Application of primer for detecting anti-disease gene of Eriocheir sinensis in identification of parent disease resistance of Eriocheir sinensis

Abstract

The application of the primer for detecting the anti-disease gene of the Eriocheir sinensis in identifying the disease resistance of the parent of the Eriocheir sinensis comprises the following steps: (1) respectively extracting RNA (Ribonucleic Acid) of the Eriocheir sinensis, and carrying out reverse transcription to obtain cDNA (Complementary Deoxyribonucleic Acid) of the Eriocheir sinensis; (2) designing a primer combination according to the sequence of the lysozyme gene of the eriocheir sinensis and the sequence of the C-type lectin 4 gene, performing PCR amplification on the cDNA sample of the eriocheir sinensis by utilizing the primer combination to obtain a target fragment, and detecting and confirming that the target fragment is amplified by utilizing agarose gel electrophoresis; (3) obtaining a cDNA sequence by a first-generation sequencing means, carrying out sequence comparison, identifying SNP sites in gene coding regions of the lysozyme gene and the C-type lectin 4 gene, and analyzing the two genes and a combination thereof; and comparing the differences of the disease resistance of the genotypes, and screening to obtain the genotype with the strongest disease resistance and the combined marker primer thereof.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker screening application in aquaculture, and specifically relates to the application of a primer for detecting disease resistance gene of Chinese mitten crab in identifying disease resistance of Chinese mitten crab parents, which is of great significance in improving disease resistance and breeding efficiency of offspring crabs, increasing breeding output and income, etc. Background Art

[0002] The protection measures for the Chinese mitten crab seed industry are relatively weak, and the disorderly introduction of species and blind release of seedlings have led to the mixing and degradation of germplasm, which has seriously restricted the green development of the industry. At present, the breeding of Chinese mitten crab in China also has a series of problems such as low industrial concentration, low level of improved varieties and coverage, and unstable seed quality.

[0003] At present, the breeding method for new varieties of Chinese mitten crab is traditional selective breeding, which is difficult to avoid problems such as genetic drift and hybrid decline. However, the lack of understanding of the function of disease-resistant genes in river crabs and their regulatory mechanisms will inevitably limit the research progress of disease-resistant molecular breeding of river crabs and fail to meet the needs of the river crab industry for disease-resistant and high-yield varieties. With the continuous development of modern molecular biology and genetics, new approaches have been provided for the genetic breeding of Chinese mitten crabs. By constructing a disease-resistant Chinese mitten crab family, disease-resistant molecular marker-assisted breeding can be achieved at the whole genome level, and molecular markers associated with disease-resistant traits can be mined, thereby selecting new varieties of disease-resistant Chinese mitten crabs.

[0004] Therefore, the research focuses on discovering disease-resistance-related genes and developing related molecular markers, realizing disease-resistance molecular marker-assisted breeding at the whole genome level, and discovering molecular markers associated with disease-resistance traits, so that new breakthroughs can be made in the molecular marker-assisted breeding technology of Chinese mitten crab, and it runs through the entire process from breeding material selection and preservation, parent matching to new variety breeding. Summary of the invention

[0005] In response to the problems raised by the background technology, the present invention studies and designs a primer for detecting the disease resistance gene of Chinese mitten crab and uses it in identifying the disease resistance of Chinese mitten crab parents, which can improve the disease resistance and breeding efficiency of offspring crabs and increase aquaculture output and income.

[0006] The invention discloses an application of primers for detecting disease resistance genes of Chinese mitten crab in identifying disease resistance of Chinese mitten crab parents, wherein the genotype is a Lys-3-CTL 4-1 genotype in which a Lysozyme gene and a C-type lectin 4 gene act together, specifically, the bases at positions 38, 47, 169, 251 and 311 of the Lysozyme gene are A, T, G, T and A in sequence, and the bases at positions 100, 108, 139 and 169 of the C-type lectin 4 gene are T, A, C and A in sequence, and the primers are: forward primer Lys-F: TACGTTTCAAGCGATGGATG, reverse primer Lys-R: TCACCGTGAGCTCGTTACAG, forward primer CTL4-F: GGCAGCAAGCAAGGAACTAC, reverse primer CTL4-R: 5'-CCAGTAGTCGGCGATCTCAT -3'; Using Chinese mitten crab DNA as a template, the above primers were used for amplification in the following PCR reaction system and conditions: PCR reaction system: 2×PCR Mix 10 μl, forward and reverse primers 1 μl each, Chinese mitten crab cDNA 2 μl, ddH2O 6 μl; PCR reaction conditions: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s; 50℃ annealing for 30s; 72℃ extension for 30s; after 35 cycles, 72℃ extension for another 10min; 4℃ storage; the product was stored at 4℃; The PCR products were sequenced and compared using Sequencher software, which showed that there were 4 SNP sites in the C-type lectin 4 gene, namely, the bases at the 100th, 108th, 139th and 169th positions of the gene were T, A, C and A, respectively; there were 5 SNP sites in the Lysozyme gene, namely, the bases at the 38th, 47th, 169th, 251st and 311th positions of the gene were A, T, G, T and A, respectively. Under the combined action of the C-type lectin 4 gene and the Lysozyme gene, the disease resistance of the genotype Lys-3-CTL4-1 was the best.

[0007] The present invention also provides a method for screening the SNP genotype of excellent disease resistance of Chinese mitten crab, which specifically comprises the following steps: (1) Extract hemolymph RNA from each individual Chinese mitten crab; (2) Reverse transcription was performed using the TAKARA reverse transcription kit to obtain cDNA; (3) PCR detection of cDNA samples from different Chinese mitten crab individuals; (4) Screening and obtaining SNP sites; (5) Inoculate Chinese mitten crab with the pathogen Aeromonas hydrophila and screen the disease resistance of different genotypes; The step (1) specifically comprises: extracting 400-450 μl of blood sample from the body of Chinese mitten crab using a 1 ml syringe, mixing the sample with ACD anticoagulant (whose formula is 0.48 g citric acid, 1.32 g sodium citrate, and 1.47 g glucose dissolved in 100 ml double distilled water) at a volume ratio of 1:1 to 400 μl, placing the sample in an EP tube and placing the tube on ice; centrifuging at 800×g, 4°C, for 20 min to separate blood cells; discarding the supernatant, retaining the white precipitate, adding 200 μl of pre-cooled Trizol reagent, grinding the sample with a grinder until the white precipitate disappears and the Trizol solution turns pink, and adding 800 μl of each sample again. Trizol reagent; let stand at room temperature for 5 minutes, then centrifuge at 4°C, 12000×g for 10 minutes; take 900μl of the supernatant and place it in a new EP tube, add 200μl of chloroform, mix thoroughly under oscillation conditions, do not vortex, shake back and forth for about 15s, and let stand at room temperature for 5 minutes; centrifuge at 4°C, 12000×g for 10 minutes; after centrifugation, the solution presents three layers, and carefully aspirate 400μl of the upper clear liquid with a gun tip placed below the liquid surface; add an equal amount of isopropanol to 400μl, mix gently, and let stand at room temperature for 5 minutes; centrifuge at 4°C, 12000×g for 15 minutes until a white precipitate is observed; remove the supernatant, do not aspirate the precipitate, if there is no precipitate and a small amount of solution is left, add 1ml of 75% ethanol prepared with DEPC water and resuspend; centrifuge at 4°C, 8000×g for 5 minutes, remove the supernatant; aspirate the solution and place the EP tube in a fume hood to dry for 2-5 minutes.

[0008] The step (2) is specifically as follows: 8 μl RNA solution, 2 μl 5×FastKing-RT SuperMix, and 10 μl ddH2O are mixed in a PCR tube, placed in a PCR instrument, and incubated at 42°C for 15 min, followed by 95°C for 3 min; The step (3) specifically comprises: using forward primer Lys-F, reverse primer Lys-R, forward primer CTL4-F and reverse primer CTL4-R to amplify the target fragment, using agarose gel electrophoresis to detect the integrity of the fragment, and the PCR conditions are: 95°C pre-denaturation for 5 minutes; 95°C denaturation for 30 seconds; 50°C annealing for 30 seconds; 72°C extension for 30 seconds; after 35 cycles, 72°C extension for another 10 minutes; 4°C storage; the product is stored at 4°C; The step (4) is specifically as follows: sending the PCR product to a sequencing company for sequencing, and using Sequencher software to compare the sequence differences of the disease resistance genes between individuals based on the specific sequence information returned by the sequencing company, and screening out SNP sites.

[0009] The step (5) is specifically as follows: selecting Chinese mitten crab as a sample, extracting 500 μl of hemolymph, extracting RNA, and then inoculating each Chinese mitten crab with the pathogen Aeromonas hydrophila. The specific inoculation steps are: using LB medium to culture Aeromonas hydrophila until the number reaches 10 8 / ml, take two ml of bacterial solution, use a centrifuge to centrifuge at 5000×g for 5 minutes, discard the supernatant, use 1ml ddH2O to resuspend the precipitate, and use a 1ml sterile syringe to slowly push 200μl of the resuspension into the 5th foot joint of each Chinese mitten crab. The genotypes of the C-type lectin 4 gene and the Lysozyme gene of each Chinese mitten crab inoculated with Aeromonas hydrophila are detected, and the genotypes are corresponded with the survival time. The differences in disease resistance of different genotypes are screened according to the survival time. Through induction and summary, the genotype combination with the strongest disease resistance is screened.

[0010] The beneficial effects of the invention are as follows: the invention provides a primer for detecting the disease resistance gene of Chinese mitten crab for seedling detection in Chinese mitten crab breeding and Chinese mitten crab aquaculture production, which can be used in identifying the disease resistance of Chinese mitten crab parents, and is of great significance in improving the disease resistance and breeding efficiency of offspring crabs, increasing aquaculture output and income, etc. The marker of the invention has high repeatability, a wide range of applications, is independent of genomic information, and can complete screening at the transcriptome level. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Agarose gel electrophoresis image of Lysozyme gene PCR amplification; Figure 2 Agarose gel electrophoresis image of PCR amplification of C-type lectin 4 gene; Figure 3 To analyze the disease resistance of different SNP genotypes of Lysozyme gene; Figure 4 This is an analysis of the disease resistance of different SNP genotypes of the C-type lectin4 gene. DETAILED DESCRIPTION

[0012] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0013] Example A method for screening SNP genotypes of excellent disease resistance of Chinese mitten crab, the method comprising the following steps: (1) Extract hemolymph RNA from each individual Chinese mitten crab, specifically: use a 1 ml syringe to extract 400-450 μl of blood sample from the Chinese mitten crab, and dissolve it in 100 ml of double distilled water with ACD anticoagulant at a volume ratio of 1:1. The formula is 0.48 g citric acid, 1.32 g sodium citrate, and 1.47 g glucose; mix to 400 μl, place in an EP tube, and place on ice; centrifuge at 800 × g, 4 ° C, for 20 min to separate blood cells; discard the supernatant, retain the white precipitate, add 200 μl of pre-cooled Trizol reagent, and grind it with a grinder until the white precipitate disappears and the Trizol solution turns pink. Add 800 μl of Trizol reagent to each sample again. agent; let stand at room temperature for 5 minutes, then centrifuge at 4°C, 12000×g for 10 minutes; take 900μl of the supernatant and place it in a new EP tube, add 200μl of chloroform, mix thoroughly under shaking conditions, do not vortex, shake back and forth for about 15s, and let stand at room temperature for 5 minutes; centrifuge at 4°C, 12000×g for 10 minutes; after centrifugation, the solution presents three layers, and carefully aspirate 400μl of the upper clear liquid with a gun tip placed below the liquid surface; add an equal amount of isopropanol to 400μl, mix gently, and let stand at room temperature for 5 minutes; centrifuge at 4°C, 12000×g for 15 minutes until a white precipitate is observed; remove the supernatant, do not aspirate the precipitate, if there is no precipitate and a small amount of solution is left, add 1ml of 75% ethanol prepared with DEPC water, and resuspend; centrifuge at 4°C, 8000×g for 5 minutes, remove the supernatant; aspirate the solution, and place the EP tube in a fume hood to dry for 2-5 minutes; (2) Use a reverse transcription kit to reverse transcribe cDNA. The specific steps are as follows: 8 μl RNA solution, 2 μl 5×FastKing-RT SuperMix, and 10 μl ddH2O are mixed in a PCR tube, placed in a PCR instrument, and incubated at 42°C for 15 min, followed by 95°C for 3 min; (3) Primer design: Based on transcriptome sequencing and gene data from the Chinese mitten crab genome database, the primers designed using Primer5 software were: Lys-F: TACGTTTCAAGCGATGGATG, Lys-R: TCACCGTGAGCTCGTTACAG; CTL4-F: GGCAGCAAGCAAGGAACTAC, CTL4-R: 5'- CCAGTAGTCGGCGATCTCAT -3'; (4) PCR detection was performed on cDNA samples of different Eriocheir sinensis individuals. The specific steps were as follows: forward primer Lys-F, reverse primer Lys-R, forward primer CTL4-F and reverse primer CTL4-R were used to amplify the target fragment, and the integrity of the fragment was detected by agarose gel electrophoresis; PCR conditions were: 95°C 30s; 95°C 5s, 60°C 34s, 40 cycles; 95°C 15s, 60°C 1min, 95°C 15s; the product was stored at 4°C; (5) Send the PCR product to a sequencing company for sequencing. Based on the specific sequence information returned by the sequencing company, use Sequencher software to compare the sequence differences of disease resistance genes between individuals and screen for SNP sites; (6) A total of 200 Chinese mitten crabs were tested, including 95 female Chinese mitten crabs and 105 male Chinese mitten crabs. The test determined that the disease resistance gene CTL 4 had 4 SNP sites and 2 genotypes. The test determined that the disease resistance gene Lysozyme had 5 SNP sites and 6 genotypes, of which 3 genotypes had extremely low gene frequencies and were therefore discarded. (7) 500 μl of hemolymph was extracted from 120 Chinese mitten crabs and RNA was extracted. Then, each Chinese mitten crab was inoculated with the pathogen Aeromonas hydrophila. The specific inoculation steps were as follows: LB medium was used to culture Aeromonas hydrophila until the number reached 10 8 / ml, take two ml of bacterial solution, centrifuge at 5000×g for 5 min, discard the supernatant, resuspend the precipitate with 1 ml ddH2O, and slowly push 200 μl of the resuspension solution into the fifth leg joint of each Chinese mitten crab using a 1 ml sterile syringe; (8) Mark each Chinese mitten crab after inoculation with Aeromonas hydrophila and record its death time; (9) The genotypes of the C-type lectin 4 gene and Lysozyme of each Chinese mitten crab inoculated with Aeromonas hydrophila were detected and matched with the survival time; the differences in disease resistance of different genotypes were screened according to the survival time; the genotype combination with the strongest disease resistance was screened through induction and summary; after analysis, it was concluded that under the combined action of the two genes Lysozyme and C-type lectin 4, the disease resistance of the genotype Lys-3- CTL 4-1 was the best, and the genotype of the Lys-3- CTL 4-1 was that the bases at the 38th, 47th, 169th, 251st and 311th positions of the Lys gene were A, T, G, T and A, respectively, and the bases at the 100th, 108th, 139th and 169th positions of the CTL 4 gene were T, A, C and A, respectively.

[0014] Figure 1The figure is agarose gel electrophoresis image of PCR amplification of the Lysozyme gene cloned in the present invention.

[0015] Figure 2 The figure is an agarose gel electrophoresis image of PCR amplification of the C-type lectin4 gene cloned in the present invention.

[0016] Figure 3 This is the correspondence between disease resistance and survival time of different SNP genotypes of the Lysozyme gene. The average survival time after inoculation of Aeromonas hydrophila in Chinese mitten crabs is between 24h and 48h. Therefore, with 24h to 48h as the boundary, survival time below 24h indicates poor disease resistance, and survival time above 48h indicates strong disease resistance. The results showed that in the Lysozyme gene, Chinese mitten crabs with genotypes Lys-3 and ATGTA have the highest proportion of survival time above 48h and the strongest disease resistance.

[0017] Figure 4 This is the correspondence between disease resistance and survival time of different SNP genotypes of C-type lectin4 gene. The average survival time after inoculation of Aeromonas hydrophila in Chinese mitten crab is between 24h and 48h. Therefore, with 24h to 48h as the boundary, survival time below 24h indicates poor disease resistance, and survival time above 48h indicates strong disease resistance. The results show that in the C-type lectin4 gene, Chinese mitten crabs with genotypes CTL 4-1, TACA have the highest proportion of survival time above 48h and the strongest disease resistance.

[0018] The present invention provides a primer for detecting disease-resistant genes of Chinese mitten crabs for seed detection in Chinese mitten crab breeding and Chinese mitten crab aquaculture production, which can be applied in identifying the disease resistance of Chinese mitten crab parents, and is of great significance in improving the disease resistance and breeding efficiency of offspring crabs, increasing aquaculture output and income, etc. The marker of the present invention has high repeatability, a wide range of applications, is independent of genomic information, and can complete screening at the transcriptome level.

Claims

1. Use of a primer for detecting a disease resistance gene of Chinese mitten crab in identifying the disease resistance of Chinese mitten crab parents, characterized in that: The gene is in the Lysozyme gene and the C-type lectin 4 gene. SNP site mining and disease resistance analysis are performed on the two genes. Under the joint action of the two genes, the genotype Lys-3-CTL4-1 has the best disease resistance effect. Specifically, the bases at the 38th, 47th, 169th, 251st and 311th positions of the Lysozyme gene are A, T, G, T and A, respectively, and the bases at the 100th, 108th, 139th and 169th positions of the C-type lectin 4 gene are T, A, C and A, respectively. The primers are: forward primer Lys-F: TACGTTTCAAGCGATGGATG, reverse primer Lys-R: TCACCGTGAGCTCGTTACAG, forward primer CTL4-F: GGCAGCAAGCAAGGAACTAC, reverse primer CTL4-R: 5'-CCAGTAGTCGGCGATCTCAT -3'; Using cDNA of different Chinese mitten crab individuals as template, amplification was performed using the above primers in the following PCR reaction system and conditions: PCR reaction system: 2×PCR Mix 10 μl, forward and reverse primers 1 μl each, Chinese mitten crab cDNA 2 μl, ddH2O 6 μl; PCR reaction conditions: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s; 50℃ annealing for 30s; 72℃ extension for 30s; after 35 cycles, 72℃ extension for another 10min; 4℃ storage; the product was stored at 4℃; The PCR products were sequenced and compared using Sequencher software, and it was determined that the C-type lectin 4 gene had four SNP sites, namely, the bases at the 100th, 108th, 139th, and 169th positions of the gene were T, A, C, and A, respectively; the Lysozyme gene had five SNP sites, namely, the bases at the 38th, 47th, 169th, 251st, and 311th positions of the gene were A, T, G, T, and A, respectively. Under the combined action of the C-typelectin 4 gene and the Lysozyme gene, the genotype Lys-3-CTL4-1 had the best disease resistance.

Images