RNA interference lentiviral vector based on CCDC3 gene and application of RNA interference lentiviral vector

Abstract

According to the present invention, the CCDC3 gene containing the coiled coil domain 3 (CCDC3) is related to the occurrence and the development of the breast cancer, and the CCDC3 gene containing the coiled coil domain 3 (CCDC3) is related to the occurrence and the development of the breast cancer; cCDC3 is a glycosylated secretory protein, is mainly expressed in vascular endothelial cells and mature adipocytes, has the function of regulating liver lipid metabolism, and plays a role in obesity and atherosclerosis processes in autosecretion, paracrine and endocrine modes. The recent research finds that compared with other tissues, the breast tissues have higher CCDC3mRNA expression, and the high-level CCDC3 in breast cancer patients is related to higher survival rate and lower recurrence rate. Further research finds that CCDC3 activates p53 in a positive feedback mode to inhibit growth of breast cancer cells. In order to further reveal the effect of the CCDC3 in breast cancer, in order to construct an RNAi lentiviral vector of the CCDC3 gene, breast cancer cells are infected in vitro, the CCDC3 gene in the cells is not expressed or is reduced in expression, and then the biological function of the cells is detected, so that the influence of the CCDC3 gene on the biological function of the breast cancer cells is analyzed.

Description

Technical Field

[0001] The present invention belongs to the field of CCDC3 gene application, and particularly relates to an RNA interference lentiviral vector based on the CCDC3 gene and an application thereof. Background Art

[0002] Coiled-coil domain containing 3 (CCDC3) gene is associated with the occurrence and development of breast cancer. CCDC3 is a glycosylated secretory protein, which is mainly expressed in vascular endothelial cells and mature adipocytes. It has the function of regulating liver lipid metabolism and plays a role in obesity and atherosclerosis in an autocrine, paracrine and endocrine manner. Recent studies have found that breast tissue has higher CCDC3 mRNA expression than other tissues, and high levels of CCDC3 are associated with higher survival rates and lower recurrence rates in breast cancer patients. Further studies have found that CCDC3 activates p53 in a positive feedback manner to inhibit the growth of breast cancer cells. There are still few related studies on CCDC3. In order to further reveal the role of CCDC3 in breast cancer, the present invention will construct an RNAi lentiviral vector for the CCDC3 gene, infect breast cancer cells in vitro, so that the CCDC3 gene in the cell is not expressed or reduced, and then detect the biological function of the cell to analyze the biological function of the CCDC3 gene on breast cancer cells. Summary of the invention

[0003] In order to solve the problems existing in the above-mentioned prior art, the object of the present invention is to provide an RNA interference lentiviral vector based on the CCDC3 gene and its application.

[0004] To achieve the above object, the technical solution of the present invention is:

[0005] The construction process of the RNA interference lentiviral vector based on the CCDC3 gene is as follows:

[0006] Step 1: Plasmid using GV248 vector

[0007] The strain was TOP10 Escherichia coli competent cells;

[0008] RNA interference target design and double-stranded DNA oligo preparation

[0009] Gene information

[0010]

[0011] Step 2: RNA interference target design

[0012] According to the RNAi sequence design principles and the CCDC3 gene as a template, multiple RNAi target sequences were designed for the target gene sequence, and the target with the best kinetic parameters was selected to enter the subsequent experimental process.

[0013]

[0014] Step 3: DNA oligo sequence synthesis

[0015] Design the shRNA interference sequence according to the selected target sequence, and add appropriate restriction endonuclease sites at both ends to complete the vector construction; in addition, add the TTTTT termination signal at the 3' end of the positive strand, and add the termination signal complementary sequence at the 5' end of the reverse strand;

[0016]

[0017]

[0018] *Ccgg: AgeI restriction site; AATTC: EcoRI restriction site; G: EcoRI restriction site complementary sequence;

[0019] Step 4: Preparation of double-stranded DNA oligo

[0020] Dissolve the synthesized single-stranded DNA oligo powder in annealing buffer (final concentration 20 μM) and incubate in a 90°C water bath for 15 min. After cooling to room temperature, a double-stranded DNA with sticky ends is formed.

[0021] Step 5: Connect the annealed product to the carrier

[0022] Use T4 DNA ligase to ligate the double-digested linearized vector and annealed double-stranded DNA at 16°C for 1-3 hours or overnight.

[0023] Reaction system:

[0024]

[0025] *Adjust according to the size of the carrier

[0026] Step 6: Conversion

[0027] Add 10 μL of the exchange reaction product to 100 μL of competent cells, flick the tube wall several times to mix, and place on ice for 30 minutes; heat shock at 42°C for 90 seconds, incubate in an ice-water bath for 2 minutes; add 500 μL of LB medium, place in a shaker at 37°C for 1 hour; take an appropriate amount of bacterial solution and evenly spread it on a plate containing the corresponding antibiotics, and invert and culture in a constant temperature incubator for 12-16 hours;

[0028] Step 7: Colony PCR Identification

[0029] Primers

[0030]

[0031] Prepare the reaction system, shake and mix, and centrifuge briefly; in the clean bench, use a sterile pipette tip to pick up a single colony and put it into 20 μL identification system, pipette and mix, and place it in a PCR instrument for reaction;

[0032] Furthermore, in step 7, in the PCR identification, the identification reaction system is:

[0033]

[0034] PCR reaction conditions:

[0035]

[0036] The annealing temperature is determined by the GC content of the primer or gene, and is generally set 5°C lower than the Tm of the primer. The extension time is determined by the length of the identified PCR product. The extension time of Taq Plus DNA polymerase is calculated at 1Kb / min.

[0037] Application of CCDC3 gene inhibitors as therapeutic drugs for breast cancer.

[0038] Furthermore, after the CCDC3 gene was interfered in human breast cancer cells MDA-MB-231 and HCC1937, the cell clone formation and cell proliferation function of breast cancer cells were inhibited, cell apoptosis was significantly enhanced, the number of cells in the S phase decreased, and the number of cells in the G1 phase increased.

[0039] Furthermore, the RNA interference lentiviral vector based on the CCDC3 gene is used as a drug for the treatment of breast cancer.

[0040] Compared with the prior art, the beneficial effects of the present invention are:

[0041] After the CCDC3 gene was interfered in human breast cancer cells MDA-MB-231 and HCC1937, the cell clone formation and cell proliferation function of breast cancer cells were inhibited, cell apoptosis was significantly enhanced, the number of cells in the S phase decreased, and the number of cells in the G1 phase increased.

[0042] The CCDC3 gene has the function of promoting the cloning and proliferation of breast cancer cells, inhibiting cell apoptosis, and affecting the cell cycle.

[0043] The present invention adopts lentiviral vector in vector construction, which is suitable for cells that are difficult to transfect, significantly improves the transduction efficiency of the target gene, can effectively integrate the exogenous gene into the host chromosome, and mediates the long-term and stable expression of the target gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is the experimental flow chart of the present invention;

[0045] Figure 2 .GV493 vector map;

[0046] Figure 3 The expression results of CCDC3 gene at the mRNA level in MDA-MB-231 and HCC1937 cells (KD1, KD2 and KD3 are knockdown vectors constructed for the three interference targets of CCDC3 gene respectively);

[0047] Figure 4 The results of the number of MDA-MB-231 and HCC1937 cell clones 3 days after shRNA lentivirus infection (upper figure: cell number observed under a microscope, lower figure: statistical results of cell clone number); after the CCDC3 gene was knocked down, the number of cell clones decreased.

[0048] Figure 5 The results of apoptosis ratio of MDA-MB-231 and HCC1937 cells 5 days after shRNA lentivirus infection (upper figure: original results of flow cytometry detection, lower figure: statistical results of cell apoptosis); after the CCDC3 gene was knocked down, the number of apoptotic cells increased.

[0049] Figure 6 The figure shows the proliferation rate of MDA-MB-231 and HCC1937 cells 5 days after shRNA lentivirus infection; after the CCDC3 gene was knocked down, the cell proliferation rate decreased.

[0050] Figure 7 The results of the cell cycle of MDA-MB-231 and HCC1937 cells 5 days after shRNA lentivirus infection. After the CCDC3 gene was knocked down, the cell cycle changed, the number of G1 phase cells of MDA-MB-231 cells decreased, and the number of S phase cells increased; the number of G1 phase and S phase cells of HCC1937 cells decreased, and the number of G2 / M phase cells increased. DETAILED DESCRIPTION

[0051] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments:

[0052] like Figure 1-7 As shown,

[0053] Test example:

[0054] 1. Functional testing experimental data

[0055] Using the CCDC3 gene as a template, the RNA interference target sequence was designed and the target gene RNA interference lentiviral vector was constructed.

[0056] Experimental Materials

[0057] 1. Experimental plasmid

[0058] This experiment uses the GV248 vector, the vector map is as follows Figure 2 .

[0059] 2. Experimental strains

[0060] TOP10 E. coli competent cells (TIANGEN, Cat.#CB104-03)

[0061] Experimental Materials

[0062] 3.1 Main Reagents

[0063]

[0064]

[0065] 3.2 Main instruments

[0066]

[0067] RNA interference target design and double-stranded DNA oligo preparation

[0068] Gene information

[0069]

[0070] 2. RNA interference target design

[0071] According to the RNAi sequence design principles and the CCDC3 gene as a template, multiple RNAi target sequences were designed for the target gene sequence, and the target with the best kinetic parameters was selected to enter the subsequent experimental process.

[0072]

[0073]

[0074] DNA oligo sequence synthesis

[0075] Design the shRNA interference sequence according to the selected target sequence, and add appropriate restriction endonuclease sites at both ends to complete the vector construction. In addition, add the TTTTT termination signal at the 3' end of the positive strand, and add the termination signal complementary sequence at the 5' end of the reverse strand.

[0076]

[0077] *Ccgg: AgeI restriction site; AATTC: EcoRI restriction site; G: EcoRI restriction site complementary sequence.

[0078] 4. Preparation of double-stranded DNA oligo

[0079] Dissolve the synthesized single-stranded DNA oligo powder in annealing buffer (final concentration 20 μM) and incubate in a 90°C water bath for 15 min. After cooling naturally to room temperature, a double-stranded DNA with sticky ends is formed.

[0080] 5. Connect the annealed product to the carrier

[0081] The double-digested linearized vector and annealed double-stranded DNA were ligated using T4 DNA ligase at 16°C for 1-3 hours, or overnight.

[0082] Reaction system:

[0083]

[0084] *Adjust according to the size of the carrier

[0085] 6. Conversion

[0086] Add 10 μL of the exchange reaction product to 100 μL of competent cells, flick the tube wall several times to mix, and place on ice for 30 minutes. Heat shock at 42°C for 90 seconds, and incubate in an ice-water bath for 2 minutes. Add 500 μL of LB medium and place in a 37°C shaker for 1 hour. Take an appropriate amount of bacterial solution and evenly spread it on a plate containing the corresponding antibiotics, and invert and culture it in a constant temperature incubator for 12-16 hours.

[0087] 7. Colony PCR Identification

[0088] 7.1 Primers

[0089]

[0090] 7.2 PCR Identification Prepare the following reaction system, shake and mix, and centrifuge briefly. In the clean bench, use a sterile pipette tip to pick up a single colony and add it to 20 μL of the identification system, pipette and mix, and place it in a PCR instrument for reaction.

[0091] Identification reaction system:

[0092]

[0093]

[0094] PCR reaction conditions:

[0095]

[0096] 1 The annealing temperature is determined according to the GC content of the primer or gene and is generally set 5°C lower than the Tm of the primer. 2 The extension time is determined based on the length of the PCR product to be identified. The extension time of Taq Plus DNA polymerase is calculated at 1 Kb / min.

[0097] 7.3 Identification results

[0098] Electrophoresis of PCR products

[0099] Sample Description:

[0100]

[0101] 1 The blank control uses ddH2O as a template to detect whether the identification system is contaminated.

[0102] 2 The negative control uses an empty vector without the target gene inserted as a template to prove that there is no false positive phenomenon during the amplification process.

[0103] After the RNA interference lentiviral vector was successfully constructed, RNAi lentiviral packaging was performed and then breast cancer cells MDA-MB-231 and HCC1937 were infected.

[0104] Steps of virus infection of cells:

[0105] Culture target cells with good growth status, design experimental conditions for each group according to the results of the preliminary experiment of lentivirus infection, and carry out formal infection. If it is a fluorescently labeled lentivirus infection, refer to the infection time point determined in the preliminary experiment, observe the GFP expression under a fluorescence microscope, and collect cells for downstream experiments when the fluorescence rate reaches about 80% and the cell confluence reaches about 80%.

[0106] qPCR detection of CCDC3 gene knockdown efficiency at mRNA level

[0107] 1. Experimental process: Total RNA was extracted from cells and reverse transcribed to obtain cDNA. Real-time PCR was used to detect the expression level of CCDC3 gene.

[0108] 2. PCR primer information:

[0109] Primer Information:

[0110] Internal reference gene Upstream primer sequence Downstream primer sequence Amplified fragment size (bp) ACTB GCGTGACATTAAGGAGAAGC CCACGTCACACTTCATGATGG 236 Target gene <![CDATA[upstream Primers sequence]]> <![CDATA[downstream Primers sequence]]> <![CDATA[ Amplification Fragment size (bp)]]> CCDC3 AGTCAATTTCCAAGATGCCA CGAGGAGCACATGAGCCTAC 157

[0111] RESULTS AND CONCLUSION: Three days after infection with shRNA lentivirus, the expression of CCDC3 gene at the mRNA level in MDA-MB-231 and HCC1937 cells in the experimental group was inhibited, indicating that the RNAi lentivirus had a significant effect.

[0112] Detection of the effect of CCDC3 gene knockdown on cell clone formation ability

[0113] 1. Experimental process:

[0114] (1) Preparation of infected cells: Digest the cells of each experimental group in the logarithmic growth phase with trypsin, resuspend them in complete medium to prepare a cell suspension, and count them.

[0115] (2) Cell inoculation: 400-1000 cells / well (determined according to cell growth conditions) were inoculated in each experimental group in a 6-well culture plate, and 3 replicate wells were set up for each experimental group.

[0116] (3) Continue to culture the inoculated cells in the incubator until 14 days or until the number of cells in most individual clones is greater than 50. Change the medium every 3 days and observe the cell status.

[0117] (4) Before terminating the experiment, the cell clones were photographed under a fluorescence microscope and the cells were washed once with PBS.

[0118] (5) Add 1 mL of 4% paraformaldehyde to each well and fix the cells for 30-60 min. Wash the cells once with PBS.

[0119] (6) Add 1000 μL of clean, impurity-free crystal violet stain to each well and stain the cells for 10-20 minutes.

[0120] (7) Wash the cells several times with ddH2O, dry them, take pictures with a digital camera, and count the colonies.

[0121] 3. Conclusion: 3 days after shRNA lentivirus infection, cells were plated in 6-well plates. The number of MDA-MB-231 plates was 1000. After 8 days, the number of clones was observed, and it was found that the number of MDA-MB-231 cell colonies in the experimental group decreased. The number of HCC1937 plates was 1000. After 11 days, the number of clones was observed, and it was found that the number of HCC1937 cell colonies in the experimental group decreased. This suggests that the CCDC3 gene is significantly correlated with the cloning ability of MDA-MB-231 and HCC1937 cells.

[0122] Effect of CCDC3 gene knockdown on apoptosis detected by FACS

[0123] 1. Experimental process:

[0124] (1) When the cells in each experimental group grow to a coverage rate of about 70% in the 6-well plate, drugs are used to induce apoptosis (whether drugs are added for induction is determined based on the customer's experimental design).

[0125] (2) If the cells are adherent, the cells in the supernatant also need to be collected. Digest with trypsin, resuspend in complete medium to form a cell suspension, and collect it in the same 5 mL centrifuge tube as the supernatant cells. Set up three replicate wells for each group (to ensure that the number of cells on the machine is sufficient, the number of cells should be ≥5×105 / treatment). If the cells are suspended, collect them directly.

[0126] (3) Centrifuge at 1300 rpm for 5 min, discard the supernatant, and wash the cell pellet with 4°C pre-cooled PBS.

[0127] (4) Wash the cell pellet once with 1× binding buffer and collect the cells by centrifugation at 1300 rpm for 3 min. (5) Resuspend the cell pellet with 200 μL 1× binding buffer.

[0128] (6) Add 10 μL Annexin V-APC for staining and incubate at room temperature in the dark for 10-15 min.

[0129] (7) Depending on the cell number, add 400-800 μL 1× binding buffer and test on the instrument.

[0130] (8) Result analysis

[0131] Conclusion: Five days after shRNA lentivirus infection, the number of apoptotic MDA-MB-231 and HCC1937 cells in the experimental group increased significantly, suggesting that the CCDC3 gene is significantly associated with the apoptosis of MDA-MB-231 and HCC1937 cells.

[0132] Effect of CCDC3 gene knockdown on cell proliferation detected by CCK-8

[0133] 1. Experimental process:

[0134] 1) After trypsin digestion of cells in each experimental group in the logarithmic growth phase, resuspend them in complete culture medium to form a cell suspension and count them.

[0136] 2) Determine the cell density for plating according to the cell growth rate (mostly 2000 cells / well), 100 μl per well, 3-5 wells per group, and the number of plates to be plated is determined according to the experimental design (e.g., if the test lasts 5 days, 5 96-well plates are used). After the cells are uniformly plated and completely settled, observe the cell density of each experimental group under a microscope. If √)

[0137] If the density is uneven, fix one group and fine-tune the amount of cells in other groups and plate them again (for example, if it is found that there are more cells in the Con group, reduce the amount of cells and plate them again), and culture them in a cell culture incubator.

[0138] 4) Starting from the second day after plating, add 10 μL CCK-8 reagent to the wells 2 to 4 hours before the end of culture. No need to change the medium.

[0139] 5) After 4 hours, the 96-well plate was placed on an oscillator for 2-5 minutes and the OD value was detected by an ELISA reader at 450 nm.

[0140] 6) Data analysis.

[0141] Conclusion: After 3 days of shRNA lentivirus infection, cells were plated in 96-well plates with a plate number of 1500. After 5 consecutive days of detection, it was found that the proliferation rate of MDA-MB-231 cells and HCC1937 cells in the experimental group was significantly inhibited, suggesting that the CCDC3 gene is significantly correlated with the proliferation ability of MDA-MB-231 cells and HCC1937 cells.

[0142] PI-FACS detection of the effect of CCDC3 gene knockdown on cycle

[0143] 1. Experimental process:

[0144] (1) For adherent cells, when the cells in each experimental group grow to a coverage rate of about 80% in the 6 cm dish (the cells have not entered the growth plateau phase), trypsinize and resuspend in complete medium into a cell suspension. Collect the cells in a 5 mL centrifuge tube, with three replicate wells for each group (to ensure that there are enough cells on the machine, the number of cells should be ≥106 / treatment). If the cells are suspended, collect them directly.

[0145] (2) Centrifuge at 1300 rpm for 5 min, discard the supernatant, and wash the cell pellet once with 4°C pre-cooled DPBS (pH = 7.2-7.4).

[0146] (3) Centrifuge at 1300 rpm for 5 minutes

[0147] (4) Preparation of cell staining solution: 40×PI stock solution (2 mg / mL): 100×RNase stock solution (10 mg / mL): 1×DPBS: 25×Triton X-100 = 25:10:1000:40

[0148] (5) Cell staining: Depending on the cell quantity, add a certain volume of cell staining solution (0.6-1 mL) to resuspend the cells so that the cell throughput rate is 300-800 cells / s when placed on the machine.

[0149] (6) On-machine testing.

[0150] (7) Data analysis (using ModFit software for analysis).

[0151] 3. Experimental conclusion: 5 days after shRNA lentivirus infection, compared with the NC group, the number of cells in the S phase of MDA-MB-231 cells in the KD group decreased (P<0.05), the number of cells in the G1 phase increased (P<0.05), and the number of cells in the G2 / M phase did not change significantly (P>0.05). Compared with the NC group, the number of cells in the S and G1 phases of HCC1937 cells in the KD group decreased (P<0.05), and the number of cells in the G2 / M phase increased (P<0.05). This suggests that the CCDC3 gene is related to the cell cycle distribution of MDA-MB-231 and HCC1937 cells.

[0152] WB detection of the effect of CCDC3 gene knockdown on CCDC3 protein expression

[0153] 1. Experimental process:

[0154] 1. Total protein extraction

[0155] 1.1 Total cell protein extraction

[0156] (1) Receive cell samples and wash twice with PBS. Take an appropriate amount of RIPA lysis buffer and add PMSF within a few minutes before use to make the final concentration of PMSF 1mM. (Use RIPA lysis buffer, instruction link: http: / / www.beyotime.com / ripa-lysis-bufferm.htm)

[0157] (2) Add an appropriate amount of RIPA lysis buffer and lyse on ice for 10-15 min. Scrape the cells and transfer them to a new EP tube, then sonicate the cells (40W for 20 times, 1 s each time, 2s intervals).

[0158] (3) Centrifuge at 4°C and 12,000 g for 15 min and take the supernatant to determine the protein concentration using the BCA method (BCA Protein Assay Kit instruction manual link: http: / / www.beyotime.com / p0010s.htm)

[0159] (4) Add new lysis buffer to adjust the protein concentration of each sample to the same level, generally 2 μg / μL. Then add 1 / 5 volume of 6X lodding buffer and mix well. Boil in a metal bath at 100°C for 10 min, centrifuge briefly, and store at -80°C.

[0160] Save for later use.

[0161] 1.2 Total protein extraction from tissues

[0162] (1) Receive tissue samples and cut them into pieces on dry ice. Take an appropriate amount of RIPA lysis buffer and add it within a few minutes before use.

[0163] PMSF, make the final concentration of PMSF to 1mM. (Use RIPA lysis buffer, instruction link: http: / / www.beyotime.com / ripa-lysis-bufferm.htm)

[0164] (2) Add 150-250 μL of lysis buffer for every 20 mg of tissue and lyse on ice (if lysis is insufficient, add more lysis buffer; if a high-concentration protein sample is required, reduce the amount of lysis buffer).

[0165] (3) Homogenize with a homogenizer, and after sufficient lysis, centrifuge at 10,000-14,000 g for 3-5 min. Take the supernatant and determine the protein concentration by BCA method (BCA Protein Assay Kit Instruction Manual Link

[0166] http: / / www.beyotime.com / p0010s.htm)

[0167] (4) Add new lysis buffer to adjust the protein concentration of each sample to a consistent level, generally 2 μg / μL. Then add 1 / 5 volume of 6X lodding buffer and mix well. Boil in a metal bath at 100 degrees for 10 minutes, centrifuge briefly, and store at -809 for later use.

[0168] 2.SDS-PAGE

[0169] (1) Gel preparation: Gels of different concentrations are prepared according to the molecular weight of the target protein. The specific system is as follows

[0170]

[0171]

[0172]

[0173] 2. Experimental conclusion: A band was detected in MDA-MB-231 cells, but it was not possible to determine whether a band was detected at 36 kDa in HCC1937 cells.

[0174] Statistical analysis:

[0175] The bars represent the mean of three experiments, and the error bars indicate the standard deviation (SD).

[0176] ****, P<0.0001 compared with the target gene shRNA lentivirus-treated group.

[0177] ***, NC group compared with the target gene shRNA lentivirus treatment group, 0.0001 <P<0.001。

[0178] **, NC group compared with the target gene shRNA lentivirus treatment group, 0.001 <P<0.01。

[0179] *, NC group compared with the target gene shRNA lentivirus treatment group, 0.01 <P<0.05。

[0180] 2. Conclusion of the experiment

[0181] The above in vitro experiments confirmed that after the CCDC3 gene in human breast cancer cells MDA-MB-231 and HCC1937 was interfered, the cell clone formation and cell proliferation function of breast cancer cells were inhibited, cell apoptosis was significantly enhanced, the number of cells in the S phase decreased, and the number of cells in the G1 phase increased. The CCDC3 gene has the function of promoting breast cancer cell cloning and proliferation, inhibiting cell apoptosis, and affecting the cell cycle.

[0182] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that are not conceived through creative work should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope defined in the claims.

Claims

1. An RNA interference lentiviral vector based on the CCDC3 gene, characterized in that: The build process is as follows: Step 1: Plasmid using GV248 vector The strain was TOP10 Escherichia coli competent cells; RNA interference target design and double-stranded DNA oligo preparation Gene information Step 2: RNA interference target design According to the RNAi sequence design principles, multiple RNAi target sequences were designed using the CCDC3 gene as a template for the target gene sequence, and the target with the best kinetic parameters was selected to enter the subsequent experimental process; Step 3: DNA oligo sequence synthesis Design shRNA interference sequences according to the selected target sequences, and add appropriate restriction endonuclease sites at both ends to complete the vector construction; In addition, a TTTTT termination signal is added to the 3' end of the forward strand, and a termination signal complementary sequence is added to the 5' end of the reverse strand; *Ccgg: AgeI restriction site; AATTC: EcoRI restriction site; G: complementary sequence to EcoRI restriction site; Step 4: Preparation of double-stranded DNA oligo Dissolve the synthesized single-stranded DNA oligo powder in annealing buffer (final concentration 20 μM) and incubate in a 90°C water bath for 15 min. After cooling to room temperature, a double-stranded DNA with sticky ends is formed. Step 5: Connect the annealed product to the carrier Use T4 DNA ligase to ligate the double-digested linearized vector and annealed double-stranded DNA at 16°C for 1-3 hours or overnight. Reaction system: *Adjust according to the size of the carrier Step 6: Conversion Add 10 μL of the exchange reaction product to 100 μL of competent cells, flick the tube wall several times to mix, and place on ice for 30 minutes; heat shock at 42°C for 90 seconds, incubate in an ice-water bath for 2 minutes; add 500 μL of LB medium, place in a shaker at 37°C for 1 hour; take an appropriate amount of bacterial solution and evenly spread it on a plate containing the corresponding antibiotics, and invert and culture in a constant temperature incubator for 12-16 hours; Step 7: Colony PCR Identification Primers Prepare the reaction system, vortex to mix, and centrifuge briefly; in the clean bench, use a sterile pipette tip to pick up a single colony and put it into 20 μL identification system, pipette to mix, and place it in a PCR instrument for reaction.

2. The lentiviral vector according to claim 1, characterized in that In the step 7, in the PCR identification, the identification reaction system is: PCR reaction conditions: The annealing temperature is determined according to the GC content of the primer or gene, and is generally set 5°C lower than the Tm of the primer; the extension time is determined according to the length of the identified PCR product; The extension time of Taq Plus DNA polymerase is calculated based on 1 Kb / min.

3. Application of CCDC3 gene inhibitors as therapeutic drugs for breast cancer.

4. The use according to claim 3, characterized in that: After the CCDC3 gene was interfered in human breast cancer cells MDA-MB-231 and HCC1937, the cell clone formation and cell proliferation function of breast cancer cells were inhibited, cell apoptosis was significantly enhanced, the number of cells in the S phase decreased, and the number of cells in the G1 phase increased.

5. Use of the CCDC3 gene-based RNA interference lentiviral vector according to claim 1 or 2 as a drug for treating breast cancer.

Images