RT-PCR primer extraction method and detection method for detecting neonatal HPeV infection
Through RT-PCR primer extraction method and agarose gel electrophoresis technology, the problem of inaccurate detection of HPeV infection in neonatals is solved, and rapid and accurate HPeV detection is achieved, improving the ability to clinically distinguish between infected and uninfected.
Patent Information
- Application Number
- CN202510062205.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-15
- Publication Date
- 2025-04-15
AI Technical Summary
In the prior art, the detection of HPeV infection in neonatal babies is not accurate enough, and it is difficult to accurately distinguish between infected and uninfected children.
Using RT-PCR primer extraction method, specific primers were designed through multiple sequence alignment of HPeV-1 whole genome sequences, combined with agarose gel electrophoresis and recycling technology, to achieve fast and accurate HPeV detection.
It improves the accuracy and speed of HPeV infection detection in neonatal babies, and can more quickly and accurately distinguish between infected and uninfected children.
Smart Images
Figure CN119824141A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of HPeV infection detection in newborns, and specifically to an RT-PCR primer extraction method and a detection method for detecting HPeV infection in newborns. Background Art
[0002] Human echovirus (HPeV) is a non-enveloped single-stranded positive-sense RNA virus. It was first discovered in 1956 in children with diarrhea in the United States and was initially classified as echoviruses 22 and 23 (E22 and E23) in the genus Enterovirus of the family Picornaviridae. However, in 1992, scientists discovered that there were significant genetic differences between the genomes of E22 and E23 and other enteroviruses, and in 1999 they were reclassified as a separate genus of small RNA viruses in the family Picornaviridae and renamed human echoviruses 1 and 2 (HPeV-1 and HPeV-2).
[0003] The open reading frame (ORF) of HPeV is covered by a highly structured 5′ noncoding region (5′UTR) and 3′UTR, which encodes a single polyprotein that is processed into three capsid-encoded proteins (VP0, VP3, and VP1) and seven nonstructural proteins (2A, 2B, 2C, 3A, 3B, 3C, and 3D). HPeV differs from enteroviruses in that HPeV not only does not terminate host cell protein synthesis during replication, but also the VP0 of HPeV cannot be further cleaved into VP4 and VP2.
[0004] To date, the prevalence of HPeV has been reported many times around the world. In the past decade, the frequency of HPeV prevalence has been detected in Asia, Europe, and South America with increasing frequency. In recent years, the Netherlands, Japan, the United States and other countries have reported widespread prevalence and outbreaks of HPeV. The prevalence of HPeV mainly occurs in summer and autumn, and the infectious diseases caused by HPeV mainly occur in infants under 3 months old, posing a serious threat to the life, health and safety of infants. Therefore, HPeV has gradually begun to attract widespread attention.
[0005] The main echovirus with humans as the main host is Parechovirus A (PeVA). Parechovirus A can be divided into 19 genotypes, of which HPeV-1 and HPeV-3 are the most common. HPeV-1 has the widest spread and has been reported many times in many countries and regions around the world. HPeV-3 is considered to be one of the most common viruses that cause central nervous system infections in infants and young children, and together with echovirus 11 and coxsackievirus B2–5, it is recognized as the most common virus that causes severe infections in newborns. Studies have shown that the clinical manifestations of infants and young children infected with HPeV are diverse, and the symptoms of infection with different genotypes of HPeV are also different. For example, HPeV-1 most often causes digestive and respiratory diseases, while HPeV-3 can cause central nervous system diseases such as sepsis-like diseases, encephalitis, meningitis, and meningoencephalitis in addition to digestive and respiratory diseases. Due to the limitations of our understanding of the prevalence of HPeV in different cities in my country and the unknown relationship between HPeV infection and clinical symptoms in neonates, it is currently not possible to accurately distinguish the type of enterovirus infected by the clinical symptoms of the children, nor to distinguish it from severe bacterial infections or other viral infections. Summary of the invention
[0006] The technical problem to be solved by the present invention is to provide an RT-PCR primer extraction method and a detection method for detecting HPeV infection in neonates in view of the problem that HPeV infection detection in the above-mentioned background technology is not accurate enough.
[0007] In order to solve the above technical problems, the technical solution provided by the present invention is: a RT-PCR primer extraction method and a detection method for detecting HPeV infection in newborns, characterized in that it comprises the following steps:
[0008] Step 1: Multiple sequence alignment of the HPeV-1 whole genome sequence;
[0009] Step 2: Design of primers for HPeV-1 detection;
[0010] Step 3: Extraction of nucleic acid from clinical samples;
[0011] Step 4: Rapid testing of HPeV-1 positive samples;
[0012] Step 5: agarose gel electrophoresis;
[0013] Step 6: Agarose gel recovery.
[0014] The step 1 is to query and retrieve the whole genome sequence of HPeV-1 in the database, and merge the existing whole genome sequence and the whole genome sequence of HPeV-1 detected and amplified in the clinical sample into one file, and then perform multiple sequence alignment on the merged file through MAFFT software to obtain an alignment sequence file.
[0015] The second step is to annotate the HPeV-1 full genome sequence. In the alignment sequence obtained in the first step, a pair of specific primers with a length of 115 bp for amplification are designed at the 5′UTR conservative sequence.
[0016] The step three is to extract the nucleic acid of the sample to be tested by a fully automatic nucleic acid extractor, and the extracted nucleic acid is stored in a -80°C refrigerator.
[0017] The fourth step is to perform RT-PCR on the nucleic acid of the obtained sample by Primescript one-step RT-PCRkit version 2 reagent and primers designed at the 5′UTR conservative sequence. The PCR amplification conditions are: 50°C 30min, 94°C 2min, (94°C 30s, 55°C 30s, 72°C 15s)*35cycles, 72°C 10min.
[0018] The step five is to prepare a piece of agarose gel with a concentration of 1.2%, mix the sequence PCR product amplified in the previous step with 6*loading buffer using a pipette, and then add them to the sample loading wells of the agarose gel in sequence. After electrophoresis at a constant voltage of 120V for 30 minutes, a single specific band can be observed at 100-250bp for the HPeV-1 positive sample under ultraviolet light.
[0019] The step six is to cut out the gel block of the target fragment from the agarose gel, and use a DNA gel recovery kit to recover the fragment from the agarose gel.
[0020] The specific detection method is:
[0021] Step 1: fragment concentration determination;
[0022] Step 2: Establish a standard curve for HPeV-1 positive samples;
[0023] Step 3: HPeV-1 sample virus titer determination;
[0024] The step 1 is to measure the DNA concentration by Nanodrop ultra-micro spectrophotometer, and use the formula:
[0025] copies / μL=DNA concentration(ng / μL)×10-9×6.02×10 23 / (660×DNAlength), convert the concentration unit to copies / μL;
[0026] In step 2, the HPeV-1 positive samples detected in the clinical samples were subjected to nucleic acid extraction, and the products after RT-PCR and agarose gel recovery were diluted 10 times with DEPC water, and used as a template, and the ChamQ Blue Universal SYBR qPCR Master Mix kit was used for qPCR, and the program design was: 95°C 30s, (95°C 3-10s, 60°C 10-30s)*40cycles;
[0027] The Ct values measured at each dilution gradient are the horizontal axis, log 12.0180366 After establishing the standard curve with (copy / ul) as the ordinate, the standard curve formula is calculated as: log 12.0180366 (copy / ul)=-0.286*Ct+10.014;
[0028] In step 3, the product recovered from agarose gel is used as a template, and the ChamQ Blue Universal SYBRqPCR Master Mix kit is selected for qPCR. The program design is: 95°C 30s, (95°C 3-10s, 60°C 10-30s)*40cycles. The measured Ct value can be used to calculate the titer of the positive sample through the established standard curve, and the sample mass when the sample nucleic acid is extracted can be measured, and the sample titer unit can be converted into copies / g.
[0029] After adopting the above structure, the present invention has the following advantages: a new extraction method for quickly and accurately detecting HPeV in clinical samples and a method for detecting the virus titer using this primer can help to more quickly and accurately distinguish children infected with and not infected with HPeV in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 It is a schematic diagram of positive bands in Example 1 of a RT-PCR primer extraction method and a detection method for detecting HPeV infection in newborns;
[0031] Figure 2 It is a schematic diagram of negative band comparison of Example 1 of an RT-PCR primer extraction method and a detection method for detecting HPeV infection in newborns;
[0032] Figure 3It is a schematic diagram of positive bands in Example 2 of a RT-PCR primer extraction method and a detection method for detecting HPeV infection in newborns;
[0033] Figure 4 It is a schematic diagram of negative band comparison of Example 2 of an RT-PCR primer extraction method and a detection method for detecting HPeV infection in newborns;
[0034] Figure 5 The present invention is a schematic diagram of a positive sample standard curve of an RT-PCR primer extraction method and a detection method for detecting HPeV infection in newborns. DETAILED DESCRIPTION
[0035] The present invention is further described in detail below in conjunction with the accompanying drawings.
[0036] Combined with Figure 1-4 , a RT-PCR primer extraction method for detecting HPeV infection in newborns, comprising the following steps:
[0037] Step 1: Multiple sequence alignment of the HPeV-1 whole genome sequence: Query and retrieve the HPeV-1 whole genome sequence in the database, and merge the existing whole genome sequence and the HPeV-1 whole genome sequence detected and amplified in clinical samples into one file. Then, perform multiple sequence alignment on the merged file using MAFFT software to obtain the alignment sequence file.
[0038] Step 2: Design of HPeV-1 detection primers: Annotate the HPeV-1 full genome sequence, and design a pair of specific primers with a length of 115 bp for amplification sequence at the 5′UTR conserved sequence in the alignment sequence obtained in step 1.
[0039] Step 3: Extraction of nucleic acid from clinical samples: Use a fully automatic nucleic acid extractor to extract nucleic acid from the sample to be tested, and store the extracted nucleic acid in a -80°C refrigerator.
[0040] Step 4: Rapid detection of HPeV-1 positive samples: The nucleic acid of the sample to be tested was subjected to RT-PCR using Primescriptone-step RT-PCR kit version 2 reagent and primers designed at the 5′UTR conservative sequence. The PCR amplification conditions were: 50℃30min, 94℃2min, (94℃30s, 55℃30s, 72℃15s)*35cycles, 72℃10min.
[0041] Step 5: Agarose gel electrophoresis: prepare a piece of 1.2% agarose gel, mix the PCR product amplified in the previous step with 6*loading buffer using a pipette, and add them to the sample wells of the agarose gel in sequence. Perform electrophoresis at a constant voltage of 120V for 30 minutes. Under ultraviolet light, a single specific band at 100-250bp can be observed for HPeV-1 positive samples. Cut the gel block of the target fragment from the agarose gel and use a DNA gel recovery kit for agarose gel recovery.
[0042] The amplification primer sequences are:
[0043] HPeV-5'UTR-F:GCCAAAAGCCAAGGTTTAAC;
[0044] HPeV-5'UTR-R:GTGGGCCTTACAACTAGTG.
[0045] The specific detection method is:
[0046] Step 1: Fragment concentration determination: Step 1 is to measure the DNA concentration by Nanodrop ultra-micro spectrophotometer and use the formula:
[0047] copies / μL=DNA concentration(ng / μL)×10-9×6.02×10 23 / (660×DNAlength), and convert the concentration unit to copies / μL.
[0048] Step 2: Establish a standard curve for HPeV-1 positive samples: Extract nucleic acid from the HPeV-1 positive samples detected in clinical samples, and perform 10-fold gradient dilution with DEPC water after RT-PCR and agarose gel recovery. Use this as a template and select the ChamQ Blue Universal SYBR qPCR Master Mix kit for qPCR. The program design is: 95℃30s, (95℃3-10s, 60℃10-30s)*40cycles. The Ct value measured at each dilution gradient is the horizontal axis, and log 12.0180366 After establishing the standard curve with (copy / ul) as the ordinate, the standard curve formula is calculated as: log 12.0180366 (copy / ul)=-0.286*Ct+10.014,
[0049] Step 3: Determination of virus titer of HPeV-1 samples: Using the product recovered from agarose gel as a template, ChamQBlue Universal SYBR qPCR Master Mix kit was selected for qPCR. The program design was: 95℃30s, (95℃3-10s, 60℃10-30s)*40cycles. The measured Ct value can be used to calculate the titer of the positive sample through the established standard curve. The sample mass when extracting sample nucleic acid can be measured, and the sample titer unit can be converted into copies / g.
[0050] A specific implementation case 1 of the above method is as follows: Figure 1-2 As shown:
[0051] 1. Conduct rapid testing of HPeV-1 positive samples on the collected clinical samples. After the nucleic acid is extracted from the collected samples on the same day, RT-PCR is performed immediately, and the positive bands in the samples are observed by agarose gel electrophoresis.
[0052] 2. HPeV-1 sample virus titer determination: After the target band of the positive sample was recovered by agarose gel, the DNA concentration was measured by Nanodrop ultra-micro spectrophotometer.
[0053] Samples ID Ct average Virus titer (copies / g) 323 1.49 6.59*1013 324 7.98 2.91*1011 326 1.73 1.93*1013 327 6.573333 2.43*1012 333 1.786667 1.10*1014 335 4.74 2.74*1012 336 4.703333 1.81*1012 337 4.546667 1.75*1013 338 1.93 3.87*1013
[0054] A specific implementation case 2 using the above method, such as Figure 3-4 As shown:
[0055] 1. Conduct rapid testing of HPeV-1 positive samples on the collected clinical samples. After the nucleic acid is extracted from the collected samples on the same day, RT-PCR is performed immediately, and the positive bands in the samples are observed by agarose gel electrophoresis.
[0056] 2. HPeV-1 sample virus titer determination: After the target band of the positive sample was recovered by agarose gel, the DNA concentration was measured by Nanodrop ultra-micro spectrophotometer.
[0057]
[0058]
[0059] The present invention and its implementation methods are described above, and such description is not restrictive, and the actual structure is not limited thereto. In short, if a person skilled in the art is inspired by it, and does not deviate from the purpose of the invention, and does not creatively design a structure and implementation method similar to the technical solution, they should all fall within the protection scope of the present invention.
[0060] like Figure 5Shown: Standard curve of positive samples:
[0061]
[0062] Average Ct value:
[0063] Average Ct value <![CDATA[lg 12.0180366 (copy / ul)]]> 2.41 9 8.186667 8 11.4 7 13.91333 6 17.34667 5 20.46333 4
Claims
1. A method for extracting RT-PCR primers for detecting HPeV infection in newborns, characterized in that: It includes the following steps: Step 1: Multiple sequence alignment of the HPeV-1 whole genome sequence; Step 2: Design of primers for HPeV-1 detection; Step 3: Extraction of nucleic acid from clinical samples; Step 4: Rapid testing of HPeV-1 positive samples; Step 5: agarose gel electrophoresis; Step 6: Agarose gel recovery.
2. The method for extracting RT-PCR primers for detecting HPeV infection in newborns according to claim 1, characterized in that: The step 1 is to query and retrieve the whole genome sequence of HPeV-1 in the database, and merge the existing whole genome sequence and the whole genome sequence of HPeV-1 detected and amplified in the clinical sample into one file, and then perform multiple sequence alignment on the merged file through MAFFT software to obtain an alignment sequence file.
3. The RT-PCR primer extraction method for detecting HPeV infection in newborns according to claim 2, characterized in that: The second step is to annotate the HPeV-1 full genome sequence. In the alignment sequence obtained in the first step, a pair of specific primers with a length of 115 bp for amplification are designed at the 5′UTR conservative sequence.
4. The RT-PCR primer extraction method for detecting HPeV infection in newborns according to claim 3, characterized in that: The step three is to extract the nucleic acid of the sample to be tested by a fully automatic nucleic acid extractor, and the extracted nucleic acid is stored in a -80°C refrigerator.
5. The method for extracting RT-PCR primers for detecting HPeV infection in newborns according to claim 4, characterized in that: The fourth step is to perform RT-PCR on the nucleic acid of the obtained sample by Primescript one-step RT-PCRkit version 2 reagent and primers designed at the 5′UTR conservative sequence. The PCR amplification conditions are: 50°C 30min, 94°C 2min, (94°C 30s, 55°C 30s, 72°C 15s)*35cycles, 72°C 10min.
6. The method for extracting RT-PCR primers for detecting HPeV infection in newborns according to claim 5, characterized in that: The step five is to prepare a piece of agarose gel with a concentration of 1.2%, mix the sequence PCR product amplified in the previous step with 6*loading buffer using a pipette, and then add them to the sample loading wells of the agarose gel in sequence. After electrophoresis at a constant voltage of 120V for 30 minutes, a single specific band can be observed at 100-250bp for the HPeV-1 positive sample under ultraviolet light.
7. The method for extracting RT-PCR primers for detecting HPeV infection in newborns according to claim 6, characterized in that: The step six is to cut out the gel block of the target fragment from the agarose gel, and use a DNA gel recovery kit to recover the fragment from the agarose gel.
8. A detection method using RT-PCR primers for detecting HPeV infection in newborns according to claims 1-7, characterized in that: Step 1: fragment concentration determination; Step 2: Establish a standard curve for HPeV-1 positive samples; Step 3: HPeV-1 sample virus titer determination; The step 1 is to measure the DNA concentration by Nanodrop ultra-micro spectrophotometer, and use the formula: copies / μL=DNA concentration(ng / μL)×10-9×6.02×10 23 / (660×DNAlength), convert the concentration unit to copies / μL; In step 2, the HPeV-1 positive samples detected in the clinical samples were subjected to nucleic acid extraction, and the products after RT-PCR and agarose gel recovery were diluted 10 times with DEPC water, and used as a template, and the ChamQ Blue Universal SYBR qPCR Master Mix kit was used for qPCR, and the program design was: 95°C 30s, (95°C 3-10s, 60°C 10-30s)*40cycles; The Ct values measured at each dilution gradient are the horizontal axis, log 12.0180366 After establishing the standard curve with (copy / ul) as the ordinate, the standard curve formula is calculated as: log 12.0180366 (copy / ul)=-0.286*Ct+10.014; In step 3, the product recovered from agarose gel is used as a template, and the ChamQ Blue Universal SYBRqPCR Master Mix kit is selected for qPCR. The program design is: 95°C 30s, (95°C 3-10s, 60°C 10-30s)*40cycles. The measured Ct value can be used to calculate the titer of the positive sample through the established standard curve, and the sample mass when the sample nucleic acid is extracted can be measured, and the sample titer unit can be converted into copies / g.