Construction method of cDNA (complementary deoxyribonucleic acid) library for screening drought-resistant genes of black-heart golden chrysanthemum

Abstract

The invention belongs to the technical field of biotechnology, and particularly relates to a construction method of a cDNA (complementary deoxyribonucleic acid) library for screening drought-resistant genes of black-heart golden chrysanthemum. The method disclosed by the invention is scientific and reasonable in design, and the pYES2-NTB no-load transformation yeast strain INVSc1 is firstly used as a control group; secondly, transforming recipient bacteria INVSc1 by using the constructed black-heart golden chrysanthemum library, and preparing a yeast working bacteria solution; and then, screening by using SG-U liquid culture mediums with different concentrations of PEG 3350, after determining the screening concentration, coating the library working bacterial liquid on an SG-Ura plate for library positive clone identification, and sequencing the positive clone at the same time. Finally, rotation verification is carried out; according to the method, the drought-resistant gene of the black-heart golden chrysanthemum is determined through yeast screening, compared with the method that the drought-resistant gene of the black-heart golden chrysanthemum is identified after genetic transformation of species, the yeast screening period is short, the efficiency is high, and the species do not have a genetic transformation technology.

Description

Technical Field

[0001] The present invention belongs to the technical field of biotechnology, and particularly relates to a method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta. Background Art

[0002] Constructing a cDNA library capable of screening drought genes of Rudbeckia hirta has the following important significances: 1) Directly screening target genes: Constructing a cDNA library can directly isolate some regulatory genes in the process of life activities, especially genes under specific environmental conditions, such as genes related to drought stress. Through the cDNA library, genes in Rudbeckia hirta that respond to drought stress can be efficiently screened, which is of great significance for deeply analyzing the plant drought adaptation mechanism and improving the plant drought resistance ability. 2) Studying gene functions: The cDNA library is an important tool for discovering new genes and studying gene functions. By constructing the cDNA library of Rudbeckia hirta, the gene expression patterns, regulatory mechanisms and interaction relationships with other genes under drought stress can be further analyzed, so as to reveal the molecular basis of plant drought resistance. 3) Facilitating operation and screening: cDNA usually does not contain introns, which makes its length relatively short and facilitates subsequent operations and analyses. At the same time, constructing a cDNA library can greatly reduce the workload of screening target genes and improve the screening efficiency. In addition, since the cDNA library directly reflects the transcription level of mRNA, the coding region can be directly found, the amino acid sequence can be inferred, and the properties and functions of proteins can be analyzed. In the field of plant drought-resistant genetic engineering, the screened drought stress-related genes can be introduced into other plants through genetic engineering techniques, so as to cultivate new varieties with excellent drought resistance.

[0003] In the prior art, there is no cDNA library for screening drought-tolerant genes of Rudbeckia hirta. Therefore, the inventor expects to provide a method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta. Summary of the Invention

[0004] The purpose of the present invention is to overcome the above problems existing in the traditional technology and provide a method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta.

[0005] To achieve the above technical purposes and reach the above technical effects, the present invention is realized through the following technical solutions:

[0006] The present invention provides a method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta, comprising the following steps:

[0007] S1. Transforming the recipient bacterium INVSc1 with the empty plasmid;

[0008] S2. Transforming the Rudbeckia hirta library into the recipient bacterium INVSc1;

[0009] S3. Preparation of yeast working bacterial solution;

[0010] S4. Screening of PEG 3350 concentration;

[0011] S5. Identification of positive clones in the library;

[0012] S6. Retrograde verification.

[0013] Furthermore, in step S1, the transformation of the empty plasmid into the recipient bacterium INVSc1 includes yeast transformation reaction, yeast transformation method, and PCR verification of control positive clones;

[0014] Among them, the yeast transformation reaction is to transfer the plasmid to be transformed into INVSc1 respectively.

[0015] Furthermore, the specific sub-steps of the yeast transformation method are as follows:

[0016] 1) Pick a single colony of INVSc1 from the YPDA plate and inoculate it into 4 ml of YPDA liquid medium, incubate at 30 °C, 225 rpm, and shake culture for 18 - 20 h until OD 600 > 1.5;

[0017] 2) Transfer to YPDA liquid medium, with a culture volume of 50 ml, so that the initial OD 600 = 0.2, incubate at 30 °C, 225 rpm, and shake culture for 4 - 5 h until OD 600 = 0.6;

[0018] 3) Centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min;

[0019] 4) Resuspend the bacterial cells with 20 ml of sterile water, mix well, centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0020] 5) Resuspend the bacterial cells with 5 ml of 0.1 M LiAc, mix well, centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0021] 6) Resuspend the bacterial cells with 500 ul of 0.1 M LiAc, mix well, aliquot into 1.5 ml centrifuge tubes, and allocate 50 ul for each transformation, for standby;

[0022] 7) Add reagents to each 1.5 ml centrifuge tube in turn, pipette and mix well with a pipette tip, or shake vigorously for about 1 min until completely mixed;

[0023] 8) Incubate in a 30 °C water bath for 30 min;

[0024] 9) Heat shock in a 42 °C water bath for 25 min;

[0025] 10) Resuscitate in a 30°C water bath for 30 min;

[0026] 11) Centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0027] 12) Suspend the bacterial cells with 200 μl of sterile water for each transformation, mix gently as much as possible, and spread on the corresponding defective SD-Ura screening plate;

[0028] 13) Incubate at 30°C for 4 days.

[0029] Furthermore, for the control positive clone PCR, randomly pick 8 spots from the transformed SD-Ura plate for PCR verification. If the verification is correct, it is used for yeast phenotype verification; the specific steps are as follows:

[0030] 1) Pipette 3 - 3.5 μl of Yeast lysis buffer into a PCR tube, and dip an appropriate amount of yeast cells into the PCR tube with a sterile pipette tip or toothpick;

[0031] 2) After pipetting and mixing, place it in a 98°C reaction for 10 - 20 min;

[0032] 3) Prepare another sterile PCR tube and prepare the reaction system.

[0033] Furthermore, in step S2, the specific steps for the transformation recipient bacterium INVSc1 of the Rudbeckia hirta library are as follows:

[0034] 1) Pick a single colony of INVSc1 from the YPDA plate and inoculate it into 50 ml of YPDA liquid medium, incubate at 30°C, 225 rpm, for 18 - 20 h until OD 600 > 1.5;

[0035] 2) Transfer it to 500 ml of YPDA liquid to make the initial OD 600 = 0.2, incubate at 30°C, 225 rpm, for 4 - 5 h until OD 600 = 0.6;

[0036] 3) Centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min;

[0037] 4) Resuspend the bacterial cells with 30 ml of sterile water, mix well, centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0038] 5) Resuspend the bacterial cells with 20 ml of 0.1 M LiAc, mix well, centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0039] 6) Resuspend the cells with 10 ml of 0.1 M LiAc, mix well, centrifuge to collect the cells at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0040] 7) Add the reagents to the centrifuge tube in sequence, pipette to mix well, or shake vigorously until completely mixed;

[0041] 8) Incubate in a 30 °C water bath for 30 min;

[0042] 9) Heat shock in a 42 °C water bath for 25 min;

[0043] 10) Resuscitate in a 30 °C water bath for 1 h;

[0044] 11) Centrifuge to collect the cells at room temperature, 4000 rpm, for 5 min, discard the supernatant, resuspend the cells with 6 ml of sterile water, take 100 μl of the original solution and dilute it by 10 -2 、10 -3 、10 -4 , coat on a 90 mm SD-U plate, and coat the remaining on a 150 mm SD-U plate, 300 μl / plate;

[0045] 12) Incubate at 30 °C for 3 - 7 days and observe the colony growth.

[0046] Furthermore, in step S3, to identify the quality of the library, 24 clones were randomly selected for PCR verification; the specific steps are as follows:

[0047] 1) Pipette 3 - 3.5 μl of Yeast lysis buffer into a PCR tube, and dip an appropriate amount of yeast into the PCR tube with a sterile pipette tip or toothpick;

[0048] 2) Mix well by pipetting and stirring, and place in a 98 °C reaction for 10 - 20 min;

[0049] 3) Prepare another sterile PCR tube and prepare the reaction system.

[0050] Furthermore, in step S3, scrape all the clones on the plate with 2×YPDA liquid; take 100 μl of the original solution and dilute it with ddH2O by 10 -2 、10 -3 、10 -4 、10 -5 , take 100 ul of the diluted solution and coat it on a 90 mm SD-Ura plate.

[0051] Furthermore, in step S4, the specific steps for PEG 3350 concentration screening are as follows:

[0052] 1) preparing a series of SG-U (galactose substituted glucose) liquid culture media containing 0 mM, 30 mM, 60 mM, 90 mM, 100 mM, 110 mM, 120 mM, 130 mM, 135 mM, and 140 mM PEG 3350;

[0053] 2) Take the working bacterial solution and the empty control strain, shake the bacteria for 24 hours to confirm the growth, and then dilute the bacterial solution OD = 0.2 with ddH2O 10 -2 , 10 -3 , 10 -4 , take 10uL of the dilution solution and spot it on the SG-Ura plate, place it in an incubator at 30℃ and culture for 3 to 5 days, observe the growth of the colonies, and determine the PEG 3350 concentration screening conditions.

[0054] Furthermore, in step S5, the specific sub-steps of identifying the positive clones in the library are as follows:

[0055] 1) Treat the library working bacterial solution in 120mM PEG3350 liquid for 24h, take 300uL and coat 150mmSG-Ura plates, a total of 20 plates;

[0056] 2) After the clones grow out, 96 clones are randomly selected for colony PCR and cultured on SG-Ura plates;

[0057] Pipette 3-3.5 μl Yeast lysis buffer into the PCR tube, and use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube;

[0058] After mixing by pipetting, place at 98℃ for 10-20 minutes;

[0059] Prepare another sterile PCR tube and prepare the reaction system;

[0060] 3) The bands identified by colony PCR were sent for testing, and after the sequencing results were returned, they were compared using BLAST from the NCBI database.

[0061] Furthermore, in step S6, the positive clone transformants grown by streaking the monoclonal clone on the SG-Ura-deficient plate were resuspended in SG-Ura liquid and SG-Ura+120mM PEG3350, respectively. After treatment for 24 hours, 10uL was spotted on the SG-Ura-deficient plate and cultured at 30°C for 3 to 4 days.

[0062] The beneficial effects of the present invention are:

[0063] The method of the present invention is scientifically and reasonably designed. First, the pYES2-NTB empty vector is transformed into the yeast strain INVSc1 as a control group. Secondly, the previously constructed Rudbeckia hirta library is transformed into the recipient bacterium INVSc1 to prepare a yeast working bacterial solution. Then, screening is carried out using SG-U liquid medium with different concentrations of PEG 3350. After determining the screening concentration, the library working bacterial solution is spread on the SG-Ura plate for library positive clone identification, and at the same time, the positive clones are sequenced. Finally, a reverse verification is carried out; the present invention determines the drought-tolerant genes of Rudbeckia hirta through yeast screening. Compared with identifying the drought-tolerant genes after species genetic transformation, the yeast screening has a short cycle and high efficiency, and there is no genetic transformation technology for this species.

[0064] Of course, it is not necessary for any product implementing the present invention to achieve all of the above advantages simultaneously. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0066] Figure 1 It is a schematic diagram of the results of colony PCR for control;

[0067] Figure 2 It is a schematic diagram of library quality identification;

[0068] Figure 3 It is a schematic diagram of yeast colony counting;

[0069] Figure 4 It is a schematic diagram of the results of drought concentration screening;

[0070] Figure 5 It is a schematic diagram of the results of reverse verification. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0071] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the drawings in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0072] This embodiment provides a method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta, including the following steps:

[0073] S1. Transform the recipient bacterium INVSc1 with the empty plasmid;

[0074] S2. Transform the Rudbeckia hirta library into the recipient bacterium INVSc1;

[0075] S3. Prepare the yeast working bacterial solution;

[0076] S4. Screen for the concentration of PEG 3350;

[0077] S5. Identify the positive clones in the library;

[0078] S6. Perform the reversion verification.

[0079] In step S1, transforming the recipient bacterium INVSc1 with the empty plasmid includes yeast transformation reaction, yeast transformation method, and PCR verification of the control positive clone;

[0080] Among them, the yeast transformation reaction is to transfer the plasmid to be transformed into INVSc1 respectively, as shown in Table 1:

[0081] Table 1

[0082] Reaction plasmid Transformation plate Remarks 1 pYES2-NTB SD-U Control group

[0083] The specific sub-steps of the yeast transformation method are as follows:

[0084] 1) Pick a single colony of INVSc1 from the YPDA plate and inoculate it into 4 ml of YPDA liquid medium, culture at 30 °C, 225 rpm, and shake culture for 18 - 20 h until OD 600 > 1.5;

[0085] 2) Transfer to the YPDA liquid medium, with a culture volume of 50 ml, so that the initial OD 600 = 0.2, culture at 30 °C, 225 rpm, and shake culture for 4 - 5 h until OD 600 = 0.6;

[0086] 3) Centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min;

[0087] 4) Resuspend the bacterial cells with 20 ml of sterile water, mix well, centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0088] 5) Resuspend the bacterial cells with 5 ml of 0.1 M LiAc, mix well, centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0089] 6) Resuspend the bacterial cells with 500 μl of 0.1 M LiAc, mix well, aliquot into 1.5 ml centrifuge tubes, and allocate 50 μl for each transformation, and set aside;

[0090] 7) Add the following reagents successively to each 1.5 ml centrifuge tube according to Table 2, pipette to mix well, or shake vigorously for about 1 min until completely mixed;

[0091] Table 2

[0092] 50% PEG3350 1M LiAc ssDNA(10mg / ml) Plasmid DNA 240ul 36ul 5ul 5ul

[0093] 8) Incubate in a 30 °C water bath for 30 min;

[0094] 9) Heat shock in a 42 °C water bath for 25 min;

[0095] 10) Resuscitate in a 30 °C water bath for 30 min;

[0096] 11) Centrifuge to collect the bacteria, at room temperature, 4000 rpm, for 5 min, discard the supernatant;

[0097] 12) Suspend the cells with 200 μl of sterile water for each transformation, mix gently as much as possible, and spread on the corresponding defective SD-Ura screening plate;

[0098] 13) Incubate at 30 °C for 4 days.

[0099] For the control positive clone PCR, randomly pick 8 spots from the transformed SD-Ura plate for PCR verification. If the verification is correct, it is used for yeast phenotype verification; the positive clone amplification uses a rapid amplification yeast positive clone kit (Yeast Colony Rapid Detection Kit, product number: RY8001) independently developed by Nanjing Ruiyuan Biotechnology Co., Ltd.

[0100] The specific steps are as follows:

[0101] 1) Pipette 3 - 3.5 μl of Yeast lysis buffer into a PCR tube, and dip an appropriate amount of yeast cells into the PCR tube with a sterile pipette tip or toothpick;

[0102] 2) After pipetting and stirring to mix well, place it in a 98 °C reaction for 10 - 20 min;

[0103] 3) Prepare another sterile PCR tube and prepare the reaction system according to Table 3;

[0104] Table 3

[0105] 2×Yeast PCR mix 25μl primer F*(10μM) 2μl primer R*(10μM) 2μl template* 1μl ddH2O to 50μl

[0106] Briefly centrifuge the reaction solution, mix well and pipette 1 μl as the template, which is the best;

[0107] F: CAGCTGTAATACGACTCACTATAGG

[0108] R: AGGGTTAGGGATAGGCTTACCTTCG

[0109] The PCR reaction conditions are shown in Table 4 as follows:

[0110] Table 4

[0111]

[0112]

[0113] The annealing temperature is adjusted according to the Tm value of the primer, generally set at Tm - 5°C;

[0114] The results are as Figure 1 shown.

[0115] In step S2, the specific sub - steps of transforming the receptor bacterium INVSc1 with the Rudbeckia hirta library are as follows:

[0116] 1) Pick a single colony of INVSc1 from the YPDA plate and inoculate it into 50 ml of YPDA liquid medium, culture it at 30°C, 225 rpm, with shaking for 18 - 20 h until OD 600 > 1.5;

[0117] 2) Transfer it to 500 ml of YPDA liquid to make the initial OD 600 = 0.2, culture it at 30°C, 225 rpm, with shaking for 4 - 5 h until OD 600 = 0.6;

[0118] 3) Centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min;

[0119] 4) Resuspend the bacterial cells with 30 ml of sterile water, mix well, centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0120] 5) Resuspend the bacterial cells with 20 ml of 0.1 M LiAc, mix well, centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0121] 6) Resuspend the bacterial cells with 10 ml of 0.1 M LiAc, mix well, centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min, and discard the supernatant;

[0122] 7) Add the following reagents to the centrifuge tube in sequence according to Table 5, mix well with a pipette tip or shake vigorously until completely mixed;

[0123] Table 5

[0124] 50% PEG3350 1M LiAc ssDNA(10mg / ml) Library plasmid DNA 9.6ml 1.44ml 300ul 25ug

[0125] 8) Incubate in a 30°C water bath for 30 min;

[0126] 9) Heat shock in a 42 °C water bath for 25 min;

[0127] 10) Resuscitate in a 30 °C water bath for 1 h;

[0128] 11) Centrifuge to collect bacteria, at room temperature, 4000 rpm, for 5 min, discard the supernatant, resuspend the bacteria with 6 ml of sterile water, take 100 μl of the original solution and dilute it by 10 -2 、10 -3 、10 -4 , spread on a 90 mm SD-U plate, and spread the remaining on a 150 mm SD-U plate, 300 μl / plate;

[0129] 12) Incubate at 30 °C for 3 - 7 days and observe colony growth.

[0130] In step S3, to identify the quality of the library, 24 clones were randomly selected for PCR verification; the positive clones were amplified using a rapid amplification yeast positive clone kit (Yeast Colony Rapid Detection Kit, product number: RY8001) independently developed by Nanjing Ruiyuan Biotechnology Co., Ltd.;

[0131] The specific steps are as follows:

[0132] 1) Pipette 3 - 3.5 μl of Yeast lysis buffer into a PCR tube, and use a sterile pipette tip or toothpick to pick up an appropriate amount of yeast into the PCR tube;

[0133] 2) Pipette and mix well, then place in a 98 °C reaction for 10 - 20 min;

[0134] 3) Prepare another sterile PCR tube and prepare the reaction system according to Table 6;

[0135] Table 6

[0136] 2×Yeast PCR mix 25μl primer F*(10μM) 2μl primer R*(10μM) 2μl template* 1μl ddH2O to 50μl

[0137] Briefly centrifuge the reaction solution in step 2, mix well and pipette 1 μl as the template, which is the best;

[0138] F: CAGCTGTAATACGACTCACTATAGG

[0139] R: AGGGTTAGGGATAGGCTTACCTTCG

[0140] The PCR reaction conditions are shown in Table 7:

[0141] Table 7

[0142]

[0143] The annealing temperature is adjusted according to the Tm value of the primer, generally set at Tm - 5°C;

[0144] The results are as Figure 2 shown: The band size meets the expectation, and the downstream experiment is continued.

[0145] In step S3, all the clones on the plate are scraped off with 2×YPDA liquid; 100 μl of the original solution is diluted 10 -2 , 10 -3 , 10 -4 , 10 -5 times with ddH2O, and 100 μl of the diluted solution is spread on a 90-mm SD-Ura plate;

[0146] The results are as Figure 3 shown: It is divided into 16 equal parts for counting;

[0147] Library titer CFU / ml = number of clones on the plate / volume spread (ml) × dilution factor = 227 × 16 / 0.1 × 10 4 = 3.536 × 10 8 ;

[0148] Library capacity CFU = titer × total volume = 3.536 × 10 8 × 1 = 3.536 × 10 8 .

[0149] In step S4, the specific sub-steps for PEG 3350 concentration screening are as follows:

[0150] 1) Prepare a series of SG-U (galactose substituted for glucose) liquid media containing 0 mM, 30 mM, 60 mM, 90 mM, 100 mM, 110 mM, 120 mM, 130 mM, 135 mM, 140 mM PEG 3350; Taking a total volume of 10 mL as an example, the specific preparation method is shown in Table 8:

[0151] Table 8

[0152] Concentration (mM) SG-Ura liquid (mL) 50% PEG350 liquid (mL) 0 10.0 0 30 7.97 2.03 60 5.94 4.06 90 3.90 6.1 100 3.22 6.78 110 2.54 7.46 120 1.95 8.05 130 1.28 8.72 135 0.95 9.05 140 0.61 9.39

[0153] 2) Take the working bacterial solution and the empty vector control strain, shake the bacteria for 24 h to determine growth, then adjust the bacterial solution OD = 0.2, and dilute it 10 -2 , 10 -3 , 10 -4 times with ddH2O. Take 10 μL of the diluted solution and spot it on the SG-Ura plate, place it in an incubator at 30°C for 3 - 5 d, observe the colony growth, and determine the PEG 3350 concentration screening conditions;

[0154] The drought concentration screening results are asFigure 4 As shown in the figure. It can be seen from the figure that the experimental group can still grow under the condition of SG-U + 120 mM PEG 3350, while the control group cannot grow.

[0155] Conclusion: Select 120 mM PEG 3350 as the library screening condition.

[0156] In step S5, the specific sub-steps for identifying positive clones in the library are as follows:

[0157] 1) Treat the library working bacterial solution in 120 mM PEG3350 liquid for 24 h, take 300 μL and spread it on 150 mm SG-Ura plates, a total of 20 plates;

[0158] 2) After the clones grow, randomly pick 96 clones for colony PCR and preserve them on SG-Ura plates;

[0159] In order to identify what genes the selected positive clones are respectively. A rapid amplification yeast positive clone kit (Yeast Colony Rapid Detection Kit, product number: RY8001) independently developed by Nanjing Ruiyuan Biotechnology Co., Ltd. is used for amplifying positive clones.

[0160] Pipette 3 - 3.5 μl of Yeast lysis buffer into a PCR tube, and dip an appropriate amount of yeast cells into the PCR tube with a sterile pipette tip or toothpick.

[0161] After pipetting and mixing evenly, place it at 98 °C for reaction for 10 - 20 min;

[0162] Prepare another sterile PCR tube and prepare the reaction system according to Table 9;

[0163] Table 9

[0164] 2×Yeast PCR mix 25μl primer F*(10μM) 2μl primer R*(10μM) 2μl template* 1μl ddH2O to 50μl

[0165] Briefly centrifuge the reaction solution, mix well and pipette 1 μl as the template, which is the best;

[0166] F: CAGCTGTAATACGACTCACTATAGG

[0167] R: AGGGTTAGGGATAGGCTTACCTTCG

[0168] The PCR reaction conditions are shown in Table 10:

[0169] Table 10

[0170]

[0171]

[0172] The annealing temperature is adjusted according to the Tm value of the primer, generally set at Tm - 5°C;

[0173] 3) Send the bands identified by colony PCR for testing. After the sequencing results are returned, use BLAST alignment in the NCBI database. The specific alignment results are shown in Table 11:

[0174] Table 11

[0175]

[0176]

[0177]

[0178]

[0179]

[0180] In step S6, the positive clone transformants grown from the above 58 monoclonal colonies streaked on the SG-Ura defective plate were resuspended in SG-Ura liquid and SG-Ura + 120 mM PEG3350 respectively. After treatment for 24 h, 10 μL was taken and spotted on the SG-Ura defective plate, and incubated at 30°C for 3 - 4 days;

[0181] The results of the back-transformation verification are as Figure 5 shown:

[0182] The negative control can grow on SG-U and cannot grow on SG-U + 120 mM PEG 3350.

[0183] All 58 clones screened can grow on the SG-U and SG-U + 120 mM PEG 3350 plates.

[0184] The preferred embodiments of the present invention disclosed above are only used to help illustrate the present invention. The preferred embodiments do not describe all the details in detail, nor limit the invention to the specific embodiments. Obviously, many modifications and variations can be made according to the content of this specification. These embodiments are selected and specifically described in this specification to better explain the principle and practical application of the present invention, so that those skilled in the art can understand and utilize the present invention well. The present invention is only limited by the claims and their full scope and equivalents.

Claims

1. A method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta, characterized in that, It includes the following steps: S1. Transform the recipient bacterium INVSc1 with the empty plasmid; S2. Transform the Rudbeckia hirta library into the recipient bacterium INVSc1; S3. Prepare the yeast working bacterial solution; S4. Screen the concentration of PEG 3350; S5. Identify the positive clones of the library; S6. Perform the reverse verification.

2. The method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta, according to claim 1, is characterized in that, In step S1, transforming the recipient bacterium INVSc1 with the empty plasmid includes yeast transformation reaction, yeast transformation method, and PCR verification of the control positive clones; Among them, the yeast transformation reaction is to transfer the plasmid to be transformed into INVSc1 respectively.

3. The method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta L. according to claim 2, characterized in that, The specific sub-steps of the yeast transformation method are as follows: 1) Pick a single colony of INVSc1 from the YPDA plate and inoculate it into 4 ml of YPDA liquid medium. Incubate with shaking at 30 °C and 225 rpm for 18 - 20 h until OD 600 > 1.5; 2) Transfer the YPDA liquid medium with a culture volume of 50 ml to make the initial OD 600 = 0.2, culture at 30 °C with 225 rpm on a shaker for 4 - 5 h until OD 600 = 0.6; 3) Centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min; 4) Resuspend the bacterial cells with 20 ml of sterile water, mix well, centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min, and discard the supernatant; 5) Resuspend the bacterial cells with 5 ml of 0.1 M LiAc, mix well, centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min, and discard the supernatant; 6) Resuspend the bacterial cells with 500 μl of 0.1 M LiAc, mix well, aliquot into 1.5 ml centrifuge tubes, and allocate 50 μl for each transformation for standby; 7) Add reagents to each 1.5 ml centrifuge tube in sequence, pipette and mix well with a pipette tip, or shake vigorously for about 1 min until completely mixed; 8) Incubate in a 30°C water bath for 30 min; 9) Heat shock in a 42°C water bath for 25 min; 10) Resuscitate in a 30°C water bath for 30 min; 11) Centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min, and discard the supernatant; 12) Suspend the bacterial cells with 200 μl of sterile water for each transformation, mix gently as much as possible, and spread on the corresponding defective SD-Ura screening plate; 13) Incubate at 30°C for 4 days.

4. The method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta according to claim 3, wherein, The control positive clone PCR is to randomly pick 8 spots from the transformed SD-Ura plate for PCR verification. If the verification is correct, it is used for yeast phenotype verification. The specific sub-steps are as follows: 1) Pipette 3 - 3.5 μl of Yeast lysis buffer into the PCR tube, and dip an appropriate amount of yeast cells into the PCR tube with a sterile pipette tip or toothpick; 2) After pipetting and stirring to mix well, place it in a 98°C reaction for 10 - 20 min; 3) Prepare another sterile PCR tube and prepare the reaction system.

5. The method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta, according to claim 4, wherein In step S2, the specific sub-steps of transforming the Rudbeckia hirta library into the recipient bacterium INVSc1 are as follows: 1) Pick a single colony of INVSc1 from the YPDA plate and inoculate it into 50 ml of YPDA liquid medium. Incubate with shaking at 30 °C and 225 rpm for 18 - 20 h until OD 600 > 1.5; 2) Transfer to 500 ml of YPDA liquid to make the initial OD 600 = 0.2, incubate with shaking at 30 °C and 225 rpm for 4 - 5 h until OD 600 = 0.6; 3) Centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min; 4) Resuspend the bacterial cells with 30 ml of sterile water, mix well, centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min, and discard the supernatant; 5) Resuspend the bacterial cells with 20 ml of 0.1 M LiAc, mix well, centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min, and discard the supernatant; 6) Resuspend the bacterial cells with 10 ml of 0.1 M LiAc, mix well, centrifuge to collect the bacteria at room temperature, 4000 rpm, for 5 min, and discard the supernatant; 7) Add reagents to the centrifuge tube in sequence, pipette and mix well with a pipette tip, or shake vigorously until completely mixed; 8) Incubate in a 30°C water bath for 30 min; 9) Heat shock in a 42°C water bath for 25 min; 10) Resuscitate in a 30°C water bath for 1 h; 11) Centrifugally collect the bacteria at room temperature at 4000 rpm for 5 min. Discard the supernatant, resuspend the bacterial cells in 6 ml of sterile water, and take 100 μl of the original solution and dilute it by 10 -2 times, 10 -3 times, 10 -4 times. Spread them on 90-mm SD-U plates, and spread the remaining on 150-mm SD-U plates, 300 μl per plate; 12) Incubate at 30°C for 3 to 7 days and observe colony growth.

6. The method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta according to claim 5, wherein, In step S3, to identify the quality of the library, 24 clones were randomly picked for PCR verification; the specific steps are as follows: 1) Pipette 3 - 3.5 μl of Yeast lysis buffer into a PCR tube, and use a sterile pipette tip or toothpick to pick an appropriate amount of yeast into the PCR tube; 2) After pipetting and mixing well, incubate at 98°C for 10 - 20 min; 3) Prepare another sterile PCR tube and prepare the reaction system.

7. The method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta according to claim 6, characterized in that, In step S3, scrape all the clones on the plate with 2×YPDA liquid; take 100 μl of the original solution and dilute it 10 -2 , 10 -3 , 10 -4 , 10 -5 , and take 100 μl of the diluted solution and spread it on a 90-mm SD-Ura plate.

8. The construction method of the cDNA library for screening drought-tolerant genes of Rudbeckia hirta L., according to claim 1, is characterized in that, In step S4, the specific steps for PEG 3350 concentration screening are as follows: 1) Prepare a series of SG-U (galactose substituted glucose) liquid media containing 0 mM, 30 mM, 60 mM, 90 mM, 100 mM, 110 mM, 120 mM, 130 mM, 135 mM, 140 mM PEG 3350; 2) Take the working bacterial solution and the empty control strain, shake the bacteria for 24 hours to confirm the growth, and then dilute the bacterial solution OD = 0.2 with ddH2O 10 -2 , 10 -3 , 10 -4 , take 10uL of the dilution solution and spot it on the SG-Ura plate, place it in an incubator at 30℃ and culture for 3 to 5 days, observe the growth of the colonies, and determine the PEG 3350 concentration screening conditions.

9. The method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta L., according to claim 1, is characterized in that, In step S5, the specific steps for library positive clone identification are as follows: 1) Treat the library working bacterial solution in 120 mM concentration of PEG3350 liquid for 24 h, take 300 μL and spread it on 150 mm SG-Ura plates, a total of 20 plates; 2) After the clones grow, randomly pick 96 clones for colony PCR and preserve them on SG-Ura plates; Pipette 3 - 3.5 μl of Yeast lysis buffer into a PCR tube, and use a sterile pipette tip or toothpick to pick an appropriate amount of yeast into the PCR tube; After pipetting and mixing well, incubate at 98°C for 10 - 20 min; Prepare another sterile PCR tube and prepare the reaction system; 3) Send the bands identified by colony PCR for sequencing, and after the sequencing results are returned, perform BLAST alignment using the NCBI database.

10. The method for constructing a cDNA library for screening drought-tolerant genes of Rudbeckia hirta L., according to claim 9, is characterized in that, In step S6, the positive clone transformants grown by streaking monoclonal on SG-Ura defective plates are resuspended with SG-Ura liquid and SG-Ura + 120 mM PEG3350 respectively. After treatment for 24 h, take 10 μL each and spot on SG-Ura defective plates, and incubate at 30°C for 3 - 4 days.

Images