Application of OsSCL25 gene in regulating salt tolerance of rice

By overexpressing the OsSCL25 gene in the rice genome, the problem of insufficient salt tolerance in rice was solved, the salt tolerance of rice was significantly improved, and its adaptability to planting in saline-alkali land was enhanced.

CN119824033BActive Publication Date: 2025-11-25ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510095675.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-22
Publication Date
2025-11-25
Estimated Expiration
2045-01-22

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve the salt tolerance of rice, leading to a decline in rice yield and quality under salt stress, making it difficult to meet human consumption needs.

Method used

By overexpressing the OsSCL25 gene or its coding sequence in the rice genome, and then transforming the recombinant vector into rice using Agrobacterium-mediated transformation, the salt tolerance of rice can be improved.

Benefits of technology

Overexpression of the OsSCL25 gene significantly improved the salt tolerance of rice, enhanced seedling survival rate, chlorophyll content and fresh weight, reduced the content of superoxide dismutase, peroxidase and malondialdehyde, increased the soluble sugar content, and improved the adaptability of rice to planting in saline-alkali land.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119824033B_ABST
    Figure CN119824033B_ABST
Patent Text Reader

Abstract

The application belongs to the field of molecular biological technology and particularly relates to application of OsSCL25 gene in regulating salt stress tolerance of rice. Under salt stress, the seedlings of the strain overexpressing OsSCL25 gene all show that the survival rate, chlorophyll, fresh weight and dry weight are higher than those of the wild type, the superoxide dismutase, peroxidase and malondialdehyde content are lower than those of the wild type, and the proline content is significantly higher than that of the wild type and the mutant. Under normal treatment, the soluble sugar content of the wild type, the OsSCL25 mutant and the overexpression strain has no significant difference, but after salt stress, the soluble sugar content of the overexpression strain is significantly higher than that of the wild type and the gene mutant, so the OsSCL25 gene is involved in the regulation of salt tolerance of rice. After overexpression of the gene, the salt tolerance of rice is significantly improved, so the improved rice material suitable for planting in saline-alkali land can be cultivated by using OsSCL25 through biotechnology, and a new idea for improving the planting rate of rice in saline-alkali land is provided.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology technology, and particularly relates to application of OsSCL25 gene in regulating salt stress tolerance of rice. BACKGROUND

[0002] The most sensitive period of rice to salt stress in the whole growth cycle is the seedling stage and the reproductive stage. In the existing research, salt-tolerant varieties are mainly selected by observing the salt tolerance phenotype in the seedling stage. The harm of salt stress to rice growth mainly includes cell osmotic imbalance and ion damage. Salt stress leads to ion imbalance of rice cells, increase of cell membrane permeability, a large number of ions entering cells, generation of ROS, disorder of intracellular antioxidant system, inactivation due to failure to perform normal physiological functions; salt stress leads to degradation of chlorophyll in rice leaves in a short time, reduction of photosynthetic rate, insufficient energy supply, and blocked protein synthesis; in addition, rice needs to use a large amount of energy to regulate ion absorption and transport and produce substances such as sucrose, trehalose and proline to adapt to salt stress, thereby causing a substantial decrease in rice yield and rice quality, which is difficult to meet the human demand for food even after processing.

[0003] Rice salt tolerance belongs to a relatively typical quantitative trait, which is regulated by multiple genes. Although a plurality of genes related to rice salt tolerance have been mined and identified, it is still difficult to improve the salt tolerance of rice in the art. Therefore, identifying more candidate genes that can respond to salt stress is of great significance to comprehensively improve the salt tolerance of rice. SUMMARY

[0004] The purpose of the present application is to provide application of OsSCL25 gene in regulating salt stress tolerance of rice, and the overexpression of OsSCL25 gene significantly improves the salt tolerance of rice, thereby providing a new idea for improving the planting rate of rice in saline-alkali land.

[0005] The present application provides application of OsSCL25 gene in regulating salt stress tolerance of rice, and the nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO. 1.

[0006] As a preferred solution, the regulation is to improve the salt tolerance of rice by overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome.

[0007] The present application also provides a method for improving the salt tolerance of rice, which comprises the following steps: overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome.

[0008] The nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO. 1.

[0009] As a preferred solution, the CDS sequence of the OsSCL25 gene is shown as SEQ ID NO. 2.

[0010] As a preferred solution, the method for overexpression is transforming the recombinant vector into rice to obtain rice with improved salt tolerance;

[0011] The recombinant vector comprises the OsSCL25 gene or the CDS sequence of the OsSCL25 gene.

[0012] As a preferred solution, the transformation method comprises Agrobacterium transformation.

[0013] The application further provides a recombinant vector for overexpression of the OsSCL25 gene or the CDS sequence of the OsSCL25 gene, characterized in that the nucleotide sequence of the OsSCL25 gene is shown as SEQ ID NO. 1.

[0014] As a preferred solution, the basic skeleton of the recombinant vector comprises a pUN1301 vector.

[0015] The application further provides a method for creating a salt-tolerant rice germplasm, comprising the following steps: overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in a target rice genome.

[0016] As a preferred solution, the rice comprises Nipponbare.

[0017] Beneficial effects: the application provides application of the OsSCL25 gene in regulating salt stress tolerance of rice, under salt stress, the seedlings of the strain overexpressing the OsSCL25 gene all have higher survival rate, chlorophyll, fresh weight and dry weight than the wild type, and have lower superoxide dismutase, peroxidase and malondialdehyde content than the wild type, and have significantly higher proline content than the wild type and the mutant. Under normal treatment, there is no significant difference in soluble sugar content among the wild type, the OsSCL25 mutant and the overexpression strain, but after salt stress treatment, the soluble sugar content of the overexpression strain is significantly higher than that of the wild type and the gene mutant, so the OsSCL25 gene is involved in regulation of salt tolerance of rice. After overexpression of the gene, the salt tolerance of rice is significantly improved, so the improved rice material suitable for planting in saline-alkali land can be cultivated by using the OsSCL25 through biotechnology, and a new idea for improving the planting rate of rice in saline-alkali land is provided. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0019] Figure 1OsSCL25 gene in Example 1 in response to salt stress; wherein the expression analysis of rice OsSCL25 gene under salt stress treatment, each group of data three biological repeats, **: P<0.01 indicates the significance of expression difference between experimental group and control under t test;

[0020] Figure 2 Positive detection of OsSCL25 overexpression line in Example 2 and determination of gene expression amount; wherein A is the positive detection of OsSCL25 overexpression line, P is positive control, N is Nipponbare, negative control; the white horizontal line marked is the positive plant of overexpression line, M5000 is 5000 DNA marker; B is the expression amount of OsSCL25 gene of overexpression line; each group of data three biological repeats, **: P<0.01 indicates the significance of expression difference between experimental group and control under t test, WT represents wild type, OE#1 and OE#2 represent OsSCL25 overexpression line;

[0021] Figure 3 Schematic diagram of gene editing vector construction in Example 3;

[0022] Figure 4 Positive detection of scl25 gene editing line in Example 3 and gene editing site; wherein A is the positive detection of scl25 gene editing line, P is positive control, N is Nipponbare, negative control; scl25T0 is scl25 gene editing line T0 plant, M5000 is 5000 DNA marker; B is the mutation site information of gene editing line scl25#1 and scl25#2, the number represents the relative position of ATG start, the arrow represents the position of base insertion or deletion, "+" represents the insertion of base, "-" represents the deletion of base; the scale is 100 bases;

[0023] Figure 5 OsSCL25 gene phenotype in response to salt stress in Example 4; wherein A is the phenotype difference of wild type, OsSCL25 gene editing line, overexpression line under salt stress, the scale is 10 cm; B is the survival rate of wild type, OsSCL25 gene editing line, overexpression line; C is the fresh weight of each line D is the dry weight of each line; WT represents wild type, scl25#1 and scl25#2 represent OsSCL25 gene editing line, OE#1 and OE#2 represent OsSCL25 overexpression line; each group of data three biological repeats, multiple comparisons according to LSD method, significant difference is marked with different lowercase letters, p<0.05;

[0024] Figure 6Salt stress NBT, DAB staining of wild type, OsSCL25 mutant and overexpression line in Example 4; wherein A is NBT staining to detect the level of hydrogen peroxide of wild type, OsSCL25 mutant and overexpression line before and after salt treatment; B is DAB staining to detect the accumulation of superoxide anion of wild type, OsSCL25 mutant and overexpression line before and after salt treatment; WT represents wild type, scl25#1 and scl25#2 represent OsSCL25 gene editing line, OE#1 and OE#2 represent OsSCL25 overexpression line, and the scale is 5mm;

[0025] Figure 7 Physiological index determination of wild type, OsSCL25 gene editing line and overexpression line after salt stress in Example 4; wherein A is superoxide dismutase activity (SOD); B is peroxidase activity (POD); C is hydrogen peroxide content; D is chloroplast content; E is catalase activity (CAT); F is malondialdehyde content (MDA); G is proline content; H is soluble sugar content; WT represents wild type, scl25#1 and scl25#2 represent OsSCL25 gene editing line, OE#1 and OE#2 represent OsSCL25 overexpression line, multiple comparisons are carried out according to LSD method, and significant differences are marked with lowercase letters, p<0.05. DETAILED DESCRIPTION

[0026] The application provides application of an OsSCL25 gene in regulating salt stress tolerance of rice, and the regulation is to improve salt tolerance of rice by overexpressing the OsSCL25 gene or a CDS sequence of the OsSCL25 gene in a target rice genome.

[0027]

[0028] As a specific embodiment, the CDS sequence of the OsSCL25 gene is shown as SEQ ID NO. 2: 5'-ATGGGGAGAGGCTACAGTTACAGCCCATCACCACCTCCAAGAAGCTATCGGAGAAGGGCCAGCAGCCCAATTCCCCGTGACCGTTATGGTGGACGTGGTAGAGATCTCCCGACCAGTCTTCTAGTCAGGAATCTTCGTCGGGACTGCCGGCCAGAGGACCTTCGTCGGCCATTCGGACAATTTGGTCGTCTCAAAGACATATATATTCCAAGAGATTACTATAGCGGTGAACCGCGTGGATTTGGATTTGTCCAGTACTACGATCCTGATGATGCTGCCGATGCAAAATACTACATGGACGGGCAGGTTATTCTGGGCAGGGAAGTAGCTGTTGTATTTGCAGAGGAGAACAGAAAGAAGCCTTCTGAGATGAGATCTCGCGACAGAATAAGTGGCAGCAGAGGTCGTTCCTATGACCAAAGGTACTCTAGGTCACCGCGATACTCTCCTCCTCCAAGGGGCCGCTCGCCTTACCGCAGCCCGAGCTACTCAAGGTCTCCTTCGCCTCGGTATGCAAGGCGCAGGATGAGGGAGAGGTCCTACTCACCAGTTGAGAGCAGATCAAGGAGCAGGAGCCCGGTCGAGGAAGGATACGGTGGTGGATCCACACGGAGAGAGAGGTCGCTCTCTGTCAGTGAATGA-3'.

[0029] The application further provides a method for improving salt tolerance of rice, comprising the following steps: overexpressing OsSCL25 gene or CDS sequence of OsSCL25 gene in target rice genome; the nucleotide sequence of the OsSCL25 gene is shown as SEQ ID NO. 1; the CDS sequence of the OsSCL25 gene is shown as SEQ ID NO. 2. As a specific embodiment, the rice includes Nipponbare. The salt can be NaCl.

[0030] As a specific embodiment, the method for improving salt tolerance of rice provided by the present application comprises the following steps: introducing a recombinant vector containing an OsSCL25 gene or a CDS sequence of the OsSCL25 gene into Agrobacterium EHA105, transforming the recombinant vector into a target rice genome by using an Agrobacterium-mediated transgenic method, and obtaining rice with improved salt tolerance. As a specific embodiment, the basic skeleton of the recombinant vector can be a pUN1301 vector.

[0031] As a specific embodiment, under salt stress, after overexpression of the OsSCL25 gene in the target rice genome, the growth of the OsSCL25 overexpression line is better than that of the wild type, the number of withered leaves is significantly less than that of the wild type and the mutant, and the survival rate reaches 70% after 14 days of recovery, indicating that OsSCL25 has a positive effect on regulating salt tolerance of rice seedlings.

[0032] As a specific embodiment, under salt stress, the seedlings of the line overexpressing the OsSCL25 gene all exhibit higher chlorophyll, fresh weight and dry weight than the wild type, lower superoxide dismutase, peroxidase and malondialdehyde content than the wild type, and significantly higher proline content than the wild type and the mutant. Under normal treatment, there is no significant difference in soluble sugar content among the wild type, the OsSCL25 mutant and the overexpression line, but after salt stress, the soluble sugar content of the overexpression line is significantly higher than that of the wild type and the mutant, so the OsSCL25 gene is involved in the regulation of salt tolerance of rice. After overexpression of the gene, the salt tolerance of rice is significantly improved, so improved rice materials suitable for planting in saline-alkali land can be cultivated by using OsSCL25 through biotechnology, thereby providing a new idea for improving the planting rate of rice in saline-alkali land.

[0033] The present application also provides a method for creating a salt-tolerant rice germplasm, comprising the following steps: overexpressing an OsSCL25 gene or a CDS sequence of the OsSCL25 gene in a target rice genome.

[0034] In order to further illustrate the present application, the application of the OsSCL25 gene in regulating salt stress tolerance of rice is described in detail in the embodiments below, but they should not be understood as limiting the scope of protection of the present application.

[0035] Unless otherwise specified, the raw materials used in the present application have no special requirements and commercially available products known to those skilled in the art can be used.

[0036] Example 1: Analysis of salt stress-induced expression characteristics of rice OsSCL25

[0037] To explore the effect of salt treatment on the expression of OsSCL25 gene (LOC_Os07g43950, as shown in SEQ ID NO. 1), the Nipponbare seeds (Li Y, Zhou J, Li Z, Qiao J, Quan R, Wang J, Huang R, Qin H. SALT AND ABA RESPONSE ERF1 improves seed germination and salt tolerance by repressing ABA signaling in rice. Plant Physiol. 2022 Jun 1; 189(2): 1110-1127. doi: 10.1093 / plphys / kiac125. PMID: 35294556; PMCID: PMC9157093.) with full and uniform appearance and no obvious disease spots were selected, placed in a 37°C oven for 2 days until the dormancy was broken, then sterilized with 75% alcohol for 2 min and washed with clean water. The water just covered the seeds, which were placed in a 30°C incubator, and the water was changed every 6 h until the seeds were white. The seeds with uniform white appearance were placed in a 37°C incubator with clean water for germination, and 1 day later, the seeds with uniform germination were selected and placed in a 96-well black germination box. The first week was cultured with clean water, and the last two weeks were cultured with 1 / 2 concentration of rice nutrient solution. Complete rice nutrient solution requires the preparation of 5 kinds of mother liquor. 1 mL of mother liquor 1, 1 mL of mother liquor 2, 1 mL of mother liquor 3, 1 mL of mother liquor 4 and 1 mL of mother liquor 5 are added to 1 liter of complete rice nutrient solution (mother liquor 1: NH4NO380 g / L, NaH2PO4·2H2O 93 g / L, K2SO452.4 g / L; mother liquor 2: CaCl2·2H2O 44.2 g / L; mother liquor 3: MgCl2·6H2O 122 g / L; mother liquor 4: FeEDTA 19 g / L; mother liquor 5: H3BO33.01 g / L, MnSO4·5H2O 2.17 g / L, CuSO4·5H2O 0.075 g / L, ZnSO4·7H2O 0.2008 g / L, NaMoO4·2H2O 0.024 g / L), and the pH is adjusted to 5.8. The seedlings were cultured to the 4-leaf stage, and the seedlings were divided into control and treatment groups. The control group was moved to a square plastic box containing complete rice nutrient solution for culture, and the treatment group was moved to a square plastic box containing 150 mM NaCl (8.775 g NaCl was added to 1 liter of complete rice nutrient solution).Then start timing, take the control group and the treatment group of 1 h, 3 h, 6 h, 9 h, 12 h, 24 h, 48 h, 72 h, 120 h, 168 h after treatment of the above-ground samples, immediately take sample harvest in liquid nitrogen, extract total RNA by Trizol method, after the sample is ground, add 1 mL RNA Extraction Reagent (manufacturer: Yixing Biotechnology Co., Ltd., item number: 10606ES60), after 5 min at room temperature, add 1 / 5 volume of chloroform, shake vigorously for 15 s, stand at room temperature for 3 min, then centrifuge at 4°C, 12000g for 10 min, then transfer the supernatant to a new centrifuge tube, add 1 / 2 volume of isopropanol, mix well by inverting, then stand at room temperature for 10 min, then centrifuge at 4°C, 12000g for 10 min, carefully remove the supernatant, add an equal volume of 75% ethanol, centrifuge at 4°C, 7500g for 5 min to remove the supernatant, stand at room temperature for 10 min, then add 100 μL sterile water to dissolve the RNA. After complete dissolution, measure the RNA concentration, and reverse transcribe into cDNA using reverse transcription reagent (Yixing Biotechnology Co., Ltd., item number: 11141ES60). Design primers and detect the expression level of OsSCL25 before and after salt treatment by Hieff qPCR SYBR Green MasterMix (Yixing Biotechnology Co., Ltd., item number: 11201ES08). Primer sequence: Primer F: 5'-ATGGGGAGAGGCTACAGTTAC-3' (as shown in SEQ ID NO. 3); Primer R: 5'-GGGAGATCTCTACCACGTCC-3' (as shown in SEQ ID NO. 4).

[0038] The results are shown in Table 1 and Figure 1. Figure 1 As shown in Table 1 and Figure 1, the results show that the OsSCL25 gene began to decrease at 6 h after salt stress, and the gene expression was significantly inhibited from 6 h to 168 h after stress. The difference reached a peak at 24 h, at which time the expression of the control group was about 3 times that of the salt treatment, and then the difference began to decrease, indicating that the rice OsSCL25 gene responds to salt stress.

[0039] Table 1 Gene expression data of rice OsSCL25 under salt stress treatment

[0040]

[0041] Example 2 Construction and molecular identification of rice OsSCL25 gene overexpression vector

[0042] 1. Construction of rice OsSCL25 gene overexpression vector

[0043] Following the RNA extraction and reverse transcription methods described in Example 1, cDNA samples from the aboveground and underground parts of *Nipponbare* seedlings were obtained. Using these cDNA samples as templates, corresponding primers were designed using the Chinese Rice website (https: / / www.ricedata.cn / ) and SnapGene software. A specific CDS fragment of the OsSCL25 gene (as shown in SEQ ID NO.2) was amplified using a standard Tap enzyme PCR reaction for subsequent experiments. The following primers were designed for PCR fragment amplification: Primer F3: 5'-CGACTCTAGAGGATCCCCG GGATGGGGAGAGGCTACAGT-3' (as shown in SEQ ID NO.5); Primer R3: 5'-AATTCGAGC TCGGTACCCGGGTCACTTGTCATCGTCATCCTTGTAGTC-3' (as shown in SEQ ID NO.6)

[0044] The total reaction volume was 10 μL: 5 μL 2×Hieff PCR Master Mix, 0.25 μL Limer F, 0.25 μL Limer R, 0.5 μL of the above template, and 4 μL ddH2O. PCR reaction conditions: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 30 sec, 54℃ annealing for 30 sec, 72℃ extension for 1 min, 32 cycles; 72℃ extension for 3 min, and storage at 4℃. The success of the experiment was determined by agarose gel electrophoresis results. Using a DNA purification kit (catalog number: DR0101250) provided by Hangzhou EasyBio Biotechnology Co., Ltd., the CDS fragment containing the correct target gene was recovered and purified to obtain the OsSCL25 gene CDS fragment with restriction enzyme sites.

[0045] The Smal enzyme cutting site (Thermo, Cat:ER0661) was selected in the multiple cloning site region of the pUN1301 (Xia C, Liang G, Chong K, Xu Y. The COG1-OsSERL2 complex senses cold to trigger signaling network for chilling tolerance in japonica rice. Nat Commun. 2023 May 29;14(1):3104. doi: 10.1038 / s41467-023-38860-4. Erratum in: Nat Commun. 2024 Apr 26;15(1):3536. doi: 10.1038 / s41467-024-47895-0. PMID: 37248220; PMCID: PMC10227007.) vector, and the vector plasmid was linearized by enzyme cutting according to the instructions. Then, the OsSCL25 gene overexpression recombinant vector was obtained by homologous recombination.

[0046] Homologous recombination: The CDS fragment of the OsSCL25 gene was inserted into the Smal region of the multiple cloning site of the pUN1301 vector using the homologous recombination method Clone Express II One Step Cloning Kit (Nanjing Noviezhan Biotechnology Co., Ltd., Cat: C112-01) according to the instructions, and the obtained overexpression recombinant vector was named pUN1301-OsSCL25.

[0047] 2. Identification of rice OsSCL25 gene overexpression lines

[0048] The pUN1301-OsSCL25 overexpression recombinant vector obtained in the previous step was transformed into Agrobacterium EHA105, and after successful identification of transformation, the rice OsSCL25 gene overexpression T0 generation transgenic plants were obtained by rice genetic transformation method.

[0049] Agrobacterium transformation: 100 μL of Agrobacterium competent cells were taken out from -80 °C refrigerator, thawed to ice water mixture on ice, 10 μL of pUN1301-OsSCL25 vector recombinant plasmid was added, mixed well, then frozen in liquid nitrogen for 5 min, 37 °C water bath for 5 min, and then ice bath for 5 min; 750 μL of LB liquid medium without antibiotics was added, and then recovered for more than 2 h at 28 °C, 200 rpm on a shaker; 100 μL of the above recovered Agrobacterium bacterial solution was inoculated on solid LB medium containing 50 mg / L of rifampicin and 50 mg / L of kanamycin antibiotics, the plate was inverted and cultured at 28 °C for 3 days. Single colonies were picked from the plate and cultured in liquid LB medium containing rifampicin and kanamycin antibiotics, and then sent to the company for sequencing to screen positive clones, and Agrobacterium containing pUN1301-OsSCL25 vector was obtained.

[0050] Obtaining of transgenic rice lines: (1) 20 g of non-disease spot Japanese rice seeds were selected and the seed coat was removed, and the seed embryo was as complete as possible. Soak in 75% alcohol for 1 min, wash with ddH2O, then sterilize with 20% sodium hypochlorite for 20 min, then wash with sterilized water, dry in a clean bench, and place in callus culture medium (KNO32.83 g / L, CaCl2·2H2O 0.166 g / L, MgSO4·7H2O 0.185 g / L, K2HPO40.4 g / L, (NH4)2SO40.463 g / L, KI 8 mg / L, H3BO31.6 mg / L, MnSO4·4H2O 4.4 mg / L, ZnSO4·7H2O 1.5 mg / L, FeSO4·7H2O 27.8 mg / L, Na2·EDTA·2H2O 37.3 mg / L, myo-inositol 0.1 g / L, glycine 2 mg / L, VB30.5 mg / L, VB60.5 mg / mL, VB11 mg / L, 2,4-D 0.1 mg / L, hydrolyzed casein 0.3 g / L, proline 2.878 g / L, sucrose 30 g / L, 2,4-D 0.1 mg / L, agar 7 g / L, adjust pH to 5.8) with sterile operation. Culture continuously for 8 days at 28 °C under continuous light until good callus grows.

[0051] (2) Resuspend the Agrobacterium containing pUN1301-OsSCL25 vector in liquid LB medium, then take 100 μL and spread on AB solid medium (NaH2PO41 g / L, NH4Cl 1 g / L, MgSO4·7H2O 0.3 g / L, KCl 0.15 g / L, CaCl2·2H2O 12 mg / L, FeSO4·7H2O 2.5 mg / L, glucose 5 g / L, agar 15 g / L, kanamycin 50 mg / L, rifampicin 50 mg / L, adjust pH to 5.8) and incubate at 28°C. After 3 days, use 20 mL AAM liquid medium (KCl 0.3 g / L, CaCl2·2H2O 15 mg / L, MgSO4·7H2O 25 mg / L, NaH2PO4 15 mg / L, KI 0.75 mg / L, H3BO3 3 mg / L, MnSO4·4H2O 10 mg / L, ZnSO4·7H2O 2 mg / L, NaMoO4·2H2O 0.25 mg / L, CuSO4·5H2O 0.025 mg / L, CoCl2·6H2O 0.025 mg / L, FeSO4·7H2O 27.8 mg / L, Na2·EDTA·2H2O 37.3 mg / L, myo-inositol 0.1 g / mL, glycine 7.5 mg / L, VB3 1 mg / L, VB6 1 mg / L, VB1 10 mg / L, glutamine 0.9 g / L, arginine 0.177 g / L, aspartic acid 0.3 g / L, hydrolyzed casein 0.5 g / L, glucose 18 g / L, sucrose 20 g / L, adjust pH to 5.2) to wash the Agrobacterium from the AB solid medium, adjust the concentration of the bacterial solution to OD 600 = 0.1, then add 20 μL of 100 mM acetosyringone and shake for 1 h to obtain the treated bacterial solution.

[0052] (3) Select good callus and place in the treated bacterial solution and shake for 5 min, then discard the bacterial solution, remove excess bacterial solution from the callus using sterile filter paper, then place on 2N6-AS solid medium (50 mL 20x N6 macroelement stock solution, 10 mL 100x N6 microelement stock solution, 10 mL 100x iron salt stock solution, 10 mL 10 mg / mL myo-inositol, 1 mL 2 mg / mL glycine, 0.5 mL 1 mg / mL VB3, 0.5 mL 1 mg / mL VB6, 0.1 mL 10 mg / mL VB1, 0.45 mL 0.25 mg / mL 2,4-D, 0.3 g hydrolyzed casein, 10 g glucose, 30 g sucrose, add water to 1 L, adjust pH to 5.2, add 7 g agar powder, autoclave at high temperature and high pressure, then add 1 mL 100 mM AS under sterile conditions, and incubate at 25°C in the dark for 3 days.

[0053] (4) After 3 days, the callus tissue after dark culture was collected into a sterile Erlenmeyer flask, rinsed 10 times with sterile water, placed on sterile filter paper to dry, and then transferred to N6-DS medium (N6D solid medium with 300 mg / L termethin and 50 mg / L hygromycin added) and irradiated at 28°C for 14 days.

[0054] (5) Transfer the newly grown resistant callus from (4) to RE differentiation medium (NH4NO3 1.65 g / L, KNO3 1.9 g / L, CaCl2·2H2O 0.44 g / L, MgSO4·7H2O 0.37 g / L, KH2PO4 0.17 g / L, MnSO4·4H2O 0.223 g / L, ZnSO4·7H2O 8.6 mg / L, CuSO4·5H2O 0.025 mg / L, CoCl2·6H2O 0.025 mg / L, KI 0.83 mg / L, H3BO3 6.2 mg / L, NaMoO4·2H2O 0.25 mg / L, Na2·EDTA·2H2O) 37.3 mg / L, inositol 0.1 g / L, glycine 2 mg / L, VB3 0.5 mg / L, VB6 0.5 mg / L, VB1 0.1 mg / L, sucrose 30 g / L, kinetin 2 mg / L, naphthaleneacetic acid 0.2 mg / L, agar 7 g (pH adjusted to 5.8). Pale yellow callus tissue will develop green spots. After the green spots differentiate into green seedlings, they are transferred to HF rooting medium (RE differentiation medium with kinetin and naphthaleneacetic acid removed, otherwise the same) and cultured at 32℃ for one week. After the seedlings grow to 10 cm in height, they are hardened off and then transferred to the field. Transgenic positive plants are obtained after testing.

[0055] ①PCR positive test

[0056] Leaf DNA was extracted from OsSCL25 overexpressing lines obtained through rice genetic transformation (Lv Yaci. Research progress on plant DNA extraction methods [J]. Examination Weekly, 2011, (57): 176-177.). The following primers were designed for PCR amplification using genomic DNA as a template. Primer F4 is a sequence located on the pUN1301 vector, and Primer R4 is a sequence of the CDS of the OsSCL25 gene (Primer F4: 5'-TTTTTAGCCCTGCCTTCATACG-3' (as shown in SEQ ID NO.7); Primer R4: 5'-CCTGCCCGTCCATGTAGTAT-3' (as shown in SEQ ID NO.8)). The size of the target band was observed after agarose gel electrophoresis. Figure 2 Plants showing the same pattern as the positive control (A) are considered positive, while those without the target band are considered negative. The positive overexpression lines are named OE#1 and OE#2.

[0057] ②OsSCL25 gene expression detection

[0058] OsSCL25 gene expression detection was performed using the PCR SYBR Green Master Mix (Cat No: 11200ES08) provided by Yixing Biotech Co., Ltd. PCR SYBR Green Master Mix (Cat No: 11200ES08) was used to detect the transcription level of OsSCL25 in wild type and overexpression lines OE#1, OE#2. OsActin (Gao R, Lu Y, Wu N, Liu H, Jin X. Comprehensive study of serine / arginine-rich (SR) gene family in rice: characterization, evolution and expression analysis. PeerJ. 2023 Oct 13;11:e16193. doi: 10.7717 / peerj.16193. PMID: 37849832; PMCID: PMC10578304.) was used as the internal reference gene, and the OsSCL25 gene expression detection primers were Primer F6 and Primer R6 (Primer F6: 5'-ATGGGGAGAGGCTACAG TTAC-3' (as shown in SEQ ID NO. 9); Primer R6: 5'-GGGAGATCTCTACCACGTCC-3' (as shown in SEQ ID NO. 10)).

[0059] The relative expression of OsSCL25 gene in OsSCL25 overexpression lines is shown in Table B and Table 2. Figure 2 The results showed that the expression of OsSCL25 gene in OE#1, OE#2 was more than 100 times that of wild type Nipponbare.

[0060] Table 2: OsSCL25 gene expression data of overexpression lines

[0061] WT OE#1 OE#2 0.763129604 12.06982901 13.7053443 0.683020128 12.23831755 12.7875384 0.641712949 11.90366011 12.87648276

[0062] Example 3: Construction and molecular identification of rice OsSCL25 gene mutant transgenic plants

[0063] (1) Construction and transformation of gene editing vector

[0064] Target design: The design of two editing targets of OsSCL25 gene was completed on the CRISPER-GE (http: / / skl.scau.edu.cn / ) website.

[0065] Sequence of target 1: GGAATCTTCGTCGGGACTGC (as shown in SEQ ID NO. 11);

[0066] Sequence of target 2: GGAATCTTCGTCGGGACTGC (as shown in SEQ ID NO. 12).

[0067] Vector construction: Cas9Pubi-H vector was selected (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant. 2015 Aug;8(8):1274-84. doi: 10.1016 / j.molp.2015.04.007. Epub 2015 Apr 24. PMID: 25917172.). According to the method reported by Academician Liu Yaoguang's team (Ma X, Zhang Q, Zhu Q, et al. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants [J]. Mol Plant, 2015, 8(8): 1274-1284.), gRNA was connected into the vector to obtain a gene editing vector, as shown in Figure 3

[0068] The obtained gene editing vector was transformed into Agrobacterium EHA105 according to the Agrobacterium transformation method of Example 2, and the recombinant Agrobacterium with correct sequencing results was stored. According to the method for obtaining transgenic rice strains in Example 2, the gene editing vector was transformed into Japanese rice, and transgenic plants were obtained through rice tissue culture.

[0069] (2) Molecular identification of transgenic plants of rice OsSCL25 gene mutants

[0070] ​Leaf DNA of the gene edited line plants obtained after tissue culture was extracted, and specific primers GE-SISVD-F: 5'-TATCCCTCACCAGATCCACC-3' (as shown in SEQ ID NO. 13); and GE-SISVD-R: 5'-AGCACCCTTGTCAACAACCT-3' (as shown in SEQ ID NO. 14) were designed to detect the positive plants of gene editing by PCR amplification Figure 4 A), and the PCR products were sent to Genechem Technology Co., Ltd. for sequencing. Two homozygous plants in which two OsSCL25 genes were mutated were identified according to the sequencing results, and were named as scl25#1 and scl25#2. The gene editing sites of scl25#1 and scl25#2 are shown in Figure 4 B. In the scl25#1 line, a nucleotide T was inserted at the first exon of the OsSCL25 gene, and a nucleotide A was inserted at the second exon; in the scl25#2 line, a nucleotide sequence TAAATTCCTGACTAAATATTGACTAA (as shown in SEQ ID NO. 15) was inserted at the first exon of the OsSCL25 gene, and a nucleotide sequence GCCATTCGGACAATT (as shown in SEQ ID NO. 16) was deleted at the second exon, resulting in a frameshift mutation.

[0071] Example 4 Identification of salt tolerance of OsSCL25 gene mutant and overexpression line

[0072] Wild type, homozygous OsSCL25 gene edited line, and overexpression line were subjected to salt treatment experiment in seedling stage, and the phenotype and physiological and biochemical indexes were observed and determined.

[0073] (1) Identification of salt tolerance phenotype of OsSCL25 mutant and overexpression line

[0074] Wild type, OsSCL25 gene edited line, and overexpression line rice seeds with full and uniform appearance and no obvious disease spots were selected, and the germination and seed soaking method, rice seedling culture method, and salt treatment method of reference example 1 were used for culture in a 28°C rice incubator for two weeks. The first week was cultured with water, the second week was cultured with 1 / 2 concentration of rice nutrient solution, and the third week was cultured with complete rice nutrient solution for the control group and with complete rice nutrient solution containing NaCl for the treatment group, to perform salt stress experiment.

[0075] The wild type, OsSCL25 gene edited line, and overexpression line seedlings with consistent growth were treated with nutrient solution with a concentration of 150 mM NaCl according to reference example 1, the salt-containing nutrient solution was replaced every three days, the treatment was performed for 7 days, and then complete rice nutrient solution was used for recovery treatment for 14 days, and the survival rate was recorded, and the fresh weight and dry weight were recorded.

[0076] After 7 days of salt treatment, it was found that the mutant scl25 had more wilted leaves and grew worse than the wild type, and the survival rate of the wild type was close to 60% after 14 days of normal treatment recovery, which was significantly higher than that of scl25 (Table 3, A and B). Figure 5 The fresh weight and dry weight of the wild type, mutant and overexpression line had no obvious difference before salt treatment, and the fresh weight and dry weight of scl25 were significantly lower than those of the wild type after salt treatment (Table 4, C and D). Figure 5 Compared with the wild type, the overexpression line of OsSCL25 grew better than the wild type, had significantly fewer wilted leaves than the wild type and the mutant, and the survival rate reached 70% after 14 days of normal treatment recovery, which was slightly higher than that of the wild type and 3 times that of scl25 (Table 3, A and B). Figure 5 These results show that OsSCL25 has a positive effect on the regulation of salt tolerance in rice seedlings.

[0077] Table 3 Survival rate data of the wild type, OsSCL25 gene editing line and overexpression line

[0078] WT scl25#1 scl25#2 OE#1 OE#2 50% 14% 14% 64% 71% 57% 21% 21% 71% 57% 57% 28% 35% 71% 71%

[0079] Table 4 Determination data of fresh weight and dry weight of each line

[0080]

[0081] (2) Analysis of salt stress physiological indicators of OsSCL25 gene mutant and overexpression line

[0082] To further verify that OsSCL25 positively regulates salt tolerance in rice seedlings, leaf samples of the control group and wild type, OsSCL25 mutant and overexpression lines that did not recover after treatment with 150 mM NaCl were subjected to NBT, DAB (Meng F, Feng N, Zheng D, Liu M, Zhou H, Zhang R, Huang X, Huang A. Exogenous Hemin enhances the antioxidant defense system of rice by regulating the AsA-GSH cycle under NaCl stress. PeerJ. 2024 Apr 19;12:e17219. doi: 10.7717 / peerj.17219. PMID: 38650645; PMCID: PMC11034499.) staining to observe the accumulation of reactive oxygen species in different lines after salt treatment. At the same time, the chlorophyll content, soluble sugar content, proline content, SOD enzyme activity, POD enzyme activity, CAT enzyme activity, MDA content, and hydrogen peroxide content were measured (Luo C, Akhtar M, Min W, Alam Y, Ma T, Shi Y, She Y, Lu X. The suppressed expression of a stress responsive gene 'OsDSR2' enhances rice tolerance in drought and salt stress. J Plant Physiol. 2023 Mar;282:153927. doi: 10.1016 / j.jplph.2023.153927. Epub 2023 Jan 19. PMID: 36682133.).

[0083] Before salt stress treatment, there was no significant difference in leaf NBT and DAB staining between wild type, mutant, and overexpression lines. After salt stress, more blue-black spots and brown spots were attached to the mutant leaf surface, and the mutant scl25#1 leaf showed a larger area of blue-black spot coverage after NBT staining (Fig. 2A), and the mutant scl25#1 leaf also showed more brown spots after DAB staining (Fig. 2B). The overexpression line had fewer spots on the leaf surface after salt treatment (Fig. 2B), and there was no significant difference between the overexpression line and the wild type, indicating that the mutant leaf accumulated more hydrogen peroxide and superoxide anion than the wild type and overexpression line. The results showed that compared with the wild type, the OsSCL25 mutant leaf accumulated more ROS under salt stress, while the overexpression line was the opposite. Figure 6 Figure 6 Before salt stress treatment, there was no significant difference in leaf NBT and DAB staining between wild type, mutant, and overexpression lines. After salt stress, more blue-black spots and brown spots were attached to the mutant leaf surface, and the mutant scl25#1 leaf showed a larger area of blue-black spot coverage after NBT staining (Fig. 2A), and the mutant scl25#1 leaf also showed more brown spots after DAB staining (Fig. 2B). The overexpression line had fewer spots on the leaf surface after salt treatment (Fig. 2B), and there was no significant difference between the overexpression line and the wild type, indicating that the mutant leaf accumulated more hydrogen peroxide and superoxide anion than the wild type and overexpression line. The results showed that compared with the wild type, the OsSCL25 mutant leaf accumulated more ROS under salt stress, while the overexpression line was the opposite.​

[0084] Superoxide dismutase (SOD) is the most important free radical scavenger in plants, and its activity determines whether the plant's metabolism remains in balance. After salt stress, the SOD activity of the mutant scl25 was about 20% higher than that of the wild type, while the SOD activity of the overexpression line was not significantly different from that of the wild type. Figure 7 According to Table A and Table 5, NBT staining revealed that the mutant scl25 accumulated more superoxide anions, suggesting that the mutant accumulated more SOD activity to adapt to salt stress. POD is an important peroxidase that catalyzes reactions based on peroxides and hydrolyzes hydrogen peroxide, thereby protecting cells. After salt stress, the POD activity of the mutant scl25 was about 10% higher than that of the wild type. Figure 7 (See Tables B and 5). DAB staining revealed that the mutant scl25 accumulated more hydrogen peroxide, suggesting that the mutant generated more POD to eliminate the excessive accumulation of hydrogen peroxide caused by salt stress. CAT is the best antioxidant enzyme in plants, breaking down excess hydrogen peroxide into water and oxygen, thus preventing oxidative stress and reducing the production of highly toxic hydroxyl radicals. After salt stress, the CAT activity of the mutant scl25 was about 10% higher than that of the wild type, and the overexpression line was significantly lower than that of the wild type. Figure 7 (See Tables E and 5); the presence of MDA indicates excessively high levels of intracellular free radicals, whose excessive accumulation can lead to damage to plant cell membranes, affecting cellular physiological functions, and ultimately causing cell senescence and death. After salt stress, the MDA content of the mutant scl25 was significantly higher than that of the wild-type and overexpression lines, with the MDA content of the mutant scl25 being nearly twice that of the overexpression line (see Tables E and 5). Figure 7 (See Tables F and 6) indicating that the mutant scl25 suffered greater tissue oxidative damage than the wild-type and overexpression lines, accumulating more cytotoxicity, while the overexpression lines showed no significant difference from the wild-type. Hydrogen peroxide is a product of aerobic metabolism in plants, but at high concentrations it inhibits plant growth, causes oxidative damage to cells, and leads to cell death. Compared to the wild-type, the salt-treated mutant scl25 accumulated more hydrogen peroxide, approximately 33% higher, while the hydrogen peroxide content in the overexpression lines was slightly lower than that in the wild-type. Figure 7 (See Tables C and 6) to show that the mutant scl25 accumulated more reactive oxygen species, and the overexpression line grew better under salt conditions than the mutant scl25.

[0085] Chlorophyll content indicates the efficiency of photosynthesis in leaves. Abiotic stress inhibits photosynthesis, thus affecting chlorophyll content. Chlorophyll also plays a crucial role in plant stress resistance. There were no significant differences in chlorophyll content among the wild-type, OsSCL25 mutant, and overexpression line under normal treatment. After salt stress, the chlorophyll content of the SCL25 mutant was significantly lower than that of the wild-type, while the chlorophyll content of the OsSCL25 overexpression line was significantly higher than that of the wild-type. Figure 7 (See Tables D and 5). The chlorophyll content of the overexpression line was nearly twice that of the mutant, further indicating that the overexpression line had stronger salt tolerance than the mutant SCL25. Proline accumulation is an important metabolic adaptation mechanism in plants under biotic and abiotic stresses. Its main function is to act as an osmotic regulator, maintaining osmotic balance inside and outside the cell and enhancing plant stress resistance. When plants encounter biotic and abiotic stresses, they promote the formation of proline metabolic adaptation mechanisms, thereby acting as osmotic regulators to maintain osmotic balance inside and outside the cell and enhance plant stress resistance. There was no significant difference in proline content among the wild type, OsSCL25 mutant, and overexpression line under normal treatment. After salt stress, the proline content of the OsSCL25 overexpression line was significantly higher than that of the wild type (see Tables D and 5). Figure 7 (See Tables G and 6). The proline content of the overexpression line was nearly twice that of the mutant, while the proline content of the mutant scl25 was significantly lower than that of the wild type. This indicates that the stronger growth of the overexpression line under salt stress compared to the mutant is due to its stronger free radical scavenging ability. Soluble sugars are not only a source of energy for plant growth and development, but also provide a large amount of energy in regulating ion absorption and transport to adapt to biotic and abiotic stresses, playing an important role in regulating osmotic pressure. After salt stress, the increase in soluble sugar content in the mutant scl25 was lower than that in the wild type and the overexpression line. The soluble sugar content of the overexpression line was slightly higher than that of the wild type and significantly higher than that of the mutant. ​ The results (see Table 6) indicate that the overexpression line has a stronger ability to balance reactive oxygen species and enhance the antioxidant capacity of plants than the wild type.

[0086] Table 5. Results of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) activity, and chlorophyll content detection.

[0087]

[0088] Table 6. Detection results of hydrogen peroxide content, malondialdehyde (MDA) content, proline content, and soluble sugar content.

[0089]

[0090]

[0091]

[0092] Therefore, the OsSCL25 gene mutant plants have decreased antioxidant capacity under salt stress, and overexpression of the OsSCL25 gene in Nipponbare rice plants can improve the salt tolerance of the rice plants.

[0093] Although the above embodiments have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which all belong to the protection scope of the present application.

Claims

1. The application of the OsSCL25 gene in regulating salt stress tolerance in rice, characterized by, The nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The regulation involves overexpressing the OsSCL25 gene in the target rice genome to improve the salt tolerance of rice.

3. A method for improving the salt tolerance of rice, characterized in that, The steps include: overexpressing the OsSCL25 gene in the target rice genome; The nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that, The CDS sequence of the OsSCL25 gene is shown in SEQ ID NO.

2.

5. The method according to claim 3, characterized in that, The overexpression method involves transforming the recombinant vector into rice to obtain rice with improved salt tolerance. The recombinant vector contains the OsSCL25 gene.

6. The method according to claim 5, characterized in that, The transformation method includes Agrobacterium-mediated transformation.

7. The method according to claim 5, characterized in that, The basic framework of the recombinant vector includes the pUN1301 vector.

8. A method for creating salt-tolerant rice germplasm, characterized in that, The method includes the following steps: overexpressing the OsSCL25 gene in the target rice genome; the nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO.

1.

9. The method according to claim 8, characterized in that, The rice variety mentioned includes Nipponbare.