1 gene deletion mutation be flat with the wild type in a high-temperature stress environment, and the growth of the ΔClpS1-OE engineering strain with the constitutive overexpression of the ClpS1 protein is obviously better than that of the wild type strain and the cyanobacteria strain with the expression of the ClpS1 gene by using an endogenous promoter. It can be seen that the application determines that the ClpS1 linker protein or the ClpS1 gene as a heat-induced protein has a core function for the high-temperature stress resistance of cyanobacteria, and the overexpression of the ClpS1 protein in the ΔClpS1 mutant strain by using a constitutive strong promoter can make the target strain (ΔClpS1-OE) obtain better high-temperature resistance than the wild type, so that the target strain has greater potential and advantages in engineering fermentation application. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 Results of the effects of the ClpS1 protein on the high-temperature stress adaptation of Synechocystis;

[0016] Figure 2 Western-blot protein hybridization detection results of the ClpS1 protein as a heat-induced protein;

[0017] Figure 3 Construction spectrum of the empty vector, the complementary vector and the overexpression vector involved in Example 3 of the application;

[0018] Figure 4 Detection results of the ClpS1 overexpression engineering strain (ΔClpS1-OE) under different growth conditions;

[0019] Figure 5The growth results of the wild type strain and the ΔClpS1-OE engineering strain under different growth conditions. DETAILED DESCRIPTION

[0020] The application provides application of a ClpS1 linker protein, a ClpS1 gene or a genetic derivative product of the ClpS1 gene in creating a heat-resistant cyanobacterial strain.

[0021] In the application, the ClpS1 linker protein is used to create a heat-resistant cyanobacterial strain, preferably by means of genetic engineering to express the ClpS1 gene or the genetic derivative product of the ClpS1 gene in cyanobacteria. The genetic derivative product of the ClpS1 gene preferably includes a ClpS1 gene-containing overexpression vector, a ClpS1 gene-containing complementation vector or a ClpS1 gene-containing gene expression cassette. The ClpS1 gene in the ClpS1 gene-containing overexpression vector is preferably an open reading frame of the ClpS1 gene, and the corresponding nucleotide sequence is shown in SEQ ID NO: 1 (ATGATGGCGACCGAAGTTTTAAACAAGCCCAGCAATAGCACAATCCGCAAACACGCCCCCCGTTACCGGGTCTTACTGCACAACGATGACTTCAACTCCATGGAGCATGTGGTGCAAACTTTGATCCAGACGGTGGCGGGCATGACCCAGCCCCAAGCGGTGGACATTATGATGGAAGCCCACTTTAACGGCATGTCTTTGGTGATTACTTGTGAGTTGGAACACGCTGAGTTTTACTGTGAAACCCTGCGGAGTCACGGGCTGTCCAGCACCATCGAACCGGACGAATAG). The ClpS1 gene in the ClpS1 gene-containing overexpression vector is preferably expressed by using an RbcL1A promoter. The nucleotide sequence of the RbcL1A promoter is shown in SEQ ID NO: 3 (CAGTCAATGGAGAGCATTGCCATAAGTAAAGGCATCCCCTGCGTGATAAGATTACCTTCAGAAAACAGATAGTTGCTGGGTTATCGCAGATTTTTCTCGCAACCAAATAACTGTAAATAATAACTGTCTCTGGGGCGACGGTAGGCTTTATATTGCCAAATTTCGCCCGTGGGAGAAAGCTAGGCTATTCAATGTTT).

[0022]

[0023] The present application does not have special restrictions on the type of backbone vector of the overexpression vector and the complementation vector, and a blue-green algae expression vector known in the art can be used. In a specific embodiment of the present application, the backbone vector of the ClpS1 gene-containing overexpression vector or the ClpS1 gene-containing complementation vector is pQKEm, which is a vector constructed by the inventors in their previous research (Jin, H., et. al., Biosensors and Bioelectronics 244 (2024) 115792). In the overexpression vector and the complementation vector, the position of the exogenous target gene fragment inserted into the backbone vector is preferably between the EcoRI and PstI enzyme cutting sites. The present application does not have special restrictions on the construction method of the overexpression vector and the complementation vector, and a construction method of a recombinant vector known in the art can be used, such as a method of homologous recombination or Gibson isothermal assembly.

[0024] In the present application, the blue-green algae preferably include wild-type blue-green algae and / or blue-green algae mutants lacking the ClpS1 gene. In a specific embodiment of the present application, the wild-type blue-green algae are Synechocystis sp. PCC 6803. The construction method of the blue-green algae mutants lacking the ClpS1 gene preferably comprises sequentially assembling an upstream fragment of the clpS1 gene, a resistance gene fragment, and a downstream fragment of the clpS1 gene by the Gibson method, and cloning the assembled long fragment into a pBR-SacB plasmid cut by BamHI to obtain the blue-green algae mutants. The resistance gene fragment includes a kanamycin (Kan) resistance gene fragment. The blue-green algae mutants are obtained by replacing the open reading frame (ORF) of the ClpS1 gene with the kanamycin (Kan) resistance gene fragment. The kanamycin (Kan) resistance gene fragment is obtained by amplification using a vector containing a kanamycin resistance gene (such as Ptrc10-GFP) as a template and primer pair 1. The primer pair 1 preferably includes a forward primer with a nucleotide sequence as shown in SEQ ID NO: 4 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 5.

[0025] In the present application, the suitable growth temperature of the blue-green algae heat-resistant strain preferably includes 28-44°C, more preferably 30-42°C, and can be 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, or 42°C.

[0026] In one specific embodiment of the present application, under the optimal growth temperature (30°C), both the wild type cyanobacterial strain and the ClpS1 gene deleted cyanobacterial mutant can grow normally, while under the high temperature stress (42°C), the wild type cyanobacterial strain shows a downward trend after 4 days of culture, the chlorophyll content decreases, and the ClpS1 gene deleted cyanobacterial mutant cannot grow and cell classification normally compared with the wild type strain, while the ClpS2 gene deleted cyanobacterial mutant does not show the same phenomenon. This indicates that compared with the ClpS2 protein, the ClpS1 protein is a necessary cellular component for Synechocystis to adapt to high temperature stress.

[0027] In one specific embodiment of the present application, in order to explore the relationship between the ClpS1 gene and the heat induction of cyanobacteria, a detection experiment of ClpS1 response to high temperature induction expression at the protein level was carried out. Western-blot protein hybridization experiment was used to detect that under the suitable temperature culture, the ClpS1 protein was not expressed, while under the high temperature stress culture condition, the expression reached a high level after 8 hours of treatment, showing obvious lag induction effect. This indicates that ClpS1 protein is a heat shock protein, and compared with the rapid response of HspA, ClpS1 is a stress delayed and sustained accumulation heat shock protein.

[0028] In another specific embodiment of the present application, in order to explore the relationship between the ClpS1 gene expression and the cyanobacterial resistance to high temperature, the wild type cyanobacterial strain overexpressing ClpS1 gene (WT-OE), the ClpS1 gene deleted cyanobacterial mutant containing the complementation vector of ClpS1 gene (ΔClpS1-CM) and the ClpS1 gene deleted cyanobacterial mutant containing the overexpression vector of ClpS1 gene (ΔClpS1-OE) were constructed, respectively, and were cultured under the suitable culture temperature and the high temperature stress culture temperature. The results show that under the suitable temperature culture, the overexpression of ClpS1 gene inhibits the growth of the wild type cyanobacterial strain, and there is no obvious difference in the growth characteristics between ΔClpS1-CM, ΔClpS1-OE and ΔClpS1-empty vector and the wild type strain. Under the high temperature stress culture, the growth of ΔClpS1-empty vector is obviously inhibited by high temperature, which is significantly lower than that of the wild type strain. Compared with ΔClpS1-empty vector, the complementation of ClpS1 gene can obviously improve the tolerance of ΔClpS1 to high temperature, reaching the similar level of the wild type strain. It is worth noting that the overexpression of ClpS1 gene does not effectively improve the heat resistance of the wild type cyanobacterial strain. Surprisingly, compared with the wild type cyanobacterial strain, ΔClpS1-OE shows excellent growth characteristics under high temperature stress.

[0029] The application provides a cyanobacterial heat-resistant strain, a recombinant expression ClpS1 linker protein or a ClpS1 gene or a gene derivative product containing the ClpS1 gene.

[0030] In the application, the cyanobacterial engineering strain preferably overexpresses the ClpS1 linker protein or the ClpS1 gene, or the cyanobacterial ClpS1 gene deletion mutant strain contains a complementation vector expressing the ClpS1 gene or a ClpS1 gene overexpression vector, and more preferably the cyanobacterial ClpS1 gene deletion mutant strain is the ClpS1 gene overexpression vector.

[0031] In the application, the construction method of the cyanobacterial ClpS1 gene deletion mutant strain of the ClpS1 gene overexpression vector preferably comprises the following steps:

[0032] The ClpS1 gene overexpression vector is transformed into the cyanobacterial mutant strain with the ClpS1 gene deleted by a three-parent combination method. After the transformation, a positive transformant is detected by a PCR method. The nucleotide sequences of the primers used in the PCR method are preferably shown in SEQ ID NO: 6 and SEQ ID NO: 7.

[0033] In view of the characteristics of the cyanobacterial heat-resistant strain constructed in the application, the application provides an application of the cyanobacterial heat-resistant strain in preparing a biosynthesis chassis.

[0034] In the application, the cyanobacteria can directly synthesize various organic compounds, including biological energy, medical and health compounds, and biologically active plant secondary metabolites and intermediate compounds, proteins and the like, by using carbon dioxide, light energy and inorganic nutrients. Meanwhile, the cyanobacteria grow fast, have a short growth cycle, and are simple and efficient in gene transformation, and can be applied to various fields as various biosynthesis chassis. The cyanobacterial heat-resistant strain provided in the application can not be limited by the culture temperature, and can realize the rapid growth of the cyanobacteria under normal culture temperature and high-temperature conditions, which greatly promotes the application of the cyanobacteria in biosynthesis.

[0035] The application of the ClpS1 gene in creating the cyanobacterial heat-resistant strain is described in detail in the embodiments below, but they should not be understood as limiting the protection scope of the application.

[0036] Example 1

[0037] Verification experiment of ClpS1 linker protein as a key protein for high-temperature stress resistance of Synechocystis

[0038] 1. Culture and detection method of Synechocystis

[0039] In this embodiment, the growth of Synechocystis 6803 is detected by the initial OD 730Inoculate 0.1 into 250 ml conical flask containing 50 ml fresh BG11 medium (formula see Table 1), and incubate at 30°C under continuous light (45 μE-m -2 ·s -1 ) with 120 rpm shaking. The growth of the strains is measured by the absorbance (OD 730 ) at 730 nm using a UV spectrophotometer, and the growth phenotype differences are recorded by taking pictures. When the strains used carry exogenous fragments of resistance genes, the appropriate concentration of the corresponding antibiotic is added to the medium.

[0040] Table 1 Standard BG11 medium

[0041] Ingredients Final concentration (g / L) NaNO3 1.5 CaCl2·2H2O 0.036 Ammonium ferric citrate 0.006 Na2.EDTA 0.001 K2HPO4 0.04 MgSO4.7H2O 0.075 Na2CO3 0.02 Citric Acid 0.006 Other trace elements 1 ml Distilled water To 1 liter

[0042] Table 2 Composition of other trace elements

[0043]

[0044]

[0045] 2. Method for constructing Synechocystis mutants

[0046] 2.1 Method for constructing ClpS1 mutant (ΔClpS1)

[0047] The construction of the ΔClpS1 mutant in Synechocystis sp. PCC 6803 was achieved by replacing the clpS1 open reading frame (ORF) with a kanamycin (Kan) resistance gene fragment. The construction was performed as follows: The Kan gene fragment (1087 bp) was amplified from the template Ptrc10-GFP (Huang, H.-H., Camsund, D., Lindblad, P. & Heidorn, T. Design and characterization of molecular tools for a Synthetic Biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Res. 38, 2577-2593 (2010).) using primer pair 1 (CCCACTCTATTGTAAACAAGAC, SEQ ID NO: 4 and CTCGAGCTGATCCTTCAACTC, SEQ ID NO: 5); the upstream homologous recombination fragment of the ClpS1 gene (800 bp) was amplified from the Synechocystis sp. PCC 6803 genomic DNA using primer pair 2 (TGTCGACGGAGCTCGAATTCGGCAACAATTTACCCTGGGGGTC, SEQ ID NO: 8 and GTCTTGTTTACAATAGAGTGGGTTACCTCCCTGGGCGAAAGTG, SEQ ID NO: 9); the downstream homologous recombination fragment of the ClpS1 gene (801 bp) was amplified using primer pair 3 (GAGTTGAAGGATCAGCTCGAGGCCCTAATTTTTTCTTGATGAC, SEQ ID NO: 10 and GGTGGACAGCAAATGGGTCGGCATCAATCAGGAGGGGGGGTC, SEQ ID NO: 11); and the three fragments were Gibson assembled (see Gibson, D.G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345 (2009).) into the BamHI-digested pBR-SacB plasmid. The Gibson assembly reaction system was as follows: 50 ng of vector DNA fragment backbone, 3 μΐ; 20 ng of synthetic gene fragment, 1 μΐ; Gibson Master Mixer, 10 μΐ; and water, up to 20 μΐ. The reaction was performed at 50 °C for 55 min.The constructed vector is transformed into E. coli DH5a by E. coli chemical competent transformation method. The E. coli transformation method is as follows: the E. coli competent is thawed on ice, 5-50 ng of plasmid DNA is added to 50 μl of E. coli competent and mixed carefully with a gun head and ice-bathed for 30 min, then heat-shocked at 42°C for 35 s, ice-bathed for 2 min, 340 μl of LB medium is added and mixed, cultured at 37°C for 1 h, and finally cultured at 37°C for 12-16 h on a plate containing the corresponding antibiotic, and the well-grown colonies are selected and sequenced for verification. After obtaining the pBR-SacB-clpS1:Kan vector, it is transformed and integrated into the genome of Synechocystis sp. by a triparental mating method.

[0048] The triparental mating transformation method has the following specific steps: including Synechocystis sp., DH5a strain carrying pBR-SacB-clpS1:Kan vector, and conjugative plasmid (DBS-0003 pRL443 strain). First, the E. coli (plasmid vector and conjugative plasmid) is inoculated from a fresh selection plate into LB medium containing antibiotics and cultured overnight. The overnight culture of E. coli seed liquid is inoculated into LB medium without antibiotics at a ratio of 1:20, and the strain containing pRL433 conjugative plasmid is mixed with the strain carrying pBR-SacB-clpS1:Kan vector by centrifugation to collect the culture. After resuspending the culture, equal volumes of the two cultures are mixed in a culture tube and streaked on a selection plate containing antibiotics and cultured at 37°C overnight. In addition, the same volume of each strain is used as a negative control to determine whether the plasmid vector and the conjugative plasmid have successfully recombined. The recombinant E. coli is scraped from the fresh selection plate cultured overnight and cultured in LB without antibiotics. Under the condition of no antibiotic selection pressure, the culture is cultured in LB medium at 37°C and 200 rpm for 2 h.

[0049] The culture is cultured to OD 730Both *Syntrophus spp.* (WT and ΔClpS1) at a concentration of ≈0.5–0.8 and the recombinant *E. coli* were resuspended. For conjugation, different volumes of cyanobacteria and *E. coli* were mixed gently in 1.5 ml centrifuge tubes and incubated statically at 30°C for 4–5 h. Then, the mixture was spot-inoculated onto BG11 agar plates. Finally, the conjugation plates were incubated at 30°C for 48 h under light. Colonies on the conjugation plates were collected using centrifuge tubes and BG11 agar. The cultures were then cultured at 30°C on solid medium containing BG11 + Em 25 μg / ml (WT transformant) or BG11 + Em 25 μg / ml + Kan 25 μg / ml (ΔClpS1 transformant). After new colonies grew, they were transferred to fresh selection plates several times. Single colonies were then picked and grown on antibiotic-free LB agar plates to confirm the absence of *E. coli* contamination. Genomic DNA was then extracted from the transformants and used as a template for PCR detection to verify the presence of plasmids and antibiotic fragments. The sequence-specific primers used were ATGCTTGATGGTCGGAAGAGG (SEQ ID NO:6) and CATCAATCAGGAGGGGGGGTC (SEQ ID NO:7). This pair of primers can be used to verify the presence of the kanamycin antibiotic gene fragment in the ΔClpS1 mutant transformants.

[0050] 2.2 Construction method of ClpS2 mutant (ΔClpS2)

[0051] The ΔClpS2 mutant from Synechocystis was constructed by replacing the clpS2 reading frame (ORF) with a fragment of the spectinomycin (Spect) resistance gene. The specific construction method is as follows: using pPZP200 as a template, primer pair 4 (ACTTGACCTGATAGTTTGGCTGTG, SEQ ID NO:12 and...) was used.

[0052] GTCACGCAACTGGTCCAGAA (SEQ ID NO:13) amplified the Spect gene fragment; using Synechocystis genomic DNA as a template, the fragment was amplified using primer 5.

[0053] (TGTCGACGGAGCTCGAATTCGAACGCTAAATTTTTCACTCCC, SEQ ID NO: 14 and TTCTGGACCAGTTGCGTGACAACGTATCTGGAAAATAGGC, SEQ ID NO: 15) amplified upstream (800bp) of the clpS2 gene for homologous recombination, primer 6 (AGCCA AACTATCAGGTCAAGTGACAGTAATCCGGTTGCTTGAAG, SEQ ID NO: 16 and GGTGGACAGCAAATGGGTCGGGCTTACCAAATCCGTCGCTTTAAC, SEQ ID NO: 17) amplified downstream (801bp) of the clpS2 gene for homologous recombination; these three fragments were assembled into the BamHI digested pBR-SacB plasmid by Gibson assembly (method as 2.1), the constructed vector was transformed into E. coli DH5a by E. coli chemical competent transformation method (method as above) and sequenced to obtain the pBR-SacB-clpS2:Spect vector, which was then transformed and integrated into the genome of Synechocystis sp. by triparental mating method.

[0054] 2.3 Construction method of ClpS1 & ClpS2 double mutant (ΔClpS1ΔClpS2)

[0055] ΔClpS1ΔClpS2 double mutant was obtained by transforming the pBR-SacB-clpS2:Spect vector into the ΔClpS1 mutant again by triparental mating.

[0056] 3. Stress environment cultivation of mutants

[0057] Firstly, the growth status of Synechocystis sp. wild type (WT), ClpS1 mutant (ΔClpS1), ClpS2 mutant (ΔClpS2), and ClpS1 & ClpS2 double mutant (ΔClpS1ΔClpS2) under the optimal growth condition (30°C) and high temperature stress condition (42°C) was detected.

[0058] The results showed that there was no significant difference in the chlorophyll content (Fig. 2B) or cell concentration (Fig. 2C) of the four strains under the optimal growth condition within the measured time range (10 days). However, under the high temperature stress condition, the growth trend of the WT strain showed a downward trend after 4 days, the chlorophyll content gradually decreased (Fig. 2B), and the cell growth basically stagnated and showed a trend of high temperature lysis (Fig. 2C). Figure 1 Figure 1 Figure 1 Figure 1 Figure 1 ​​​​The growth rate of the ΔClpS2 strain was slightly lower than that of the WT strain, but the cell proliferation trend was still maintained and the final cell growth concentration could reach a similar level to that of the WT strain Figure 1 The ΔClpS2 strain maintained a similar chlorophyll level to that of the WT strain, which indicated that the ClpS2 protein was not essential for the adaptation of Synechocystis to high-temperature stress. The ΔClpS1 and ΔClpS1ΔClpS2 strains could hardly grow and divide under high-temperature stress Figure 1 The ΔClpS1 and ΔClpS1ΔClpS2 strains could hardly grow and divide under high-temperature stress

[0059] Example 2

[0060] Verification of the ClpS1 linker protein as a heat shock-induced protein

[0061] After understanding the necessity of the ClpS1 protein for the adaptation of Synechocystis to high-temperature stress, the expression of the ClpS1 protein was further analyzed by Western-blot protein hybridization experiments.

[0062] The Western-blot protein hybridization method was as follows:

[0063] The collected C. sorokiniana cells were washed once with thylakoid buffer [20 mM Mes / NaOH (pH 6.4), 5 mM MgCl2, 5 mM CaCl2, 20% glycerol, 1 mM fresh phenylmethylsulfonyl fluoride (PMSF) and 5 mM benzidine] and suspended to a final volume of 0.2 ml. The cell suspension was mixed with 0.5 ml glass beads (diameter 0.1 mm; Sigma) and shaken in a Mini Bead Beater for 4 times, 30 seconds each time, with 2 minutes interval between each shaking and placed on ice for cooling. After centrifugation at 3,000 g for 10 minutes to remove unbroken cells and cell debris, the cell suspension was collected as total cell extract. The protein concentration was quantified using NanoDrop 1000, and 80 μg total protein extract was mixed and diluted with 4x laemmli sample buffer (Bio-Rad Cat No. 161-0747) and boiled for 5 min before performing protein gel (Bio-Rad Cat No. 5671044) electrophoretic separation. When performing protein immunoblot analysis, the proteins on the SDS / PAGE gel were transferred to Immun-Blot PVDF protein blotting membrane (Bio-Rad Cat No. 162-0177) using Trans-Blot semi-dry transfer instrument (Bio-Rad). After transfer, the membrane was blocked with TBST containing 0.1% Tween-20 and 5% skim milk powder for 1 h, followed by incubation with primary antibody at 4°C overnight or at room temperature for 1 h, and washed three times in TBST buffer for 10 min each time. Then the secondary antibody conjugated with horseradish peroxidase was incubated at room temperature for 1 h, washed three times in TBST buffer and detected using Western Bright ECL HRP substrate detection kit.

[0064] It was demonstrated by Western-blot protein hybridization experiment that ClpS1 protein was not expressed under optimal growth conditions, but was induced to express under high temperature stress conditions Figure 2 ); and compared to the rapid stress expression of HspA protein within 1 h under high temperature induction conditions15, the peak of ClpS1 protein expression under high temperature induction showed a delay effect, reaching a high expression amount only after 8 h of treatment, and accumulated continuously under high temperature stress conditions in cells, reaching the highest amount at 5 days (120 h); and compared to the induced expression amount of HspA in cells, the expression amount of ClpS1 protein was relatively low. Through this part of the research, it was concluded that ClpS1 protein is a heat shock-induced protein, and compared to the rapid response of HspA, ClpS1 is a stress-delayed and continuously accumulated heat shock-induced protein Figure 2

[0065] Example 3

[0066] ​Overexpression of ClpS1 protein significantly enhanced the high-temperature stress resistance of engineered strains.

[0067] Having learned that ClpS1 is a heat shock-induced protein in Synechocystis that plays a continuous role in resisting high-temperature stress, this example further investigates whether overexpressing the ClpS1 protein can confer better high-temperature stress resistance to engineered strains. In this example, the following five engineered strains were constructed via transgenic methods: wild-type strain with an empty vector (WT-pQKEm), wild-type strain with an overexpression vector (WT-OE), ΔClpS1 strain with an empty vector (ΔClpS1-pQKEm), ΔClpS1 strain with an endogenous gene fragment complementation vector (ΔClpS1-CM), and ΔClpS1 strain with an overexpression vector (ΔClpS1-OE).

[0068] The following describes the method for constructing a complementary vector expressing the ClpS1 protein gene fragment.

[0069] In this embodiment, the vector was constructed using either ligase ligation or Gibson isothermal assembly. When using Gibson assembly, all assembled fragments overlapped with the upstream and downstream fragments by 20 bp. The assembled DNA fragments in this embodiment were amplified using Phusion high-fidelity DNA polymerase, and the vector used for construction (…) Figure 3 The pQKEm gene was obtained by modifying the plasmid Ptrc1O-GFP containing the RSF1010 replicon (as described in Example 1). The backbone vector was generated by double digestion with EcoRI and PstI. The digestion system was a 60 μl reaction mixture: 10×FastDigestbuffer, 6 μl; plasmid DNA (3 μg), 11 μl; EcoRI endonuclease, 3 μl; PstI endonuclease, 3 μl; water added to a final volume of 37 μl to 60 μl. The digestion conditions were 37℃ for 2 h. Using Synechocystis genomic DNA as a template, PCR amplification was performed using primer pair 7 (TAGAGAGAATTCGATGTCTAATGCCCTCCGCC, SEQ ID NO:18 and TAGAGACTGCAGGAAATCGAGAACAGAGCAGGAACG, SEQ ID NO:19). The amplified gene fragment was digested with EcoRI and PstI (as described above) and purified by gel electrophoresis. The recovered fragment was ligated and inserted into the pQKEm vector backbone, which was also digested with EcoRI and PstI, as a vector for mutant replacement. Figure 3, CM). The ligation reaction system was as follows: 80 ng of vector DNA fragment backbone, 4 μl; 100 ng of inserted gene fragment, 2 μl; 10 x ligase buffer, 1 μl; T4 DNA ligase, 1 μl; and water, to 20 μl. The ligation was performed at 16 °C overnight, and the ligation product was transformed into E. coli, and the transformation method was as described above. The vector constructed in E. coli was verified by sequencing with primers 8 (GCGTATCACGAGGCAGAATTTCAG, SEQ ID NO: 20 and CCTTTGAGTGAGCTGATACCGC, SEQ ID NO: 21).

[0070] Construction of overexpression vector

[0071] The ClpS1 open reading frame (ORF) gene fragment of 378 bp was obtained by PCR amplification with primer pair 9 (tactagATGATGGCGACCGAAGTTTTA, SEQ ID NO: 22 and TGCCCTTTTTTGCCGGACTGCAtgccctccgccgctgaagttcc, SEQ ID NO: 23) using Sybr Green PCR Master Mix (Takara, Dalian, China) and Sybr Green PCR Master Mix (Takara, Dalian, China) as the template, and the amplification product was gel purified. The RbcL1A promoter fragment of 254 bp was obtained by PCR amplification with primer pair 10 (CTTTCGCTAAGGATGATTTCTGGCAGTCAATGGAGAGCATTGCC, SEQ ID NO: 24 and CTTCGGTCGCCATCATctagtaTTTCTCCTCTTTAAAC, SEQ ID NO: 25) using Sybr Green PCR Master Mix (Takara, Dalian, China) and Sybr Green PCR Master Mix (Takara, Dalian, China) as the template, and the amplification product was gel purified. The pQKEm vector backbone containing the ORF fragment, the RbcL1A promoter fragment, and EcoRI and PstI enzyme digestion was assembled by Gibson assembly (the method is as described above) to obtain the overexpression vector of the ClpS1 protein (pQKEm-ClpS1, OE). The constructed vector was verified by sequencing with primers GCGTATCACGAGGCAGAATTTCAG (SEQ ID NO: 26) and CCTTTGAGTGAGCTGATACCGC (SEQ ID NO: 27), thereby obtaining the overexpression vector of ClpS1. Figure 3 , OE). The constructed vector was verified by sequencing with primers GCGTATCACGAGGCAGAATTTCAG (SEQ ID NO: 26) and CCTTTGAGTGAGCTGATACCGC (SEQ ID NO: 27), thereby obtaining the overexpression vector of ClpS1.

[0072] The five strains were detected under the optimal growth conditions (30 °C) and high-temperature stress conditions (42 °C), respectively. Figure 4 The results showed that under the growth conditions of 30 °C, the growth of the WT-OE strain was affected to some extent, and the other four strains had no significant difference; this phenomenon indicated that the constitutive overexpression of ClpS1 protein in wild-type Synechocystis sp. PCC 6803 would affect the growth of the bacterial cells. Under the conditions of 42 °C, ΔClpS1-pQKEm and ΔClpS1Figure 1 ) are similar, i.e. they cannot grow normally under high temperature conditions; while WT-pQKEm and WT-OE, as well as the complemented strain of the mutant ΔClpS1, ΔClpS1-CM, all have similar and much better growth trend than ΔClpS1-pQKEm; and the strain ΔClpS1-OE, which constitutively overexpresses ClpS1 protein under the background of ΔClpS1 mutant, has a much better growth trend than all the other strains. The conclusion of this part is that the strain ΔClpS1-OE does not show obvious growth disadvantage compared to the wild type strain under normal growth temperature, but shows better stress resistance and growth advantage than the wild type strain under high temperature stress (see Figure 5 ). This feature will give it better adaptation and transition when it may face local temperature rise and other problems, thus better guarantee the continuous industrial fermentation process.

[0073] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. ClpS1 The application of genes in creating heat-resistant cyanobacterial strains is characterized in that, The heat-resistant cyanobacterial strain includes ClpS1 Cyanobacterial ClpS1 gene deletion mutant strains using gene overexpression vectors; ClpS1 The nucleotide sequence of the gene is shown in SEQ ID NO:1; the overexpression vector containing the ClpS1 gene... ClpS1 Gene utilization RbcL1A The expression was initiated by a promoter; the starting strain of the cyanobacterium was Synechocystis 6803.

2. Use according to claim 1, characterized in that, Suitable growth temperature of the thermotolerant cyanobacterial strain includes 28-44°C.

3. A thermotolerant strain of cyanobacteria, characterized in that, comprising comprising ClpS1 cyanobacteria comprising ClpS1 gene deletion mutant strain; the ClpS1 nucleotide sequence of the gene is shown as SEQ ID NO: 1; the ClpS1 overexpression vector of the gene ClpS1 gene utilizes RbcL1A promoter to initiate expression; the starting cyanobacterial strain of the cyanobacteria is Synechocystis sp. PCC 6803.

Citation Information

Patent Citations

  • Resistance marker-free porcine actinobacillus pleuropneumoniae double-gene defective strain, construction method and application thereof

    CN102517232A

  • Modified proteins and associated methods of treatment

    US20220096520A1