Molecular capture technology-based live / dead virus determination system and application thereof

Abstract

The invention discloses a live / dead virus determination system based on a molecular capture technology and application thereof. The system comprises three bottles of sample eluents with different components, a dual-channel chromatography test strip and an ultraviolet analyzer, the sample eluents are respectively water, a DNase solution and a protease K solution; the two-channel chromatography test strip is provided with two channels which respectively comprise nucleic acid aptamer hydrogel microspheres and molecular beacons. According to the detection system and the detection method constructed by the invention, the problem that the live / dead state of the DNA virus cannot be rapidly and accurately measured in the prior art is solved, the DNA virus infectivity can be rapidly and conveniently judged by utilizing the detection system and the detection method disclosed by the invention, and the economic cost caused by complex virus measurement operation and too long time is reduced.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to a method for determining live / dead viruses based on molecular capture technology and its application. Background Art

[0002] Cold chain food and express delivery items have been tested positive for viral nucleic acid, which has always been a matter of great concern to the society. Currently, the widely used technologies such as real-time fluorescence quantitative PCR nucleic acid amplification detect viral nucleic acid fragments and cannot determine the "alive or dead" and infectiousness of the virus. The viruses present on contaminated cold chain or express delivery items are mostly "dead" (lysed) viruses with destroyed structures and are not infectious; however, the viral nucleic acid fragments contained in them often lead to positive PCR tests, causing unnecessary social panic and cost consumption. Therefore, it is very necessary to develop a detection method that can identify the "alive or dead" and infectiousness of viruses in the environment.

[0003] Nucleic acid aptamers are single-stranded oligonucleotides that can specifically bind to target molecules. They are known as "chemical antibodies". Once discovered, they are applied in biomedicine, diagnostic testing, drug development and other fields. The key technological breakthrough of liquid biopsy technology based on nucleic acid aptamers is developed from SELEX. SELEX, which has extremely high flexibility, can provide a variety of recognition ligands for biomedical applications by simply changing the selection target. Many aptamer-based detection methods have been proposed for protein marker analysis. Cell-SELEX starts with whole cells as the selection target, and provides satisfactory binding performance of aptamers to cell surface markers without understanding their molecular characteristics. The technology starts with screening of a large number of single-stranded nucleic acid molecules, and performs iterative in vitro selection by incubation with target cells. After subsequent amplification by polymerase chain reaction, aptamers with high affinity and specificity for target cells are enriched.

[0004] Hydrogel microspheres are colloidal particles with macromolecular networks, ranging in size from tens of nanometers to tens of micrometers, capable of capturing large amounts of solvent. Through synthetic conditions such as monomer selection, monomer ratio, crosslinker concentration, and initiator concentration, properties such as surface charge, particle size, crosslinking density, amphiphilicity, porosity, degradability, and softness can be adjusted. Hydrogel microspheres can be used in the field of precision medicine to meet a wide range of biomedical applications due to their advantages such as multiple controllable properties and high water content.

[0005] Molecular beacons are stem-loop dual-labeled oligonucleotide probes with a hairpin structure. The nucleic acid sequences at both ends are complementary and paired, so the fluorescent group labeled at one end is closely adjacent to the quenching group labeled at the other end. The photons generated by the fluorescent group after being excited are quenched by the quencher, and the energy generated by the fluorescent group is released in the form of infrared rather than visible light. However, when the molecular beacon binds to a target molecule with a completely complementary sequence to form a double-stranded hybrid, the complementary region of the beacon stem is pulled apart, the distance between the fluorescent molecule and the quenching molecule increases, and the fluorescence of the beacon molecule is almost completely restored. And the detected fluorescence intensity is proportional to the amount of target in the solution.

[0006] At present, virus detection has the following problems: 1. Traditional virus detection methods include virus isolation and identification, PCR and ELISA, but these methods have problems such as cumbersome operation, long detection time and low sensitivity. 2. Emerging technologies and optimized methods such as virus detection based on droplet digital PCR, virus detection based on gene sequencing technology; and detection technologies based on CRISPR / Cas, biosensors, flow cytometry, etc. are also widely used, but these technologies have problems such as high detection costs, need to be carried out in the laboratory and take too long. 3. Whether it is traditional virus detection methods or emerging virus detection methods, it is impossible to determine whether the virus is dead or alive, and therefore it is impossible to determine whether the virus on the sample is still contagious, which ultimately leads to problems such as high transportation costs in the entire market and long product release time. Summary of the invention

[0007] Purpose of the invention: In view of the problems existing in the prior art, the present invention provides a live / dead virus determination system based on molecular capture technology. The system uses molecular capture technology to respectively determine the virus protein coat and the virus internal nucleic acid, and through the potential logical relationship between the live / dead state of the virus and its protein coat and internal nucleic acid, it is possible to determine whether the sample to be tested contains the virus and the live / dead state of the virus.

[0008] The present invention also provides an application of the live / dead virus determination system based on molecular capture technology. The detection system and detection method constructed by the present invention solve the problem that the prior art cannot quickly and accurately measure the live / dead state of DNA viruses. The present invention can be used to quickly and conveniently determine the infectivity of DNA viruses, reducing the economic costs caused by the complex operation and long time of virus determination.

[0009] Technical solution: To achieve the above-mentioned purpose, the present invention discloses a live / dead virus determination system based on molecular capture technology, which comprises: 3 bottles of sample eluents with different components, a dual-channel chromatography test strip and a UV analysis device; the sample eluents with different components are water, DNase solution and proteinase K solution respectively; the dual-channel chromatography test strip has two channels including nucleic acid aptamer hydrogel microspheres and molecular beacons respectively.

[0010] The sample eluent includes sample eluent 1, sample eluent 2 and sample eluent 3. The sample eluent 1 is DEPC water, the sample eluent 2 is a DNase solution with a concentration of 800-1200U, and the sample eluent 3 is a commercial proteinase K solution with a concentration of 100-500μg / ml.

[0011] Preferably, the sample eluent 2 is a DNase solution with a concentration of 1000 U, and the sample eluent 3 is a commercial proteinase K solution with a concentration of 300 μg / ml.

[0012] The dual-channel chromatography test strip comprises a chromatography test strip channel 1 and a chromatography test strip channel 2, wherein the chromatography test strip channel 1 comprises nucleic acid aptamer hydrogel microspheres, fluorescein-labeled rabbit IgG, goat anti-rabbit IgG polyclonal antibody GAR, a backing, a nitrocellulose membrane, a sample pad, a release pad and absorbent paper; the chromatography test strip channel 2 comprises a molecular beacon, fluorescein-labeled rabbit IgG, goat anti-rabbit IgG polyclonal antibody GAR, a backing, a nitrocellulose membrane, a sample pad, a release pad and absorbent paper.

[0013] Among them, in the chromatography test strip channel 1 and the chromatography test strip channel 2, the nitrocellulose membrane and the absorbent paper are spliced ​​at a length of 4:1 and mounted on the base liner, the sample pad is pressed on the release pad and mounted on the other end of the nitrocellulose membrane opposite to the absorbent paper, and the area between the release pad and the absorbent paper is the detection area, and there are a test area (T line) and a control area (C line) on the detection area; the release pad is loaded with fluorescein-labeled rabbit IgG, wherein the excitation wavelength of the fluorescein is 365nm, and the emitted light is a visible blue light, the T line of channel 1 is coated with nucleic acid aptamer hydrogel microspheres, the T line of channel 2 is coated with molecular beacons, and the C line is coated with sheep anti-rabbit IgG polyclonal antibody GAR.

[0014] Furthermore, the chromatography test strip channel 1 is used to detect the spike protein on the outer shell of the target DNA virus; the chromatography test strip channel 2 is used to detect the characteristic nucleic acid fragments inside the target DNA virus.

[0015] The ultraviolet analysis device is a dark box with a wavelength of 365 nm and an observation port, and the fluorescence of the chromatographic test strip can be observed through the observation port.

[0016] The oligonucleotide aptamers in the nucleic acid aptamer hydrogel microspheres are modified with quantum dots, the modified quantum dots have an excitation wavelength of 365 nm, the nucleic acid aptamers target specific proteins on the surface of the virus to be detected; the molecular beacons target specific nucleic acid fragments inside the virus to be detected. The aptamers in the present invention can be directly customized and synthesized according to the specific proteins on the surface of each virus.

[0017] Among them, the nucleic acid aptamer in the nucleic acid aptamer hydrogel microspheres has been modified with fluorescein, but after the hydrogel microspheres are formed, the nucleic acid aptamer is wrapped in the hydrogel and cannot show fluorescence. After binding with the corresponding target, it will be pulled out of the hydrogel microspheres by the target molecules, and then after excitation, it will show fluorescence.

[0018] Furthermore, the preparation of the nucleic acid aptamer hydrogel microspheres mainly comprises the following steps:

[0019] a. Mix the commercially available fluorescein-modified oligonucleotide aptamer, polyethylene glycol diacrylate solution and ammonium persulfate solution and prepare the mixture as the aqueous phase;

[0020] b. Mix the hydrofluoroether, Krytox FSL157 surfactant and N, N, N', N'-trimethylenediamine and set aside as the oil phase;

[0021] c. The aqueous phase and the oil phase were mixed and stirred at 37°C and 800 r / min for 3 hours to obtain nucleic acid aptamer hydrogel microspheres;

[0022] d. Add 50% sucrose solution to the reaction solution, shake vigorously, centrifuge at 2000 r / min for 30 minutes, remove the supernatant, and obtain pure nucleic acid aptamer hydrogel microspheres.

[0023] Among them, the excitation wavelength of the modified quantum dots of the oligonucleotide aptamer in step a is 365nm; the ratio of the water phase and the oil phase added in step c is 1:2.

[0024] The excitation wavelength of the fluorescent marker of the molecular beacon is 365 nm. The molecular beacon is specifically a stem-loop dual-labeled oligonucleotide probe with a hairpin structure.

[0025] The live / dead virus determination system based on molecular capture technology of the present invention is applied to the detection of live / dead DNA viruses in in vitro samples.

[0026] Furthermore, the live / dead virus determination system based on molecular capture technology described in the present invention is used in the preparation of in vitro DNA virus live / dead detection reagents or kits.

[0027] Among them, the in vitro samples include cold chain food and packaging, logistics goods, rapid testing of medical devices and rapid testing of biological products.

[0028] Wherein, the detection process is:

[0029] Sampling is done in sample eluent 1. After sufficient elution, sample eluent 1 is dripped onto the sample pads in the two channels of the chromatography test strip. The color development results of the two channels are observed in a dark box UV analyzer:

[0030] (1) If channel 1 is positive and channel 2 is positive, the test result is pending and the following test steps are performed:

[0031] a. Add sample eluent 2 to the sample eluent 1 after sampling, and shake to mix;

[0032] b. After shaking, add the sample eluent 3 and heat and shake to mix;

[0033] c. Drop the processed sample eluate onto a new chromatography test strip. If channel 1 is negative and channel 2 is positive, it indicates that there are live viruses in the original sample to be tested, and both live viruses and dead viruses exist; if channel 1 is negative and channel 2 is negative, it indicates that the viruses in the original sample to be tested are all dead viruses; if channel 1 is positive, the result is invalid;

[0034] (2) If channel 1 is positive and channel 2 is negative, it indicates that live virus is present in the sample to be tested;

[0035] (3) If channel 1 is negative and channel 2 is positive, it means that there are viruses in the sample to be tested, but they are all dead viruses;

[0036] (4) If channel 1 is negative and channel 2 is negative, it means that there is no virus in the sample to be tested;

[0037] (5) In each test, the C lines of all channels should show fluorescence. If there is no fluorescence, the test is invalid.

[0038] The live / dead virus determination system based on molecular capture technology described in the present invention can perform live / dead detection of DNA viruses in vitro and is applicable to all DNA viruses. It only requires customizing the corresponding aptamers and molecular beacons according to different virus types.

[0039] The live / dead virus determination system based on molecular capture technology of the present invention comprises a dual-channel chromatographic test strip comprising a nucleic acid aptamer in channel 1 of the chromatographic test strip for detecting the surface specific protein of the DNA virus to be detected, and a molecular beacon in channel 2 of the chromatographic test strip for detecting the internal specific nucleic acid fragment of the DNA virus to be detected. After sampling, if the test finds that result (1) channel 1 is positive and channel 2 is positive, that is, both the protein shell of the virus and the DNA fragment of the virus exist in this sample, this cannot prove whether there is a live virus in the sample, because if all the viruses are live, the DNA fragment of the virus is tightly wrapped in the protein shell, and the result that the surface specific protein is positive and the internal specific nucleic acid fragment is negative should appear, that is, result (2) channel 1 is positive and channel 2 is negative. If all the viruses are dead, it is equivalent to that the virus protein shell is completely cleaved, but this situation is divided into two possibilities: Possibility 1: the virus protein shell is completely cleaved and completely digested, and the result of this possible test is that the virus shell test is negative and the internal nucleic acid fragment test result is positive, that is, result (3) channel 1 is negative and channel 2 is positive. Possibility 2: The viral protein shell is completely cleaved but there is protein that has not been digested. The result of this possible test is that the protein shell test is positive and the internal nucleic acid fragment is also positive, that is, result (1) channel 1 is positive and channel 2 is positive; but there is another possibility of result (1) that the sample contains both live and dead viruses, so the protein shell of the live virus can be detected as positive, and the internal nucleic acid fragment of the dead virus can also be detected as positive. Therefore, the appearance of result (1) requires subsequent steps and cannot be directly determined. After the appearance of result (1), first add eluent 2, i.e., DNase solution, which is a DNA enzyme that can degrade free DNA fragments in the sample, which is equivalent to removing the interference of the dead virus in the sample itself, and then add eluent 3, i.e., proteinase K solution, to it. On the one hand, it degrades both the free protein and the protein shell on the surface of the live virus, and on the other hand, it inactivates the DNA enzyme in eluent 2, so that the DNA enzyme will not continue to degrade the DNA released from the live virus after proteinase K digests the virus shell; finally, the test strip test is performed again. When testing again, because proteinase K degrades all proteins, channel 1 for testing viral surface proteins should be negative no matter what. If channel 1 is positive, the surface proteinase K is inactivated, indicating that the detection system is damaged; if channel 1 is negative and channel 2 for testing internal nucleic acid fragments is positive, it indicates that there was originally live virus, which was degraded by proteinase K to release internal nucleic acid fragments after the surface protein shell was released; if channel 1 is negative and channel 2 is negative, it indicates that they were all dead viruses. Finally, there is another situation where after sampling, the test results of the viral protein shell and internal nucleic acid fragments are both negative, that is, the result (4) channel 1 is negative and channel 2 is negative, which indicates that the sample does not contain virus.

[0040] The live / dead virus determination system based on molecular capture technology of the present invention directly determines the live / dead state of the virus on some cold chain transport samples. The system is designed by using the characteristics of whether the surface protein and internal nucleic acid of the virus are exposed when it is alive or dead. The existing detection methods can only target internal nucleic acids or surface proteins, and do not use the underlying logic of protein shell and internal nucleic acid to determine the live / dead state of the virus to be tested. Therefore, it is impossible to determine whether the virus to be tested is infectious. At present, the virus infection cell experiment is required to detect whether the virus is infectious, but this experiment takes too long. If it is a commodity like pork, when the test results come out, there will be a large number of deterioration phenomena. Therefore, the live / dead virus determination system based on molecular capture technology of the present invention can quickly and conveniently determine whether the virus on the sample to be tested is still infectious, so as to achieve rapid release by customs, etc., and reduce the cost of customs inspection and the transportation cost of merchants. In fact, the existing virus infection cell experiment takes 3 days, while the system prepared by the present invention only takes 30 minutes at most. The present invention has the advantage of obvious shorter time, and the results are accurate and reliable.

[0041] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0042] The present invention uses nucleic acid aptamer hydrogel microspheres and molecular beacon method to detect DNA viruses, and simultaneously detects the surface spike protein and internal characteristic nucleic acid of DNA viruses, and uses the inherent logic of the two test results to infer the live / dead nature of the virus contained in the sample to be tested, and simplifies the reagents used to chromatographic test strips, which can achieve rapid and on-site detection, avoid complex experimental operations and experimental site restrictions, and increase the operability of the experiment. In addition, the chromatographic test strips of the present invention can be used to conduct on-site detection of samples such as cold chain food and logistics goods, avoiding the economic losses caused by the detention of items due to long detection time. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 It is a live / dead virus assay kit based on molecular capture technology;

[0044] Figure 2 It is a diagram of the composition of a chromatographic multi-channel test strip;

[0045] Figure 3 This is a diagram of a pseudovirus cell infection experiment;

[0046] Figure 4 This is a diagram of the cell infection experiment of the pseudovirus. DETAILED DESCRIPTION

[0047] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0048] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Experimental methods without specific conditions specified in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0049] Among them, fluorescein-labeled rabbit IgG was purchased from abcam (ab199091, Alexa 488 fluorescent rabbit IgG).

[0050] Goat anti-rabbit IgG polyclonal antibody against GAR was purchased from abcam (ab6702), and goat anti-rabbit IgG was purchased from H&L.

[0051] The commercialized quantum dot-modified oligonucleotide aptamers, commercialized molecular beacons, commercialized pseudoviruses, etc. in the present invention are synthesized by biological companies according to existing conventional methods or directly purchased, wherein the modified materials are all known materials and sequences are all known sequences.

[0052] Example 1

[0053] like Figure 1 As shown, a live / dead virus determination system based on molecular capture technology includes: 3 bottles of sample eluents with different components, a dual-channel chromatography test strip and ultraviolet analysis equipment; the sample eluents with different components are water, DNase solution and proteinase K solution respectively; the dual-channel chromatography test strip has two channels including nucleic acid aptamer hydrogel microspheres and molecular beacons respectively.

[0054] The sample eluents include sample eluent 1, sample eluent 2 and sample eluent 3. Sample eluent 1 is DEPC water, sample eluent 2 is a DNase solution with a concentration of 1000U, and sample eluent 3 is a commercial proteinase K solution with a concentration of 300μg / ml.

[0055] The dual-channel chromatography test strip comprises a chromatography test strip channel 1 and a chromatography test strip channel 2, wherein the chromatography test strip channel 1 comprises nucleic acid aptamer hydrogel microspheres, fluorescein-labeled rabbit IgG, goat anti-rabbit IgG polyclonal antibody GAR, a backing, a nitrocellulose membrane, a sample pad, a release pad and absorbent paper; the chromatography test strip channel 2 comprises a molecular beacon, fluorescein-labeled rabbit IgG, goat anti-rabbit IgG polyclonal antibody GAR, a backing, a nitrocellulose membrane, a sample pad, a release pad and absorbent paper.

[0056] In the chromatography test strip channel 1 and the chromatography test strip channel 2, the nitrocellulose membrane and the absorbent paper are spliced ​​at a length of 4:1 and mounted on the base liner, the sample pad is pressed on the release pad and mounted on the other end of the nitrocellulose membrane opposite to the absorbent paper, the area between the release pad and the absorbent paper is the detection area, and there are a test area (T line) and a control area (C line) on the detection area; the release pad is loaded with fluorescein-labeled rabbit IgG, wherein the excitation wavelength of the fluorescein is 365nm, and the emitted light is a visible blue light, the T line of channel 1 is coated with nucleic acid aptamer hydrogel microspheres, the T line of channel 2 is coated with molecular beacons, and the C line is coated with sheep anti-rabbit IgG polyclonal antibody GAR.

[0057] The UV analysis equipment is a dark box with 365nm wavelength UV inside, an observation port on the top, and operation ports on both sides. The fluorescence changes of the chromatography test strip placed in it can be observed at the observation port. The oligonucleotide aptamers in the nucleic acid aptamer hydrogel microspheres are fluorescently modified, and the modified fluorescent excitation wavelength is 365nm. The nucleic acid aptamer targets the specific protein on the surface of the virus to be detected; the molecular beacon targets the specific nucleic acid fragment inside the virus to be detected.

[0058] The nucleic acid aptamers in the nucleic acid aptamer hydrogel microspheres have been modified with fluorescein, but after the hydrogel microspheres are formed, the nucleic acid aptamers are wrapped in the hydrogel and cannot fluoresce. After binding with the corresponding target, they will be pulled out of the hydrogel microspheres by the target molecules and then fluoresce after excitation.

[0059] The preparation of nucleic acid aptamer hydrogel microspheres mainly includes the following steps:

[0060] a. Mix the commercially available fluorescein-modified oligonucleotide aptamer, polyethylene glycol diacrylate solution and ammonium persulfate solution and prepare the mixture as the aqueous phase;

[0061] b. Mix the hydrofluoroether, Krytox FSL157 surfactant and N, N, N', N'-trimethylenediamine and set aside as the oil phase;

[0062] c. The aqueous phase and the oil phase were mixed and stirred at 37°C and 800 r / min for 3 hours to obtain nucleic acid aptamer hydrogel microspheres;

[0063] d. Add 50% sucrose solution to the reaction solution, shake vigorously, centrifuge at 2000 r / min for 30 minutes, remove the supernatant, and obtain pure nucleic acid aptamer hydrogel microspheres.

[0064] Among them, the excitation wavelength of the modified fluorescein of the oligonucleotide aptamer in step a is 365nm; the ratio of adding the water phase and the oil phase in step c is 1:2.

[0065] The excitation wavelength of the fluorescent label of the molecular beacon is 365nm. The molecular beacon is specifically a stem-loop dual-labeled oligonucleotide probe with a hairpin structure.

[0066] Example 2

[0067] The present invention embodies the detection of H5N1 influenza virus.

[0068] The quantum dot-modified oligonucleotide aptamers, H5N1-molecular beacons, H5N1 influenza virus pseudoviruses, etc. in this embodiment are all synthesized by biological companies according to existing conventional methods, wherein the modified materials are all known materials and sequences are all known sequences.

[0069] Among them, the quantum dot-modified oligonucleotide aptamer targets the H5N1 influenza virus. The oligonucleotide aptamer is Apt2198, which targets the H5N1 influenza virus HA protein. Its sequence (5'-3') is 5'GCAGAGGTCCGCTGACGGATGGATGGAACAGGGGTTTAGCAGCAGGACCA CTCTTGAGCG3' (Screening and Verification of H5N1 Subtype Avian Influenza Virus Aptamers, Jilin Agricultural University, 2023), and the quantum dots are CdSe / ZnS QDs (Study on Detection Methods of Sialic Acid-related Biomarkers Based on Aptamers and Quantum Dots, Jiangnan University).

[0070] The beacon molecule targeting H5N1 influenza virus (H5N1-molecular beacon), the molecular beacon structure sequence of H5N1-molecular beacon is:

[0071] 5'-FAM-TACATCACGATGGAGAAAATAGTGCTTCTTCTTGCCGTGATGC C-3'-Dabcy;

[0072] 5'-HEX-TACATCACGTTAAATGCAAATTCTGCATTGTAACGATCCGTGAT GCC-3'-Dabcy, where the fluorescein is calcein (the beacon molecule construction refers to the establishment of real-time fluorescence LAMP and molecular beacon LAMP detection methods for African swine fever virus, Huazhong Agricultural University, 2020).

[0073] The accession number of the surface specific protein of H5N1 influenza virus pseudovirus is YP_308669; the accession number of the internal specific nucleic acid fragment is Gene ID: 3654620, Influenza Avirus

[0074] (A / goose / Guangdong / 1 / 1996(H5N1)).

[0075] According to the system and method in Example 1, 10 μl of 200 μM CdSe / ZnS QDs quantum dot-modified oligonucleotide aptamer (targeting H5N1 influenza virus HA protein), 2 ml of 20% polyethylene glycol diacrylate (Merck, catalog number 729094) solution and 2 ml of 0.5% ammonium persulfate solution were mixed evenly and added to a round-bottom flask; then 5 ml of hydrofluoroether, 0.5 ml of 2% Krytox FSL157 surfactant solution and 0.2 ml of 0.4% N, N, N', N'-trimethylenediamine solution were mixed evenly, and after mixing, the mixture was added to the round-bottom flask in a volume ratio of 1:2 between the aqueous phase and the oil phase, and stirred at 37° C. and 800 r / min for 3 hours to obtain a crude product.

[0076] 20 ml of 50% sucrose solution was added to the crude solution, and after vigorous shaking, the solution was centrifuged at 2000 r / min for 30 minutes. The supernatant was removed to obtain pure H5N1 influenza virus-nucleic acid aptamer hydrogel microspheres.

[0077] The structure of the dual-channel test strip is as follows Figure 2 As shown, the bottom plate is provided with a sample pad, a conjugate release pad, a nitrocellulose (NC) membrane and absorbent paper from bottom to top. The nitrocellulose membrane and the absorbent paper are spliced ​​at a length of 4:1 and mounted on the bottom liner. The sample pad is pressed on the release pad and mounted on the other end of the nitrocellulose membrane opposite to the absorbent paper. The nitrocellulose membrane is provided with a T zone and a C zone. The prepared H5N1 influenza virus-nucleic acid aptamer hydrogel microspheres are embedded in the T zone on channel 1, and the H5N1-molecular beacon is embedded in the T zone on channel 2. Fluorescein-labeled rabbit IgG is loaded on the release pads of channel 1 and channel 2, and goat anti-rabbit IgG polyclonal antibody GAR is coated on the C line of the nitrocellulose membrane. The sample pad is stacked on the NC membrane, and the two overlap by about 5 mm. Similarly, the absorbent paper is stacked on the NC membrane, and the two overlap by about 5 mm. The pasted plate is cut into test strips of about 4 mm width by a strip cutter, assembled with a plastic base and a card shell, and sealed and stored at 4°C for later use.

[0078] The specific assembly method is as follows: H5N1 influenza virus-nucleic acid aptamer hydrogel microspheres (25μg / ml) and H5N1-molecular beacon (10μg / ml) are sprayed on each nitrocellulose membrane of the dual-channel test strip as the detection line (T line), and goat anti-rabbit IgG polyclonal antibody GAR antibody (diluted 1000 times) is sprayed on the nitrocellulose membrane as the quality control line (C line). At the same time, fluorescein-labeled rabbit IgG is sprayed on the release pads of channel 1 and channel 2. The spraying amount is 1μL / cm. The distance between each line is about 5mm. Dry at 37℃ for 2-3h. The sprayed test strips should be cut and assembled in time, and sealed and stored at 4℃ for later use. The width of the T line and C line depends on the diameter of the film spraying instrument pipeline, which is about 2mm. The length of the T line and C line, that is, the width of a single test strip, is about 4mm. The T line is about 5mm away from the sample pad, and the C line is about 5mm away from the absorbent paper.

[0079] The surface specific protein accession number of the H5N1 influenza virus pseudovirus was YP_308669. Its surface protein (accession number YP_308669) and internal gene (accession number Gene ID: 3654620) were used for the verification of the chromatographic dual-channel test strip. The pseudovirus was diluted to 1×10 3 copy / ml, drip it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, and observe the test strip in the UV analyzer. Channel 1 shows positive and channel 2 shows negative, which indicates that there is live virus in the sample to be tested. Further, by infecting cells with pseudovirus, the pseudovirus is indeed infectious, such as Figure 3 As shown, it proves that there is live virus in the sample to be tested.

[0080] Dilute the pseudovirus to 1 × 10 3 Copy / ml was directly dripped onto the sample pad of the chromatographic dual-channel test strip, left to stand for 5 minutes, and the test strip was observed in a UV analyzer. Channel 1 showed negative, and channel 2 showed negative, indicating that there was no virus in the sample to be tested. Further, the pseudovirus was used to infect cells to verify that it was correct.

[0081] The H5N1 influenza virus pseudovirus was extracted using a DNA column extraction kit, and the extracted DNA stock solution was diluted to 1×10 3 copy / ml, drip it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, and observe the test strip in the UV analyzer. Channel 1 shows negative and channel 2 shows positive, indicating that there are viruses in the sample to be tested, but they are all dead viruses. Further, the correctness is verified by infecting cells with pseudoviruses.

[0082] The DNA stock solution extracted in the previous step was mixed with the pseudovirus stock solution at a volume ratio of 1:1, and then the mixture was diluted to 1×10 3copy / ml, drip it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows positive, channel 2 shows positive, the test result of the sample is pending, and subsequent operations are required; transfer all the liquid in the eluent 1 bottle to an equal volume of eluent 2, incubate at 37°C for 20 minutes, add an equal volume of eluent 3 to eluent 2 after the reaction, incubate at 55°C for 1 hour, drip the treated sample solution onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows negative, channel 2 shows positive, so it indicates that there are live viruses in the sample to be tested, both live viruses and dead viruses. Further, by infecting cells with pseudoviruses, such as Figure 4 As shown, it proves that there is live virus in the sample to be tested, and the number of viruses is significantly less than that in the same dilution multiple. Figure 3 , proving that there are both live and dead viruses.

[0083] Influenza A H5N1 (A / Anhui / 1 / 2005) hemagglutinin / HA antigen protein (Beijing Sino Biological Technology Co., Ltd., Catalog #11048-V08H1) was mixed with the DNA stock solution extracted in the previous step at a volume ratio of 1:1, and then the mixture was diluted to 1×10 3 copy / ml (in terms of DNA copy number), drip it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows positive, channel 2 shows positive, the test result of the sample is pending, and subsequent operations are required; transfer all the liquid in the eluent 1 bottle to an equal volume of eluent 2, incubate at 37°C for 20 minutes, add an equal volume of eluent 3 to eluent 2 after the reaction, incubate at 55°C for 1 hour, drip the treated sample solution onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows negative, channel 2 shows negative, so it indicates that there are viruses in the sample to be tested, but they are all dead viruses. Further, the correctness is verified by infecting cells with pseudoviruses.

[0084] The above experiments show that the live / dead virus determination system and method based on molecular capture technology of the present invention can determine whether the sample to be tested contains viruses and the live / dead state of the virus, and can quickly and conveniently determine whether the virus on the sample to be tested is still infectious. The existing virus infection cell experiment requires 3 days, while the system prepared by the present invention only takes 30 minutes at most, which has a very obvious advantage of shorter time, and the results are accurate and reliable.

[0085] Example 3

[0086] According to the system and method in Example 1, 10 μl, 200 μM commercial quantum dot-modified oligonucleotide aptamer (Thermo Fisher, targeting African swine fever virus P72 protein), 2 ml 20% polyethylene glycol diacrylate (Merck, catalog number 729094) solution and 2 ml 0.5% ammonium persulfate solution were mixed evenly and added to a 15 ml round-bottom flask; then 5 ml hydrofluoroether, 0.5 ml 2% Krytox FSL157 surfactant solution and 0.2 ml 0.4% N, N, N', N'-trimethylenediamine solution were mixed, and then added to the above 15 ml round-bottom flask, and stirred at 37° C. and 800 r / min for 3 hours to obtain a crude product.

[0087] 20 ml of 50% sucrose solution was added to the crude solution, and after vigorous shaking, the solution was centrifuged at 2000 r / min for 30 minutes. The supernatant was removed to obtain pure P72-nucleic acid aptamer hydrogel microspheres.

[0088] Purchase a commercial molecular beacon (Merck), one segment of which is linked to calcein and the other segment targets the P72 gene of the African swine fever virus.

[0089] The structure of the dual-channel test strip is as follows Figure 2 As shown, the bottom plate is provided with a sample pad, a conjugate release pad, a nitrocellulose (NC) membrane and absorbent paper from bottom to top. The nitrocellulose membrane and the absorbent paper are spliced ​​at a length of 4:1 and mounted on the bottom liner. The sample pad is pressed on the release pad and mounted on the other end of the nitrocellulose membrane opposite to the absorbent paper. The nitrocellulose membrane is provided with a T zone and a C zone. The prepared P72-nucleic acid aptamer hydrogel microspheres are embedded in the T zone on channel 1, and the purchased P72-molecular beacon is embedded in the T zone on channel 2. Fluorescein-labeled rabbit IgG is loaded on the release pads of channel 1 and channel 2, and goat anti-rabbit IgG polyclonal antibody GAR is coated on the C line of the nitrocellulose membrane. The sample pad is stacked on the NC membrane, and the two overlap by about 5 mm. Similarly, the absorbent paper is stacked on the NC membrane, and the two overlap by about 5 mm. The pasted plate is cut into test strips of about 4 mm width by a strip cutter, assembled with a plastic base and a card shell, and sealed and stored at 4°C for later use.

[0090] The specific assembly method is as follows: spray P72-nucleic acid aptamer hydrogel microspheres (25μg / ml) and P72-molecular beacon (10μg / ml) on each nitrocellulose membrane of the dual-channel test strip as the detection line (T line), spray goat anti-rabbit IgG polyclonal antibody GAR (diluted 1000 times) on the nitrocellulose membrane as the quality control line (C line), and spray fluorescein-labeled rabbit IgG on the release pads of channel 1 and channel 2 at the same time. The spraying amount is 1μL / cm, and the distance between each line is about 5mm. Dry at 37℃ for 2-3h. The sprayed test strips should be cut and assembled in time, and sealed and stored at 4℃ for later use. The width of the T line and the C line depends on the diameter of the film spraying instrument pipeline, which is about 2mm. The length of the T line and the C line, that is, the width of a single test strip, is about 4mm. The T line is about 5mm away from the sample pad, and the C line is about 5mm away from the absorbent paper.

[0091] A commercial African swine fever pseudovirus with P72 protein on its surface and P72 gene inside was selected for verification of the chromatographic dual-channel test strip. The purchased pseudovirus was diluted to 1×10 3 copy / ml, drop it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, and observe the test strip in the UV analyzer. Channel 1 shows positive and channel 2 shows negative, indicating that live virus exists in the sample to be tested.

[0092] The purchased pseudovirus was diluted to 1×10 3 Copy / ml is directly dropped onto the sample pad of the chromatographic dual-channel test strip, left to stand for 5 minutes, and the test strip is observed in a UV analyzer. Channel 1 shows negative and channel 2 shows negative, indicating that there is no virus in the sample to be tested.

[0093] The African swine fever pseudovirus was extracted using a DNA column extraction kit, and the DNA was then diluted to 1×10 3 copy / ml, drop it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, and observe the test strip in the UV analyzer. Channel 1 shows negative and channel 2 shows positive, which indicates that there are viruses in the sample to be tested, but they are all dead viruses.

[0094] The DNA stock solution extracted in the previous step was mixed with the pseudovirus stock solution in an equal volume of 1:1, and then the mixture was diluted to 1×10 3copy / ml, drop it on the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows positive, channel 2 shows positive, the test result of the sample is pending, and subsequent operations are required; transfer all the liquid in the eluent 1 bottle to an equal volume of eluent 2, incubate at 37°C for 20 minutes, add an equal volume of eluent 3 to eluent 2 after the reaction, incubate at 55°C for 1 hour, drop the treated sample solution on the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows negative, channel 2 shows positive, it indicates that there are live viruses in the original sample to be tested, both live viruses and dead viruses.

[0095] The commercially available African swine fever antigen P72 recombinant protein was mixed with the DNA stock solution extracted in the previous step at a ratio of 1:1, and then the mixture was diluted to 1×10 3 copy / ml (in terms of DNA copy number), drip it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows positive, channel 2 shows positive, the test result of the sample is pending, and subsequent operations are required; transfer all the liquid in the eluent 1 bottle to the eluent 2, incubate at 37°C for 20 minutes, add eluent 3 to eluent 2 after the reaction is completed, incubate at 55°C for 1 hour, drip the treated sample solution onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows negative, channel 2 shows negative, so it indicates that there are viruses in the sample to be tested, but they are all dead viruses. The above experiment proves that the results are correct by infecting cells with pseudoviruses.

[0096] Example 4

[0097] According to the system and method in Example 1, 20 μl, 100 μM commercial quantum dot-modified oligonucleotide aptamer (Thermo Fisher, targeting hepatitis B virus HBsAg protein), 2 ml 20% polyethylene glycol diacrylate solution and 2 ml 0.5% ammonium persulfate solution were mixed evenly and added to a 15 ml round-bottom flask; then 5 ml hydrofluoroether, 0.5 ml 2% Krytox FSL157 surfactant solution and 0.2 ml 0.4% N, N, N', N'-trimethylenediamine solution were mixed, and then added to the above 15 ml round-bottom flask, and stirred at 37° C. and 800 r / min for 3 hours to obtain a crude product.

[0098] 20 ml of 50% sucrose solution was added to the crude solution, and after vigorous shaking, the solution was centrifuged at 2000 r / min for 30 minutes. The supernatant was removed to obtain pure HbsAg-nucleic acid aptamer hydrogel microspheres.

[0099] Purchase commercial S-molecular beacons, one section of which is linked to calcein and the other section targets the S gene of the hepatitis B virus.

[0100] The structure of the dual-channel test strip is as follows Figure 2 As shown, the bottom plate is provided with a sample pad, a conjugate release pad, a nitrocellulose (NC) membrane and absorbent paper from bottom to top. The nitrocellulose membrane and the absorbent paper are spliced ​​at a length of 4:1 and mounted on the bottom liner. The sample pad is pressed on the release pad and mounted on the other end of the nitrocellulose membrane opposite to the absorbent paper. The nitrocellulose membrane is provided with a T zone and a C zone. The prepared HbsAg-nucleic acid aptamer hydrogel microspheres are embedded in the T zone on channel 1, and the purchased S-molecular beacon is embedded in the T zone on channel 2. Fluorescein-labeled rabbit IgG is loaded on the release pads of channel 1 and channel 2, and goat anti-rabbit IgG polyclonal antibody GAR is coated on the C line of the nitrocellulose membrane. The sample pad is stacked on the NC membrane, and the two overlap by about 5 mm. Similarly, the absorbent paper is stacked on the NC membrane, and the two overlap by about 5 mm. The pasted plate is cut into test strips of about 4 mm width by a strip cutter, assembled with a plastic base and a card shell, and sealed and stored at 4°C for later use.

[0101] The specific assembly method is as follows: HbsAg-nucleic acid aptamer hydrogel microspheres (25μg / ml) and S-molecular beacon (10μg / ml) are sprayed on each nitrocellulose membrane of the dual-channel test strip as the detection line (T line), and goat anti-rabbit IgG polyclonal antibody GAR (diluted 1000 times) is sprayed on the nitrocellulose membrane as the quality control line (C line). At the same time, fluorescein-labeled rabbit IgG is sprayed on the release pads of channel 1 and channel 2. The spraying amount is 1μL / cm. The distance between each line is about 5mm. Dry at 37℃ for 2-3h. The sprayed test strips should be cut and assembled in time, and sealed and stored at 4℃ for later use. The width of the T line and the C line depends on the diameter of the film spraying instrument pipeline, which is about 2mm. The length of the T line and the C line, that is, the width of a single test strip, is about 4mm. The T line is about 5mm away from the sample pad, and the C line is about 5mm away from the absorbent paper.

[0102] A commercial hepatitis B pseudovirus with HBsAg protein on its surface and S gene inside was selected for verification of the chromatographic dual-channel test strip. The purchased pseudovirus was diluted to 1×10 3 copy / ml, drop it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, and observe the test strip in the UV analyzer. Channel 1 shows positive and channel 2 shows negative, indicating that live virus exists in the sample to be tested.

[0103] Dilute the purchased pseudovirus to 1×10 3Copy / ml is directly dropped onto the sample pad of the chromatographic dual-channel test strip, left to stand for 5 minutes, and the test strip is observed in a UV analyzer. Channel 1 shows negative and channel 2 shows negative, indicating that there is no virus in the sample to be tested.

[0104] The DNA of the hepatitis B pseudovirus was extracted using a DNA column extraction kit, and then the extracted DNA stock solution was diluted to 1×10 3 copy / ml, drop it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, and observe the test strip in the UV analyzer. Channel 1 shows negative and channel 2 shows positive, which indicates that there are viruses in the sample to be tested, but they are all dead viruses.

[0105] The DNA stock solution extracted in the previous step was mixed with the pseudovirus stock solution at a ratio of 1:1, and then the mixture was diluted to 1×10 3 copy / ml, drop it on the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows positive, channel 2 shows positive, the test result of the sample is pending, and subsequent operations are required; transfer all the liquid in the eluent 1 bottle to the eluent 2, incubate at 37°C for 20 minutes, add eluent 3 to eluent 2 after the reaction, incubate at 55°C for 1 hour, drop the treated sample solution on the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows negative, channel 2 shows positive, which indicates that there are live viruses in the original sample to be tested, both live viruses and dead viruses.

[0106] The commercially available hepatitis B virus surface antigen (HBsAg) serum (liquid) standard material (Guangzhou Bondeson Biotechnology Co., Ltd., GBW(E)090841) was mixed with the DNA stock solution extracted in the previous step at a ratio of 1:1, and then the mixture was diluted to 1×10 3 copy / ml (in terms of DNA copy number), drip it onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows positive, channel 2 shows positive, the test result of the sample is pending, and subsequent operations are required; transfer all the liquid in the eluent 1 bottle to the eluent 2, incubate at 37°C for 20 minutes, add eluent 3 to eluent 2 after the reaction is completed, incubate at 55°C for 1 hour, drip the treated sample solution onto the sample pad of the chromatographic dual-channel test strip, let it stand for 5 minutes, observe the test strip in the UV analyzer, channel 1 shows negative, channel 2 shows negative, so it indicates that there are viruses in the sample to be tested, but they are all dead viruses. The above experiment proves that the results are correct by infecting cells with pseudoviruses.

Claims

1. A live / dead virus determination system based on molecular capture technology, characterized in that: The system comprises: sample eluents with different components, a dual-channel chromatography test strip and ultraviolet analysis equipment; the sample eluents with different components are water, DNase solution and proteinase K solution respectively; the dual-channel chromatography test strip has two channels respectively comprising nucleic acid aptamer hydrogel microspheres and molecular beacons.

2. The live / dead virus determination system based on molecular capture technology according to claim 1, characterized in that: The sample eluents of different components preferably include sample eluent 1, sample eluent 2 and sample eluent 3, wherein the sample eluent 1 is DEPC water, the sample eluent 2 is a DNase solution with a concentration of 800-1200U, and the sample eluent 3 is a proteinase K solution with a concentration of 100-500μg / ml.

3. The live / dead virus determination system based on molecular capture technology according to claim 1, characterized in that: The dual-channel chromatographic test strip comprises a chromatographic test strip channel 1 and a chromatographic test strip channel 2, wherein the chromatographic test strip channel 1 comprises nucleic acid aptamer hydrogel microspheres, fluorescein-labeled rabbit IgG, goat anti-rabbit IgG polyclonal antibody GAR, a backing, a nitrocellulose membrane, a sample pad, a release pad and absorbent paper; and the chromatographic test strip channel 2 comprises a molecular beacon, fluorescein-labeled rabbit IgG, goat anti-rabbit IgG polyclonal antibody GAR, a backing, a nitrocellulose membrane, a sample pad, a release pad and absorbent paper.

4. The live / dead virus determination system based on molecular capture technology according to claim 1, characterized in that: The ultraviolet analysis device is a dark box with a wavelength of 365 nm and an observation port, and the fluorescence of the chromatography test strip can be observed through the observation port.

5. The live / dead virus determination system based on molecular capture technology according to claim 1, characterized in that: The oligonucleotide aptamers in the nucleic acid aptamer hydrogel microspheres are fluorescently modified, and the modified quantum dot excitation wavelength is 365nm. The nucleic acid aptamers target specific proteins on the surface of the virus to be detected; and the molecular beacons target specific nucleic acid fragments inside the virus to be detected.

6. The live / dead virus determination system based on molecular capture technology according to claim 5, characterized in that: The nucleic acid aptamer in the nucleic acid aptamer hydrogel microspheres has been modified with fluorescein, but after the hydrogel microspheres are formed, the nucleic acid aptamer is wrapped in the hydrogel and cannot fluoresce. After binding with the corresponding target, it will be pulled out of the hydrogel microspheres by the target molecules and then fluoresce after being excited.

7. The live / dead virus determination system based on molecular capture technology according to claim 5, characterized in that: The excitation wavelength of the fluorescent label of the molecular beacon is 365 nm.

8. Use of the live / dead virus determination system based on molecular capture technology as claimed in claim 1 for rapid detection of live / dead DNA viruses in in vitro samples.

9. The use according to claim 8, characterized in that: The in vitro samples include cold chain food and packaging, logistics goods, medical devices and biological products.

10. The use according to claim 8 is characterized in that The detection process is as follows: Sampling is done in sample eluent 1. After sufficient elution, sample eluent 1 is dripped onto the sample pads in the two channels of the chromatography test strip. The color development results of the two channels are observed in a dark box UV analyzer: (1) If channel 1 is positive and channel 2 is positive, the test result is pending and the following test steps are performed: a. Add sample eluent 2 to the sample eluent 1 after sampling, and shake to mix; b. After shaking, add the sample eluent 3 into it. Heat and shake to mix; c. Drop the processed sample eluate onto a new chromatography test strip. If channel 1 is negative and channel 2 is positive, it indicates that there are live viruses in the original sample to be tested, and both live viruses and dead viruses exist; if channel 1 is negative and channel 2 is negative, it indicates that the viruses in the original sample to be tested are all dead viruses; if channel 1 is positive, the result is invalid; (2) If channel 1 is positive and channel 2 is negative, it indicates that live virus is present in the sample to be tested; (3) If channel 1 is negative and channel 2 is positive, it means that there are viruses in the sample to be tested, but they are all dead viruses; (4) If channel 1 is negative and channel 2 is negative, it means that there is no virus in the sample to be tested; (5) In each test, the C lines of all channels should show fluorescence. If there is no fluorescence, the test is invalid.

Images