Double-drug nanoparticle for treating Alzheimer's disease as well as preparation method and application of double-drug nanoparticle

Abstract

The invention belongs to the technical field of biological medicine, and discloses a double-drug nanoparticle for treating Alzheimer's Disease and a preparation method and application thereof.The preparation method comprises the steps that an A beta inhibitor is connected to an amphiphilic polymer through chemical bonds, the amphiphilic polymer connected with the A beta inhibitor and an STING inhibitor are mixed, the mixture is slowly dropwise added into water under ultrasound, and the mixture is stirred to be uniform; the prepared double-drug nanoparticles have good biocompatibility and stability, can penetrate through a blood brain barrier and simultaneously act on A beta and a microglial cell STING pathway, depolymerize A beta, promote A beta removal, inhibit microglial cell STING pathway activation and reduce neuron damage caused by inflammatory factor release. The compound can obviously reduce A beta deposited in the brain and obviously inhibit activation of microglial cell STING pathways in the brain, obviously improves the memory ability and space recognition ability of mice, and improves the brain inflammatory microenvironment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a pharmaceutical composition containing a STING inhibitor, a preparation method thereof, and an application thereof in the treatment of Alzheimer's disease. Background Art

[0002] Alzheimer's disease (AD) is a neurodegenerative disease with insidious onset. Its clinical manifestations include cognitive dysfunction and gradual loss of independence in daily life. It is one of the most difficult diseases to cure in the world. In 2021, there were 16.99 million AD patients in my country, accounting for about 29.8% of the global total number of patients. With the aging of the population, the incidence of AD will further increase year by year, and it is estimated that the number of patients worldwide will reach 78 million in 2030. Studies have shown that the pathological characteristics of AD mainly include: cholinergic neurodegeneration, extracellular aggregation of amyloid protein (Aβ) to form senile plaques (Aβ plaques), brain inflammatory environment and neurofibrillary tangles.

[0003] The pathogenesis of AD is relatively complex and may be the result of the interaction of multiple factors. Among them, the "Aβ cascade hypothesis" is considered to be the most classic AD pathogenesis, that is, the neurons in the brain of AD patients produce amyloid precursor protein, which is mistakenly sheared by β-secretase and γ-cleavage enzyme to generate Aβ monomers, which are secreted into the extracellular aggregates to form Aβ aggregates, and eventually evolve into insoluble fibers and plaques, causing neurotoxicity. Aβ monoclonal antibodies are a major breakthrough in the development of AD drugs, which can target and remove toxic Aβ aggregates. Aβ targeting peptides have the function of targeting and dissociating Aβ aggregates similar to Aβ monoclonal antibodies, and some targeting peptides can even inhibit Aβ aggregation. Because of their low price and simple preparation process, they have become a hot research object for the treatment of AD drugs. Recent clinical experimental results show that although Aβ monoclonal antibodies and Aβ targeting peptides can reduce Aβ plaques in the brain, they do not show obvious inhibitory effects on brain inflammation in the late stage of AD. Further mechanistic studies have shown that Aβ targeting peptides can enhance the ability of Aβ to be taken up by microglia. When microglia take up too much Aβ but cannot effectively degrade it, they will activate the stimulator of interferon genes (STING), thereby causing the release of downstream inflammatory factors.

[0004] The interferon gene stimulator (STING) is a core family member of the immune system to resist pathogen invasion. It recognizes exogenous double-stranded DNA in the cytoplasm through the upstream cyclic GMP-AMP synthase (cGAS), activates the STING protein, recruits serine threonine protein kinase (TBK1), activates downstream interferon regulatory factor 3 (IRF3), and induces the secretion of IFN-I and various pro-inflammatory factors. A large number of recent studies have shown that the degree of DNA breakage in the brain of spontaneous AD mouse models is increased, and the cGAS-STING signaling pathway is abnormally activated.

[0005] When microglia take in excessive amounts of Aβ, they may damage mitochondria and cause mitochondrial DNA (mtDNA) leakage. After entering the cytoplasm, mtDNA binds to cGAS to form cGAMP. As an agonist of STING, cGAMP activates the STING protein, causing a series of downstream reactions and generating a large number of inflammatory factors. Inflammatory factors secreted into the extracellular space cause neuronal inflammatory toxicity and further damage microglia. At present, many drugs that inhibit inflammation in the brain with preclinical benefits have been reported, some of which have entered clinical trials, but no STING inhibitors with proven efficacy have been marketed. Based on the key role of the cGAS-STING signaling pathway in inflammation, the development of various STING inhibitors is also considered a promising AD treatment strategy.

[0006] STING inhibitors mainly include covalent inhibitors and non-covalent inhibitors. Covalent inhibitors bind to the Cys88 or Cys91 residues in the transmembrane region of the STING protein, blocking the palmitoylation of STING, thereby inhibiting the activation of STING. Another type of non-covalent inhibitor targets the C-terminal ligand binding region of STING, competitively binds to the endogenous ligand of STING, and inhibits the activation of downstream signaling pathways mediated by STING. STING inhibitors have shown promise as AD therapeutic agents in preclinical studies, but many of its drugs, such as H151, have problems such as poor water solubility, easy degradation, and poor BBB penetration, and need to be improved through certain pharmaceutical methods.

[0007] Therefore, there is an urgent need to address the inflammatory environment caused by the Aβ cascade mechanism that causes AD and the abnormal activation of STING in the brain. Summary of the invention

[0008] The purpose of the present invention is to address the deficiencies in the prior art and to provide a dual-drug nanoparticle for the treatment of Alzheimer's disease and a preparation method and application thereof, which improves the memory ability and spatial recognition ability of mice, improves the inflammatory microenvironment of the brain, and provides favorable conditions for targeting the microglial STING pathway and promoting Aβ clearance to treat Alzheimer's disease.

[0009] In order to achieve the above object, the present invention is achieved through the following technical solutions:

[0010] In a first aspect, the present invention provides a dual-drug nanoparticle comprising an Aβ inhibitor, a STING inhibitor and an amphiphilic polymer, wherein the Aβ inhibitor is selected from an Aβ antibody or a hydrophobic targeting peptide and its derivatives that dissociate and inhibit Aβ aggregation, and the STING inhibitor is a STING covalent inhibitor H151.

[0011] Preferably, the Aβ inhibitor is Aβ 42The core hydrophobic region of the GKLVFF polypeptide.

[0012] Preferably, the amphiphilic polymer is PEPA.

[0013] Preferably, the mass ratio of the amphiphilic polymer to the STING inhibitor is 10:1-3; the molar mass ratio of the amphiphilic polymer to the Aβ inhibitor is 1:2-5.

[0014] In a second aspect, the present invention provides a method for preparing dual-drug nanoparticles, which is as follows: an Aβ inhibitor is chemically linked to an amphiphilic polymer, the amphiphilic polymer linked to the Aβ inhibitor and a STING inhibitor are mixed, and the mixture is slowly dropped into water under ultrasound, and then the upper layer is taken by ultrasound and filtration to obtain the dual-drug nanoparticles.

[0015] Preferably, it is characterized in that the method specifically comprises:

[0016] Step (1), weigh 6.30 mg EDC, 1.51 mg NHS, and 0.825 mg TK, dissolve in 200 μL DMF, vortex until completely dissolved, then magnetically stir and activate in an ice bath for 3 h;

[0017] Step (2), synthesizing PEPA-AMA by atom transfer radical polymerization;

[0018] Step (3), weigh 10 mg of PEPA-AMA and dissolve it in 100 μL of DMF, vortex until completely dissolved, mix it with the system in step (1), and react it in a metal bath at 43° C. for 24 h;

[0019] Step (4), diluting the mixed system in step (3) with 2.1 mL of methanol, centrifuging, absorbing the upper liquid, and removing the remaining methanol by reduced pressure distillation at 90 rpm and 49° C. to obtain PEPA-TK;

[0020] Step (5), weigh 2.33 mg of GKLVFF polypeptide, dissolve it in 200 μL of DMF and mix it with the PEPA-TK liquid in step (4), and react in a metal bath at 43° C. with magnetic stirring for 24 h;

[0021] Step (6), diluting the mixed system in (5) with 2.0 mL of methanol, centrifuging, collecting the liquid, which is PEPA-G, and setting the concentration to 10 mg / mL using methanol;

[0022] Step (7), weigh 1 mg of H151, dissolve it in DMSO, mix the H151 solution and the PEPA-G solution in step (6) evenly, and drop the mixed solution dropwise into 3 mL of ultrapure water in an ice bath under probe ultrasound to form uniform drug-loaded micelles; centrifuge to remove methanol, make the inner tube micelles constant with ultrapure water, and retain the outer tube solution to obtain dual-drug nanoparticles.

[0023] In a third aspect, the present invention provides a pharmaceutical composition comprising the dual-drug nanoparticles described above.

[0024] In a fourth aspect, the present invention provides use of the dual-drug nanoparticles or the pharmaceutical composition in the preparation of a drug for treating Alzheimer's disease.

[0025] The present invention has the following beneficial effects: (1) The dual-drug nanoparticles of the present invention encapsulate the nanocarriers of the two therapeutic drugs and can dissociate Aβ aggregates in the brain, reduce extracellular Aβ plaques, and can achieve the combined administration of dual targets of inhibiting the STING pathway and reducing Aβ, thereby reducing the brain inflammatory environment and Aβ plaques; achieving the co-delivery of the two drugs to the brain and improving their combined therapeutic effect will likely lead to a breakthrough in the clinical effect of Aβ targeting peptides and STING inhibitors in the treatment of AD.

[0026] (2) The dual-drug nanoparticles (H151@PEPA-G) described in the present invention use the amphiphilic nanomaterial PEPA as a carrier, which greatly increases the binding strength and drug loading of STING inhibitors (such as H151) and Aβ targeting peptides (such as GKLVFF) in the nanoparticles, forming nanoparticles with extremely small particle sizes, thereby avoiding the extracellular degradation of the two gene drugs.

[0027] (3) The dual-drug nanoparticles described in the present invention improve the properties of free H151 and GKLVFF, increase their stability, prolong their retention time in the brain, and enhance the therapeutic effect.

[0028] (4) The dual-drug nanoparticles described in the present invention can dissociate Aβ fibers, inhibit Aβ aggregation, and reduce the accumulation of extracellular Aβ fibers and plaques.

[0029] (5) The dual-drug nanoparticles described in the present invention can inhibit the activation of the STING pathway in microglia, reduce the production of CXCL-9, CXCL-10 and IFN-β downstream of the STING pathway, and then reduce the production of downstream IL-6, IL-1β and TNF-α.

[0030] (6) The dual-drug nanoparticles described in the present invention can improve the memory ability of 5xFAD (spontaneous AD mice) and improve cognitive impairment. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1Preparation process of the dual-drug nanoparticle H151@PEPA-G prepared in Example 1 of the present invention ( Figure 1 -A) and particle size distribution diagram ( Figure 1 -B);

[0032] Figure 2 is the in vitro cumulative release curve of H151 and GKLVFF in Example 2 of the present invention ( Figure 2 -A is the in vitro cumulative release curve of H151; Figure 2 -B is the in vitro cumulative release curve of GKLVFF), one-way ANOVA, mean ± SEM. **P < 0.01, ***P < 0.001, and ****P < 0.0001;

[0033] Figure 3 Figure 2 shows the in vitro hemolysis test of the dual-drug nanoparticles H151@PEPA-G prepared in Example 1 at different concentrations ( Figure 3 -A) and toxicity test on microglial cells BV2 ( Figure 3 -B);

[0034] Figure 4 The in vivo brain imaging and ex vivo brain imaging of mice 24 hours after tail vein administration of DIR@PEPA-G in Example 4 of the present invention ( Figure 4 -A) and confocal imaging of C6@PEPA-G uptake by cells ( Figure 4 -B);

[0035] Figure 5 FRET experimental results of the affinity of PEPA-G and the like for Aβ fibers in Example 5 of the present invention ( Figure 5 -A) and the results of ThT fluorescence experiment of dissociated Aβ fibers ( Figure 5 -B), affinity FRET experiment results for Aβ monomer ( Figure 5 -C) and the results of ThT fluorescence experiment on inhibiting Aβ monomer aggregation ( Figure 5 -D);

[0036] Figure 6 In Example 6 of the present invention, the in vitro cell ( Figure 6 -A) and in vivo 5xFAD mouse hippocampus ( Figure 6 -B) Statistical graph of STING-related gene expression levels, using one-way ANOVA, mean ± SEM. **P < 0.01, ***P < 0.001, and ****P < 0.0001;

[0037] Figure 7This is a statistical diagram of the expression level of inflammatory factors in the hippocampus of 5xFAD mice in Example 7 of the present invention, using one-way ANOVA, mean±SEM. **P<0.01, ***P<0.001, and ****P<0.0001;

[0038] Figure 8 This is a representative diagram of the nesting experiment of WT and 5xFAD mice in Example 8 of the present invention ( Figure 8 -A) and scoring result statistics ( Figure 8 -B), one-way ANOVA, mean±SEM. **P<0.01, and ****P<0.0001;

[0039] Fig. 9 This is a representative diagram of the Morris water maze experiment of WT and 5xFAD mice in Example 8 of the present invention ( Fig. 9 -A), training latency mice ( Fig. 9 -B), test latency ( Fig. 9 -C), the number of times you cross the platform ( Fig. 9 -D) and target quadrant time ( Fig. 9 -E) Statistical graph of the results, using one-way ANOVA, mean±SEM. **P<0.01, and ****P<0.0001. DETAILED DESCRIPTION

[0040] The present invention will be further described below in conjunction with the embodiments, but they are not intended to limit the present invention.

[0041] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention is further described in detail below in conjunction with specific examples and accompanying drawings, and with reference to data. It should be understood that this embodiment is only for the purpose of illustrating the present invention, and is not intended to limit the scope of the present invention in any way. In the following examples, the various processes and methods not described in detail are conventional methods well known in the art. The materials, reagents, devices, instruments, equipment, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0042] GKLVFF was purchased from Nanjing Jiepeptide Biotechnology Co., Ltd.

[0043] H151 was purchased from MedChemExpress.

[0044] 1-Ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) was purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0045] N-Hydroxysuccinimide (NHS) was purchased from Bidex Pharmaceutical Technology Co., Ltd.

[0046] 3,3'-(Propane-2,2-diylbis(sulfanediyl))dipropionic acid (TK) was purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0047] PEPA-AMA was synthesized by atom transfer radical polymerization.

[0048] Example 1

[0049] Preparation of coupled peptide drug-loaded nanomicelles H151@PEPA-G:

[0050] (1) Accurately weigh 6.30 mg of EDC, 1.51 mg of NHS, and 0.825 mg of 3,3'-(propane-2,2-diylbis(sulfanediyl))dipropionic acid (TK) and dissolve them in 200 μL of N,N-dimethylformamide (DMF). Vortex to completely dissolve. Stir magnetically and activate on ice for 3 h.

[0051] (2) Dissolve 2-(propylamino)ethanol in acetonitrile, then add potassium carbonate, ethyl bromide and potassium iodide in sequence, raise the temperature to 78°C, and react for 24 hours; post-treatment: remove acetonitrile by suction filtration and rotary evaporation, add water, saturated sodium bicarbonate aqueous solution, saturated sodium chloride aqueous solution, extract with ethyl acetate, and rotary evaporation to obtain EPA (2-(ethylpropylamino)ethanol).

[0052] (3) Methacryloyl chloride was dissolved in 30 ml of mass spectrometry grade dichloromethane (DCM), and EPA, Et3NHCl, and 2,6-di-tert-butyl-p-cresol were dissolved in 170 ml of mass spectrometry grade DCM. Methacryloyl chloride dissolved in DCM was slowly added dropwise to the above mixed solution under stirring in an ice bath, and the mixture was acylated in an ice bath for 6 hours to obtain a yellow solid. Solid impurities were filtered out, and the filtrate was transferred to a rotary evaporator and dried to obtain a milky white solid with a slight yellow color. After drying, ethyl acetate was added to completely dissolve the solid, and then saturated NaHCO3 was added to extract twice, and the ethyl acetate phase was extracted again with saturated NaCl, and the ethyl acetate phase was dried to obtain a transparent liquid. The liquid was distilled to obtain EPA-MA. EPA-MA (0.43 g, 2 mmol), PMDETA (12 μL, 0.05 mmol), MeO-PEO113-Br (0.25 g, 0.05 mmol), AMA (2-aminoethyl methacrylate hydrochloride, 0.1 mmol) were loaded into a polymerization tube, and a mixture of 2-propanol (1 mL) and DMF (1 mL) was then added to dissolve the above solids. After three cycles of freeze-pump-thaw deoxygenation, CuBr (7 mg, 0.05 mmol) was added to the polymerization tube under a nitrogen atmosphere, and the tube was vacuum sealed. The polymerization was carried out at 40° C. for 8 hours. After polymerization, the reaction mixture was diluted with 10 mL of THF and the catalyst was removed by a neutral Al2O3 column. The THF solvent was removed by rotovap. The residue was dialyzed in distilled water and freeze-dried to obtain a white powder, which was PEPA-AMA.

[0053] (4) Accurately weigh 10 mg of PEPA-AMA and dissolve it in 100 μL of DMF. Vortex it to completely dissolve, mix it with the system in (1), and react it in a metal bath at 43°C for 24 h.

[0054] (5) The mixed system in (4) was diluted with 2.1 mL of methanol (7 times), and the liquid was transferred to the inner tube of a 10k ultrafiltration tube. The mixture was centrifuged at 3500 rpm for 40 min, and the inner tube liquid was transferred to a 5 mL EP tube. The remaining methanol was removed by reduced pressure distillation at 90 rpm and 49 °C to obtain PEPA-TK.

[0055] (6) Accurately weigh 2.33 mg of GKLVFF polypeptide and dissolve it in 200 μL of DMF. Mix it with the remaining PEPA-TK liquid in the above (5) and react in a metal bath at 43°C with magnetic stirring for 24 h.

[0056] (7) Dilute the mixed system in (6) with 2.0 mL of methanol (7 times), transfer the liquid to the inner tube of a 10k ultrafiltration tube, centrifuge at 3500 rpm for 40 min, collect the remaining liquid in the inner tube as PEPA-G, and set the concentration to 10 mg / mL using methanol.

[0057] (8) Accurately weigh 1 mg of H151 and dissolve it in an appropriate amount of DMSO (vortex to completely dissolve it). Mix the H151 solution with the PEPA-G solution in (7) above. Under the condition of probe ultrasound, drop the mixed solution drop by drop into 3 mL of ultrapure water in an ice bath to form uniform drug-loaded micelles. Use a 10k ultrafiltration tube and centrifuge at 3500 rpm for 30 minutes to remove methanol. Make the inner tube micelles constant with ultrapure water and retain the outer tube solution to obtain H151@PEPA-G. The schematic diagram of nanomicelle preparation is shown in the figure. Figure 1 shown.

[0058] The particle size was measured by Malvern particle size analyzer to investigate the micelle morphology and the encapsulation efficiency and drug loading were investigated by high performance liquid chromatography (HPLC). The results showed that the particle size was 24 nm ( Figure 1 -B), PDI is less than 0.02, zeta potential is +20mV, HPLC is used to detect the H151 content in the outer tube solution and the micelle solution after demulsification, and the H151 drug loading is calculated to be 8% and the encapsulation efficiency is 85%.

[0059] Example 2 Investigation of in vitro release characteristics of H151@PEPA-G nanomicelles

[0060] The nanomicelles H151@PEPA-G prepared in Example 1 were added to a dialysis bag (MW: 3500), placed in a 50 mL centrifuge tube, and 20 mL of pH 7.4 PBS and pH 5.4 PBS were added respectively. H151 was released in a shaker at 37°C. 200 μL of release solution was taken at 0, 1, 2, 3, 4, 8, 10, 12, 24, 30, 36, 48, 60, 72, and 96 h, respectively, and 200 μL of release medium was added. The H151 content was determined by HPLC, and the release curve was drawn.

[0061] The results are as follows Figure 2 As shown, the in vitro release of H151 is pH responsive. Under acidic conditions, drug release is accelerated and the total release amount increases, which is related to the transition point of the pH-responsive material PEPA. The release of H151 peaked at 72h, releasing more than 80% of the drug, indicating that H151 can be released smoothly in vitro and the nanomicelles have sustained release characteristics. In addition, the release efficiency of GKLVFF from the micelles is less than 5%, indicating that GKLVFF is stably connected to the micelles.

[0062] Example 3 Investigation of the in vitro safety of H151@PEPA-G nanomicelles

[0063] Take 0.5mL of fresh rat (6-8 weeks, SD rat, 180-220g, Vital River) blood, add 0.5mL of 5% glucose injection solution and mix evenly, wash the blood cell precipitate repeatedly until the red color in the supernatant disappears. Take 0.1mL of blood cell precipitate and add glucose injection solution to obtain 2% red blood cell suspension. Mix 1, 4, 16, 128, 256μg / mL H151@PEPA-G 5% glucose injection solution with 2% red blood cell suspension in equal volumes, let stand for 1h to observe hemolysis, and detect hemolysis status by multifunctional microplate reader.

[0064] Microglial BV2 cells were cultured in 96-well plates in vitro. When the cell density reached 50%, the preparations were co-cultured with microglial cells in serum-free medium at concentrations of 0, 1, 4, 16, 64, 128, and 256 μg / mL for 24 h, respectively. 10 μL of CCK-8 solution was added to each well and incubated at 37°C, 5% CO2 for 2 h. The absorbance (OD) at 450 nm was measured using a multifunctional microplate reader.

[0065] The results are as follows Figure 3 As shown, different concentrations of nanomicelles did not cause hemolysis, and different concentrations of micelle preparations had no obvious cytotoxicity. Even at 256 μg / mL, the survival rate of microglia was still 90%.

[0066] Example 4 Investigating the ability of H151@PEPA-G nanomicelles to enter the brain and be taken up by cells

[0067] DIR@PEPA-G (DIR encapsulated in PEPA-G) was prepared according to the method of Example 1 and administered (containing 1 μg DIR) to AD mice through the tail vein. After 24 hours, the fluorescence of the mouse brain was detected in vivo using in vivo imaging (Tanon-ABLX6). The brain of the mouse was then removed and the fluorescence intensity of the brain was detected in vitro ( Figure 4 -A).

[0068] 1 mg of PEPA-G and an appropriate amount of C6 were dissolved in methanol, and added dropwise into ultrapure water under 80W ultrasonic conditions using an ultrasonic cell disruptor in an ice bath to form C6@PEPA-G nanomicelles. The methanol was removed by centrifugation at 3500 rpm for 30 min, and the volume was fixed with ultrapure water.

[0069] bEnd3 cells were plated in the upper chamber of the transwell plate, and the resistance was measured every day. When the resistance was stable at about 300Ω, microglial cells BV2 were plated in the lower chamber. When the cells grew to a density of 50%, 500 μL of C6@PEPA-G nanomicelles resuspended in incomplete culture medium (MEM gibco) was added to the upper chamber of each well. After incubation in the dark for 3 hours, the cells in the lower chamber were collected and washed 3 times with PBS; polyformaldehyde was added to fix for 10 minutes, and the supernatant was aspirated and washed 3 times with PBS; diluted HOECHST 33342 was added for staining for 10 minutes. Anti-fluorescence quencher was added, and the C6 and HOECHST 33342 channels of the laser confocal (LSM800) were turned on and observed under a microscope. The confocal results are shown in Figure 2. Figure 4 -B, intracellular fluorescence was obvious after 3 h, indicating that the micelle preparation could cross the blood-brain barrier and be taken up by cells.

[0070] Example 5 Investigating the affinity, disaggregation and aggregation inhibition ability of H151@PEPA-G nanomicelles for Aβ in vitro

[0071] H151@PEPA-G, Aβ monomer (mAβ), and GKLVFF were coupled with the fluorescent group Cy5, and another part of Aβ fiber (oAβ) was coupled with the paired fluorescent group Cy3. The subject with Cy5 was co-incubated with the guest oAβ-Cy3 for 4 hours. The fluorescence resonance energy transfer (FRET) experiment was performed and the fluorescence of Cy5 was detected using a multifunctional microplate reader. When the distance between GKLVFF-Cy3 and Aβ-Cy5 was less than 10nm, a FRET effect would occur, reflecting the intermolecular affinity between GKLVFF and Aβ fiber. Similarly, Aβ monomer (mAβ) was prepared by coupling the paired fluorescent group Cy3, and the subject with Cy5 was co-incubated with the guest mAβ-Cy3 to detect the affinity of each substance with mAβ.

[0072] The H151@PEPA-G nanomicelles were incubated with aggregated Aβ and monomeric Aβ at 37°C and 200 rpm for 24 h, respectively. The ThT fluorescence intensity was detected on a multifunctional microplate reader (ex 450 nm, em 485 nm) to determine the degree of Aβ aggregation.

[0073] The results are as follows Figure 5 As shown, Figure 5 -A, 5-B show that the fluorescence intensity of Cy5 in H151@PEPA-G nanomicelles is stronger than that of Aβ aggregates, and the fluorescence intensity of ThT after co-incubation of H151@PEPA-G nanomicelles and Aβ aggregates is lower, indicating that H151@PEPA-G nanomicelles have better affinity with Aβ aggregates and can disaggregate Aβ aggregates; Figure 5-C, 5-D show that the fluorescence intensity of Cy5 in H151@PEPA-G nanomicelles is stronger than that of Aβ monomers, and the ThT fluorescence intensity of the co-incubation system of H151@PEPA-G nanomicelles and Aβ monomers is lower, indicating that the nanomicelles inhibit the re-aggregation of Aβ monomers and disaggregates.

[0074] Example 6 Investigating the inhibition of STING activation by H151@PEPA-G nanomicelles in vivo and in vitro

[0075] Microglial BV2 cells were added with 5 μM Aβ aggregates, and PEPA-G micelles, 5 μM H151 or H151@PEPA-G micelles were added and treated for 24 h, and then the intracellular RNA was extracted. The qPCR detection method was used to configure the reaction body according to the instructions of the kit (Universal Blue qPCR SYBR Green Master Mix, Novozymes Biotech Co., Ltd.) to detect the expression levels of IFN-β, CXCL-9, and CXCL-10 genes in the cells.

[0076] H151@PEPA-G nano-micelles, H151@PEPA micelles, PEPA-G micelles, and PBS were injected into the tail vein (100 μL, 1 mg / mL) of 4-month-old 5xFAD mice (Alzheimer's disease transgenic mice, Ai Ling Fei Biotechnology Co., Ltd.) and wild-type mice (WT) every three days for 9 times. The brain of each mouse was removed and the hippocampus was isolated, and the tissue homogenate was frozen and ground respectively. The qPCR detection method was used to configure the reaction body according to the instructions of the kit to detect the expression levels of IFN-β, CXCL-9, and CXCL-10 genes in the hippocampus.

[0077] The reaction procedure is shown in Table 1:

[0078] Table 1 Reaction procedure

[0079]

[0080]

[0081] Primer sequences:

[0082] IFN-β:

[0083] Forward primer (SEQ ID NO: 1): GCCTTTGCCATCCAAGAGATGC

[0084] Reverse primer (SEQ ID NO: 2): ACACTGTCTGCTGGTGGAGGTC

[0085] CXCL-9:

[0086] Forward primer (SEQ ID NO: 3): GGAGTTCGAGGAACCCTAGTG

[0087] Reverse primer (SEQ ID NO: 4): GGGATTTGTAGTGGATCGTGC

[0088] CXCL-10:

[0089] Forward primer (SEQ ID NO: 5): ATCATCCCTGCGAGCCTATCCT

[0090] Reverse primer (SEQ ID NO: 6): GACCTTTTTTGGCTAAACGCTTTC

[0091] GAPDH:

[0092] Forward primer (SEQ ID NO: 7): GCCTCAAGATCATCAGCAAT

[0093] Reverse primer (SEQ ID NO: 8): TTCAGCTCAGGGATGACCTT

[0094] The above primers were from Shanghai Sangon Biotechnology Co., Ltd.

[0095] The results are as follows Figure 6 As shown, Figure 6 -A is the data of the inhibition of STING pathway activation caused by Aβ by agent 1 in vitro, showing the gene expression levels of CXCL-9, CXCL-10 and IFN-β Figure 6 -B is the gene expression level detected after extraction from the mouse hippocampus in vivo. Whether in cells or in the hippocampus, free H151 or nano-micelles containing H151 were significantly downregulated compared with the Control (PBS injection group), with CXCL-9 levels in the hippocampus decreasing by 5 times, CXCL-10 levels decreasing by 2 times, and IFN-β levels decreasing by 3 times. There was no significant STING inhibitory effect in the PEPA-G group. This suggests that GKLVFF can significantly inhibit the STING pathway in Alzheimer's disease only when it is used in combination with the STING inhibitor H151 in vivo.

[0096] Example 7 Investigating the ability of H151@PEPA-G nanomicelles to inhibit the release of inflammatory factors

[0097] Microglial cells BV2 were treated with 5 μM Aβ fibers and PEPA-G micelles, 5 μM H151 or H151@PEPA-G micelles for 24 hours and then the intracellular RNA was extracted. The qPCR detection method was used to detect the expression levels of IL-6, IL1-β, and TNF-α genes in the cells.

[0098] The hippocampus of each group of mice in Example 6 was taken, frozen and ground into tissue homogenate, centrifuged at 5000g for 5 minutes, and the supernatant was added to the Elisa plate (IL-6, IL1-β, TNF-α) pre-coated with capture antibodies. A series of standards of known concentrations were added to some wells, and each well was incubated for 24 hours. After that, secondary antibodies and HRP were added for color development, and the absorbance of each well was measured in turn at a wavelength of 450nm using an enzyme reader, and the amount of each inflammatory factor was quantitatively analyzed by labeling.

[0099] The results of ELISA are as follows Figure 7 -B, H151@PEPA-G nanomicelles and H151@PEPA micelles significantly reduced the concentration of inflammatory factors in the hippocampus. It may be that H151 inhibited the STING pathway of microglia and reduced the release of inflammatory factors. The amount of inflammatory factors released from the hippocampus of mice treated with H151@PEPA-G nanomicelles was less than that of H151@PEPA, indicating that GKLVFF further reduced the activation of microglia by Aβ.

[0100] Example 8 Investigating the effect of H151@PEPA-G nanoparticles in treating Alzheimer's disease

[0101] 5xFAD mice were treated according to the grouping (10 mice per group) and administration method of Example 6. After the administration, mice in each group were placed in a cage and a paper towel (5 cm×5 cm) was placed in it. The mice were taken out after 24 hours, and the degree of tearing of the towel was photographed. Ten independent researchers who did not participate in the test were invited to score according to a 5-point system, where 0 points: the towel had no signs of tearing and appeared intact; 1 point: the towel had signs of partial tearing; 2 points: the towel was torn into large pieces, but not gathered; 3 points: the towel was torn into large pieces and gathered; 4 points: the towel was torn into small pieces and gathered; 5 points: the towel was torn into pieces and gathered very well, forming a perfect nest.

[0102] Each mouse was subjected to the Morris water maze test, and the whole process included three parts: Day 1: The mouse was placed in a pool (a circular pool with a diameter of 120 cm and a depth of 50 cm) to familiarize the environment (1 min). Day 2-6: A 5-day training phase, in which the pool was divided into four quadrants, and a platform was placed 1 cm below the water in the third quadrant. The mouse was placed in the pool from each quadrant to explore for 60 seconds to find the platform and stayed for 5 seconds. The mouse that did not find the platform was given guidance and stayed on the platform for 15 seconds. The trajectory, number of times the platform was crossed, and the latency were recorded. Day 7: During the test phase, the platform was removed. The swimming trajectory, crossing time, and time in the target quadrant of the mouse were collected and analyzed by instruments.

[0103] The results of the nesting experiment are as follows Figure 8As shown, the nests of H151@PEPA-G nanomicelles and H151@PEPA micelles are more beautiful and have higher scores, which are significantly higher than those of the PEPA-G micelle group, but the effect of H151@PEPA-G nanomicelles is better than that of H151@PEPA micelles, indicating that the combined effect of GKLVFF and STING inhibitor H151 in the treatment of Alzheimer's disease is better.

[0104] The results of the Morris water maze are as follows Fig. 9 As shown in Figure 10, the number of times the mice in the H151@PEPA-G nano-micelle and H151@PEPA micelle groups crossed the platform, the platform quadrant residence time, and the latency were significantly better than those in the PEPA-G micelle group, but the effect of the H151@PEPA-G nano-micelle was better than that of the H151@PEPA micelle, indicating that the combined use of GKLVFF and the STING inhibitor H151 reduced the Aβ aggregated and deposited in the brain, accelerated the degradation and clearance of Aβ by microglia, and inhibited the activation of the STING pathway in the brain to reduce the release of inflammatory factors by microglia to damage neurons. This provides useful help for the treatment of Alzheimer's disease.

[0105] The present invention constructs a nanoparticle H151@PEPA-G coupled with a GKLVFF polypeptide and encapsulating a STING inhibitor H151, which has good biocompatibility and stability. H151@PEPA-G can cross the blood-brain barrier and simultaneously act on the Aβ and microglial STING pathways, depolymerize Aβ and promote Aβ clearance, inhibit the activation of the microglial STING pathway, and reduce the release of inflammatory factors to damage neurons. In the Alzheimer's transgenic 5xFAD mouse model, H151@PEPA-G can significantly reduce the Aβ deposited in the brain and significantly inhibit the activation of the microglial STING pathway in the brain, significantly improve the mouse's memory ability and spatial recognition ability, and improve the brain's inflammatory microenvironment, providing favorable conditions for targeting the microglial STING pathway and promoting Aβ clearance to treat Alzheimer's disease.

[0106] The above shows and describes the basic principles, main features and advantages of the present invention. However, the above is only a specific embodiment of the present invention, and the technical features of the present invention are not limited thereto. Any other implementation methods derived by any technician in the field without departing from the technical solution of the present invention should be included in the patent scope of the present invention.

Claims

1. A dual-drug nanoparticle, characterized in that: It comprises an Aβ inhibitor, a STING inhibitor and an amphiphilic polymer. The Aβ inhibitor is selected from an Aβ antibody or a hydrophobic targeting peptide and its derivatives that dissociate and inhibit Aβ aggregation. The STING inhibitor is a STING covalent inhibitor H151.

2. The dual-drug nanoparticle according to claim 1, characterized in that: The Aβ inhibitor is Aβ 42 The core hydrophobic region of the GKLVFF polypeptide.

3. The dual-drug nanoparticle according to claim 1, characterized in that: The amphiphilic polymer is PEPA.

4. The dual-drug nanoparticle according to claim 1, characterized in that: The mass ratio of the amphiphilic polymer to the STING inhibitor is 10:1-3; the molar mass ratio of the amphiphilic polymer to the Aβ inhibitor is 1:2-5.

5. The method for preparing the dual-drug nanoparticles according to any one of claims 1 to 4, characterized in that: The method is as follows: Aβ inhibitor is connected to the amphiphilic polymer through a chemical bond, the amphiphilic polymer connected to the Aβ inhibitor and the STING inhibitor are mixed, and slowly added to water under ultrasound, and then ultrasound is performed and the upper layer is filtered to obtain dual-drug nanoparticles.

6. The method for preparing dual-drug nanoparticles according to claim 5, characterized in that: The method is specifically as follows: Step (1), weigh 6.30 mg EDC, 1.51 mg NHS, and 0.825 mg TK, dissolve in 200 μL DMF, vortex until completely dissolved, then magnetically stir and activate in an ice bath for 3 h; Step (2), synthesizing PEPA-AMA by atom transfer radical polymerization; Step (3), weigh 10 mg of PEPA-AMA and dissolve it in 100 μL of DMF, vortex until completely dissolved, mix it with the system in step (1), and react it in a metal bath at 43° C. for 24 h; Step (4), diluting the mixed system in step (3) with 2.1 mL of methanol, centrifuging, absorbing the upper liquid, and removing the remaining methanol by reduced pressure distillation at 90 rpm and 49° C. to obtain PEPA-TK; Step (5), weigh 2.33 mg of GKLVFF polypeptide, dissolve it in 200 μL of DMF and mix it with the PEPA-TK liquid in step (4), and react in a metal bath at 43° C. with magnetic stirring for 24 h; Step (6), diluting the mixed system in (5) with 2.0 mL of methanol, centrifuging, collecting the liquid, which is PEPA-G, and setting the concentration to 10 mg / mL using methanol; Step (7), weigh 1 mg of H151, dissolve it in DMSO, mix the H151 solution and the PEPA-G solution in step (6) evenly, and drop the mixed solution dropwise into 3 mL of ultrapure water in an ice bath under probe ultrasound to form uniform drug-loaded micelles; centrifuge to remove methanol, make the inner tube micelles constant with ultrapure water, and retain the outer tube solution to obtain dual-drug nanoparticles.

7. A pharmaceutical composition, characterized in that Comprising the dual-drug nanoparticles according to any one of claims 1 to 4.

8. Use of the dual-drug nanoparticles according to any one of claims 1 to 4 or the pharmaceutical composition according to claim 7 in the preparation of a drug for treating Alzheimer's disease.

Images