InDel Molecular Marker for Screening Salt-Tolerant Gene Ts33 in Rice and Its Application

By locating the salt-tolerant gene Ts33 in rice and developing InDel molecular markers, the problem of difficulty in effectively utilizing the salt-tolerant gene in the prior art is solved, and rapid breeding of salt-tolerant rice varieties is achieved, and the efficiency of salt-tolerant breeding is improved.

CN119824137BActive Publication Date: 2025-06-24SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510326057.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-19
Publication Date
2025-06-24
Estimated Expiration
2045-03-19

AI Technical Summary

Technical Problem

The prior art is difficult to effectively utilize the salt-tolerant genes in wild rice, resulting in low yields of rice in salinized soils and slow salt-tolerant breeding process.

Method used

By constructing a backcrossing genetic population of strong salt-resistant ordinary wild rice and cultivated rice variety NK57, the salt-resistant gene Ts33 was localized, and the associated InDel molecular markers were developed for screening salt-resistant rice varieties.

Benefits of technology

The rapid selection and breeding of salt-tolerant rice varieties has been achieved, the salt-tolerant identification process has been simplified, the field workload has been reduced, and the efficiency of salt-tolerant breeding in rice has been improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119824137B_ABST
    Figure CN119824137B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biotechnology, and specifically provides an InDel molecular marker for screening the rice salt-tolerant gene Ts33 and its application. Genomic DNA of the above-mentioned tissue is extracted from the leaves of rice, and then, using the DNA of the above-mentioned tissue as a template and the corresponding sequences of ProTs33-F1 and ProTs33-R1 as specific primers, PCR amplification is respectively carried out to obtain amplified fragments. After electrophoresis, the salt-sensitive strain lines show a 238bp band, while the salt-tolerant strain lines show no band. The present invention can quickly breed rice varieties improved by using the wild rice Ts33 gene, which helps to improve the current situation of a large amount of field work and heavy workload caused by a large number of salt-tolerance identifications using population materials, and has important theoretical and practical significance for cultivating new rice varieties with salt-tolerant traits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of rice variety screening, and particularly relates to InDel molecular markers for screening the rice salt tolerance gene Ts33 and their applications. Background Art

[0002] Rice ( Oryza sativa L.) is one of the important food crops in the world. With the continuous explosion of the world's population, ensuring high and excellent yields of rice has become the top priority of rice research. Since the mid-20th century, under the utilization of dwarf breeding and heterosis, two leaps in rice yields have been achieved. Rice is a salt-sensitive crop. During the vegetative growth stage, rice seedlings are relatively sensitive to salt; during the reproductive growth stage, rice is highly sensitive to salt. Nowadays, the increase in rice yield has reached a bottleneck, and more than 20% of arable land cannot be effectively utilized due to salinization. The ancestor species of Asian cultivated rice, common wild rice ( Oryza rufipogon ), preserves specific genes that disappeared or were weakened during the domestication of cultivated rice and has good resistance and tolerance to various environmental stresses. Therefore, using wild rice resources to discover and identify new rice salt tolerance genes and applying them to rice breeding can not only control and improve saline-alkali soil, but also make full use of saline-alkali soil, and even become a solid foundation for ensuring the stable increase of rice yields in China.

[0003] There are abundant salt tolerance genes in rice germplasm resources, but most of the rice salt tolerance is a genetically complex trait, generally controlled by multiple minor genes. To deeply explore these salt tolerance genes, researchers usually perform mapping through constructing mapping populations with simple backgrounds such as recombinant inbred lines, backcross inbred lines, substitution lines, etc. So far, only one major QTL SKC1 at the seedling stage has been successfully cloned. However, there are few reports on how to identify and obtain the salt tolerance genes of wild rice. Summary of the Invention

[0004] The purpose of the present invention is to utilize the backcross genetic population of strongly salt-tolerant common wild rice and the cultivated rice variety NK57 (Nongken 57) that has been constructed to discover the genes related to salt tolerance in wild rice and develop corresponding salt tolerance molecular markers. A salt tolerance gene Ts33 was mapped, and an InDel marker associated with it was developed, providing a new molecular marker for improving rice salt tolerance to accelerate the process of rice salt tolerance breeding.

[0005] To achieve the above purpose, the present invention provides the following technical solutions:

[0006] The first aspect of the present invention provides the application of the InDel molecular marker in the rice Ts33 promoter region in screening salt-tolerant rice varieties. The upstream primer sequence of the specific primer pair for amplifying the InDel molecular marker is as shown in ProTs33-F1, and the downstream primer sequence is as shown in ProTs33-R1; the upstream primer ProTs33-F1 (SEQ ID NO:1): ATGCACTCGGGTAAGCTGTT; the downstream primer ProTs33-R1 (SEQ ID NO:2): AGGTTCAGAGAGATGTTGTGCA; the size of the amplification product is 238bp.

[0007] The second aspect of the present invention provides the application of the specific primer pair of the above InDel molecular marker in molecular screening of salt-tolerant rice varieties.

[0008] The third aspect of the present invention provides a method for screening the presence or absence of a salt-tolerant gene in the rice Ts33 promoter region, comprising the following steps:

[0009] S1. Select the leaves of rice and use a DNA extraction kit (TIANGEN) to extract DNA from the test materials. According to the different SNP site information in the parents, select primers with polymorphisms between the two parents to design molecular markers to detect the genotypes in the progeny population. Then, using the DNA of the above tissues as a template and the corresponding sequences of the ProTs33-R1 and ProTs33-F1 as specific primers, perform PCR amplification respectively to obtain amplification fragments;

[0010] S2. The amplification fragments are subjected to agarose gel electrophoresis. For the Ts33 promoter fragment, the salt-sensitive strain lines show only one main band of 238bp after electrophoresis, while the salt-tolerant strain lines show no bands.

[0011] Furthermore, the system for the PCR amplification is: the volume is 51µL, including 2 µL of DNA, 1µL of KOD-FX enzyme, 1.5 µL each of the forward primer and the reverse primer, 25 µL of 2×PCR Buffer for KOD FX, 10 µL of ddH2O, and 10 µL of dNTP.

[0012] Furthermore, the procedure for the PCR amplification is: pre-denaturation at 98℃ for 5 min; denaturation at 98℃ for 10 s, annealing at 58℃ for 30s, extension at 68℃ for 30 s, 35 cycles; extension at 68℃ for 10 min.

[0013] The beneficial effects of the present invention:

[0014] The genotypes of six different lines in the parental wild rice, NK57, and a randomly selected F6 progeny population (wild rice / NK57) were detected using this InDel molecular marker. It was found that no bands appeared after electrophoresis of the DNA of the parental wild rice and three of the F6 lines after PCR amplification, all of which were wild rice genotypes. However, only a 238 bp main band appeared after electrophoresis of the DNA of the parental NK57 and the other three F6 lines after PCR amplification, which was the cultivated rice genotype. Therefore, using this molecular marker can quickly select salt-tolerant rice materials improved by the wild rice Ts33 gene, which helps to improve the current situation of a large amount of field work and heavy workload caused by a large number of salt-tolerance identifications using population materials, and has important theoretical and practical significance for breeding new rice varieties with salt-tolerant traits. Description of the Drawings

[0015] Figure 1 Electrophoresis pattern of the rice Ts33 promoter fragment in Example 1: M is Marker2000, and the lanes are wild rice and cultivated rice NK57 respectively.

[0016] Figure 2 Electrophoresis pattern of the rice Ts33 promoter fragment in Example 2: M is Marker2000, and the lanes are: cultivated rice NK57, wild rice, and F6 population respectively, T1, T2, and T3 are salt-tolerant F6 individual plants, and S1, S2, and S3 are salt-tolerant F6 individual plants.

[0017] Figure 3 Phenotype diagrams of salt tolerance of wild rice, NK57, and six F6 individual plants before and after salt stress. Detailed Implementation Modes

[0018] The following describes the detailed implementation modes of the present invention to facilitate those skilled in the art to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the detailed implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions created using the concept of the present invention are within the scope of protection.

[0019] Experimental materials: wild rice, cultivated rice NK57, and an F6 progeny population established using wild rice and cultivated rice NK57 as parents. Example 1

[0020] A method for screening the presence or absence of the salt-tolerant gene Ts33 in the promoter region of rice, comprising the following steps:

[0021] S1. Select the leaves of rice to extract the genomic DNA of the above-mentioned tissue. Then, using the DNA of the above-mentioned tissue as a template and the corresponding sequences of ProTs33-R1 and ProTs33-F1 as specific primers, perform PCR amplification respectively to obtain amplified fragments. Use KOD-FX high-fidelity enzyme for PCR amplification. The PCR amplification system is 51 µL, including 2 µL (50 ng) of DNA, 1 µL of KOD-FX enzyme, 1.5 µL each of the primers (forward + reverse) (10 µmol·L-1), 25 µL of 2×PCR Buffer for KOD FX, 10 µL of ddH2O, and 10 µL of dNTP. The PCR amplification program is pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 68°C for 30 s, for 35 cycles; extension at 68°C for 10 min.

[0022] S2. Use 1.0% agarose gel to electrophoretically separate the obtained amplified fragments under 200V voltage, and observe and record the band patterns of each sample.

[0023] Identification result: Among the two parents, the one with only one main band of 238bp after electrophoresis of the Ts33 promoter fragment is salt-sensitive, while the one without a band after electrophoresis is salt-tolerant ( Figure 1 and Figure 2 ).

[0024] Figure 1 It can be seen from that there are significant differences in the length and number of the Ts33 promoter fragments of salt-tolerant and salt-sensitive rice. The bands are clear after electrophoresis and can be directly and accurately judged by the naked eye. At the same time, the molecular identification results of the salt tolerance of the two parents are consistent with the salt tolerance phenotype identification results, indicating that the identification procedure of the present invention is simple and has a wide application range. Example 2

[0025] S1. Select the leaves of rice to extract the genomic DNA of the above-mentioned tissue. Then, using the DNA of the above-mentioned tissue as a template and the corresponding sequences of ProTs33-R1 and ProTs33-F1 as specific primers, perform PCR amplification respectively to obtain amplified fragments. Use KOD-FX high-fidelity enzyme for PCR amplification. The PCR amplification system is 51 µL, including 2 µL (50 ng) of DNA, 1 µL of KOD-FX enzyme, 1.5 µL each of the primers (forward + reverse) (10 µmol·L-1), 25 µL of 2×PCR Buffer for KOD FX, 10 µL of ddH2O, and 10 µL of dNTP. The PCR amplification program is pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 68°C for 30 s, for 35 cycles; extension at 68°C for 10 min.

[0026] S2. Obtain the amplified fragments and separate them by electrophoresis on a 1.0% agarose gel at 200 V, and observe and record the band patterns of each sample.

[0027] Identification results: Among the F6 population, for the Ts33 promoter fragment, those with only one main band of 238 bp after electrophoresis are salt-sensitive lines, while those without bands after electrophoresis are salt-tolerant lines ( Figure 2 and Figure 3 ).

[0028] Figure 2 It can be seen that there are significant differences in the fragment length and number of the Ts33 promoter of salt-tolerant and salt-sensitive rice after electrophoresis. The bands after electrophoresis are clear and can be directly and accurately judged by the naked eye. At the same time, the molecular identification results of rice salt tolerance are consistent with the salt-tolerance phenotype results, indicating that the identification accuracy of the present invention is high.

[0029] In summary, by using this InDel molecular marker to detect the genotypes of 6 different lines in the randomly selected offspring population F6 (wild rice / NK57), it is found that the DNA of the parental wild rice and 3 of the F6 generation lines did not show bands after PCR amplification and electrophoresis, and they are all salt-tolerant genotypes of Ts33, while the DNA of the parental NK57 and the other 3 F6 generation lines had only one main band of 238 bp after PCR amplification and electrophoresis, which is the salt-sensitive genotype of Ts33. Therefore, using this molecular marker can quickly breed salt-tolerant rice varieties improved by the wild rice Ts33 gene, helping breeders overcome the disadvantages of large workload and long time-consuming in the field salt-tolerance identification using a large number of population materials.

[0030] In the present invention, specific embodiments are used to elaborate on the principle and implementation manner of the present invention. The description of the above embodiments is only used to help understand the method and its core idea of the present invention; at the same time, for those of ordinary skill in the art, according to the idea of the present invention, there will be changes in the scope of the specific implementation manner. In summary, the content of this specification should not be construed as a limitation to the present invention.

Claims

1. Application of a specific primer pair for amplifying the InDel molecular marker in the promoter region of rice Ts33 in screening salt-tolerant rice varieties, characterized in that: The upstream primer sequence of the specific primer pair for amplifying the InDel molecular marker is shown in ProTs33-F1, and the downstream primer sequence is shown in ProTs33-R1; the upstream primer ProTs33-F1: ATGCACTCGGGTAAGCTGTT; the downstream primer ProTs33-R1: AGGTTCAGAGAGATGTTGTGCA; the rice containing the salt-tolerant gene fragment in the Ts33 promoter region has no band, and the rice not containing the salt-tolerant gene fragment in the Ts33 promoter region has a 238bp electrophoresis band; the rice varieties are wild rice, NK57, and the offspring population F6 constructed with wild rice and NK57 as parents.

2. A method for screening the presence or absence of a salt-tolerant gene in the promoter region of rice Ts33, characterized in that: The following steps are included: S1. Select rice leaves to extract genomic DNA from leaf tissues, then use the DNA from the tissues as templates and the corresponding sequences of ProTs33-R1 and ProTs33-F1 described in claim 1 as specific primers to perform PCR amplification to obtain an amplified fragment; S2. The amplified fragments were subjected to agarose gel electrophoresis. The Ts33 promoter fragment with only one 238 bp main band after electrophoresis was a salt-sensitive type, while the one with no band was a salt-tolerant type.

3. The method according to claim 2, characterized in that The PCR amplification system is as follows: the volume is 51 µL, including 2 µL DNA, 1 µL KOD-FX enzyme, 1.5 µL forward primer and 1.5 µL reverse primer, 25 µL 2×PCR Buffer for KOD FX, 10 µL ddH2O, and 10 µL dNTP.

4. The method according to claim 2, characterized in that: The PCR amplification program was as follows: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 58°C for 30 s, and extension at 68°C for 30 s, for 35 cycles; and extension at 68°C for 10 min.

Citation Information

Patent Citations

  • InDel molecular marker of rice salt-tolerant gene SKC1 as well as primer, kit and detection method of InDel molecular marker

    CN116042899A

  • Insertion and deletion molecular marker of rice salt-tolerant gene OsCam1-1, application of insertion and deletion molecular marker, primer pair and identification method

    CN118703686A