A strain of auricularia polytricha and application thereof

Abstract

The present application relates to edible mushroom technical field, disclose a kind of Auricularia polytricha strain and application.The Auricularia polytricha (Auricularia polytricha) of the present application JI 5, on October 23, 2024, is preserved in China typical culture preservation center, and the preservation number is CCTCC NO: M 20242312.Auricularia polytricha JI 5 fruit body has the excellent agronomic characters such as little fluff, regular ear edge, small ear base, high rehydration rate, and can be used for screening breeding, cultivation planting, fermentation extraction of Auricularia polytricha, also can be used for the deep processing of food or health products.

Description

Technical Field

[0001] The present invention relates to the technical field of edible fungi, and particularly to a new strain of Auricularia polytricha, Ji 5, and its application. Background Art

[0002] Auricularia polytricha belongs to the family Auriculariaceae and the genus Auricularia. Auricularia polytricha has certain advantages among many edible fungi products, and its unique flavor and crispy texture have earned it the reputation of "jellyfish skin on wood". According to the "Chinese Herbal Medicine", Auricularia polytricha contains great medicinal value, and has the effects of enriching blood and promoting blood circulation, clearing the lungs and replenishing qi, nourishing yin and strengthening yang, stopping bleeding and relieving pain, and enhancing immune ability. Auricularia polytricha contains various active ingredients, such as polysaccharides, proteins, vitamins, etc., and its main active ingredient is polysaccharide, which has antibacterial, antithrombotic, lipid-lowering, antioxidant, antiepileptic and other effects.

[0003] In the process of cultivation and production of different Auricularia polytricha varieties, different agronomic characters are shown. For example, the white Auricularia polytricha strain AJB1501 with the preservation number CGMCC NO.14555, and the pink Auricularia polytricha strain ZJFME001 with the preservation number CGMCC NO.40900. Screening new strains of Auricularia polytricha with excellent agronomic characters can not only promote the sustainable and healthy development of the edible fungi industry, but also serve as an important source for the creation of new germplasm and the breeding of new varieties. Summary of the Invention

[0004] The purpose of the present invention is to provide a strain of Auricularia polytricha, Ji 5, and its application. This strain has excellent agronomic characters such as less fluff, regular ear margin, small ear base, and high rehydration rate.

[0005] In order to achieve the above invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides a strain of Auricularia polytricha, which is Auricularia polytricha Ji 5, and the preservation number is CCTCC NO: M 20242312.

[0007] In the present invention, the wild Auricularia polytricha Ji 5 is collected from the Guanshan National Nature Reserve in Huangshan City, Anhui Province, and has excellent agronomic character characteristics. After sequencing, the ITS sequence of the Auricularia polytricha strain in the present invention is as shown in SEQ ID NO.1, and it belongs to the Auricularia polytricha variety.

[0008] The present invention also includes the following substances of the above Auricularia polytricha strain:

[0009] (1) Basidiospores;

[0010] (2) Mycelium;

[0011] (3) Sub-entities;

[0012] (4) Fungal logs containing Auricularia auricula-judae strain;

[0013] (5) Fermentation broth of Auricularia auricula-judae strain.

[0014] This invention investigated the optimal culture conditions for the above-mentioned Auricularia auricula strain and provided a culture medium for culturing the above-mentioned Auricularia auricula strain, wherein each liter of the culture medium contains: 200g of potato, 20.00g of sucrose, 3.00g of diammonium hydrogen phosphate, 75.00g of sawdust, 3.00g of potassium dihydrogen phosphate, and 1.00g of magnesium sulfate.

[0015] The present invention also provides a method for culturing the above-mentioned Auricularia auricula strain, wherein the Auricularia auricula strain is inoculated into the culture medium of the present invention, the pH of the culture medium is adjusted to 5-7, and cultured in the dark at 25-27°C.

[0016] Another object of the present invention is to provide the use of the above-mentioned Auricularia auricula strain and the substances produced therefrom in any of the following:

[0017] (1) Screening and breeding of Auricularia auricula-judae;

[0018] (2) Cultivation and planting of Auricularia auricula-judae;

[0019] (3) Extraction of components from Auricularia auricula-judae;

[0020] (4) Processing of hairy fungus into food and health products.

[0021] The beneficial effects of this invention are:

[0022] This invention provides a strain of Auricularia auricula-judae, strain Ji 5, collected from the Guniujiang National Nature Reserve in Huangshan City, Anhui Province, and currently deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20242312. The fruiting bodies of strain Ji 5 possess excellent agronomic traits such as few hairs, regular auricular margins, small auricular base, and high rehydration rate, providing an important source for the creation of new germplasm and the breeding of new varieties of Auricularia auricula-judae.

[0023] This invention uses the mycelium of *Auricularia auricula-judae* strain Ji 5 as experimental material to design single-factor experiments and orthogonal experiments, exploring the optimal growth conditions for wild *Auricularia auricula-judae* strain Ji 5 from the perspectives of carbon source, nitrogen source, sawdust, inorganic salts and their different levels. The growth status under different temperatures and pH conditions was used to investigate the suitable environmental conditions for its growth. Based on this, the culture medium and cultivation method of the above-mentioned *Auricularia auricula-judae* strain are provided, laying the foundation for the cultivation of wild *Auricularia auricula-judae* strain Ji 5, promoting the development and utilization of new *Auricularia auricula-judae* germplasm resources, and promoting the sustainable development of my country's *Auricularia auricula-judae* industry. Attached Figure Description

[0024] Figure 1 Effects of different basal culture media on the mycelial growth rate of wild Auricularia auricula-judae strain Ji 5.

[0025] Figure 2 Effects of different carbon sources on the mycelial growth rate of wild Auricularia auricula-judae strain Ji 5.

[0026] Figure 3 Effects of different carbon sources on the colony morphology of wild Auricularia auricula-judae strain Ji 5.

[0027] Figure 4 Effects of different nitrogen sources on the mycelial growth rate of wild Auricularia auricula-judae strain Ji 5.

[0028] Figure 5 Effects of different nitrogen sources on the colony morphology of wild Auricularia auricula-judae strain Ji 5.

[0029] Figure 6 Effects of different sawdust contents on the mycelial growth rate of wild Auricularia auricula-judae strain Ji 5.

[0030] Figure 7 Effects of different sawdust contents on the colony morphology of wild Auricularia auricula-judae strain Ji 5.

[0031] Figure 8 The effects of different levels of different influencing factors on the colony morphology of wild Auricularia auricula-judae strain Ji 5.

[0032] Figure 9 Effects of different pH values ​​on the mycelial growth rate of wild Auricularia auricula-judae strain Ji 5.

[0033] Figure 10 Effects of different pH values ​​on the colony morphology of wild Auricularia auricula-judae strain Ji 5.

[0034] Figure 11 Effects of different temperatures on the mycelial growth rate of wild Auricularia auricula-judae strain Ji 5.

[0035] Figure 12 Effects of different temperatures on the colony morphology of wild Auricularia auricula-judae strain Ji 5.

[0036] Figure 13 The fruiting body morphology of wild hairy wood ear fungus Ji 5.

[0037] Figure 14 Phylogenetic tree constructed based on the 5ITS sequence of wild Auricularia auricula-judae strain.

[0038] Figure 15 Images of dried fruiting bodies of Hebei-5 and other products from different origins.

[0039] Figure 16 Images of the downy hairs on the back of Ji 5 and other products from different origins of the wood ear fungus. The scale bar in the images is 250 micrometers.

[0040] Figure 17 Images of dried fruiting bodies of Auricularia auricula-judae (Hypericum perforatum) from different origins after rehydration (Ji 5, etc.).

[0041] Figure 18 The rehydration rate of dried fruiting bodies of Auricularia auricula-judae from different origins (Ji 5).

[0042] Biological Preservation Information

[0043] The Auricularia polytricha of this invention was deposited on October 23, 2024, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M 20242312. Detailed Implementation

[0044] This invention provides a strain of *Auricularia polytricha*, strain Ji 5, deposited at the China Center for Type Culture Collection (CCTCC), accession number M 20242312. This strain was collected from the Guniujiang National Nature Reserve in Huangshan City, Anhui Province, and exhibits excellent agronomic traits. The dried wild *Auricularia polytricha* Ji 5 has small ear pieces with regular edges, few hairs on the back, and a high rehydration rate. After rehydration, the ear pieces have regular, wrinkle-free edges, moderate thickness, and are significantly smaller than other varieties in terms of both size and base. The fruiting body color is also darker than that of other varieties.

[0045] The present invention also includes the basidiospores, mycelium and fruiting body of the above-mentioned Auricularia auricula-judae strain 5, the mycelium containing the above-mentioned Auricularia auricula-judae strain, and the fermentation broth fermented with the above-mentioned Auricularia auricula-judae strain.

[0046] This invention uses *Auricularia auricula-judae* strain Ji 5 as the research object. Single-factor experiments were conducted to investigate the effects of different carbon sources, nitrogen sources, and sawdust concentrations on the mycelial growth rate and colony morphology of wild *Auricularia auricula-judae* strain Ji 5, screening out the optimal carbon source, optimal nitrogen source, and optimal sawdust content for the growth of wild *Auricularia auricula-judae* strain Ji 5. Orthogonal experiments were used to investigate the effects of different levels of various influencing factors on the colony growth of wild *Auricularia auricula-judae* strain Ji 5, optimizing the culture medium formulation and determining the optimal culture medium ratio for the growth of wild *Auricularia auricula-judae* strain Ji 5. A suitable culture medium for culturing *Auricularia auricula-judae* strain Ji 5 is provided, containing the following per liter: 200g potato, 20.00g sucrose, 3.00g diammonium hydrogen phosphate, 75.00g sawdust, 3.00g potassium dihydrogen phosphate, and 1.00g magnesium sulfate. Solid or liquid culture medium can be selected according to the cultivation purpose. As one embodiment, agar is added to the liquid culture medium to create a solid culture medium. The agar addition amount can be selected as 15.00–20.00g / L. In one embodiment, the sawdust is 3-5 mm in size. The culture medium described above has the greatest promoting effect on the growth rate of *Auricularia auricula-judae* mycelium, resulting in longer, whiter, denser, and more uniform mycelium growth.

[0047] This invention uses the aforementioned culture medium as a basis to screen for suitable growth environments for *Auricularia auricula-judae* strain Ji 5 under different pH and temperature conditions. A method for culturing the *Auricularia auricula-judae* strain Ji 5 is provided. The strain Ji 5 is inoculated into the aforementioned culture medium, and the pH of the medium is adjusted to 5–7, with selectable pH values ​​being 5, 5.5, 6, 6.5, and 7. Culture is then carried out in the dark at 25–27°C, with selectable temperatures being 25°C, 25.5°C, 26°C, 26.5°C, and 27°C. These culture conditions are suitable for the growth of *Auricularia auricula-judae* strain Ji 5, resulting in dense mycelial growth and relatively regular colony morphology.

[0048] This invention cultivates Auricularia auricula-judae 'Ji' 5 in a substrate. The substrate composition can be selected as follows: 50% sawdust, 30% cottonseed hulls, 18% wheat bran, 1% gypsum, and 1% sucrose. The total fresh yield biological efficiency of the cultivated Auricularia auricula-judae 'Ji' 5 is 100.05%, and the total dry yield biological efficiency is 11.89%. The characteristics of the fresh ear pieces harvested from the cultivation are: ear piece thickness 2.08±0.17mm, ear base thickness 7.28±1.05mm, ear piece length 50.65±5.47mm, ear piece width 80.91±9.96mm, ear piece length-to-width ratio 0.63±0.06, ear piece ventral color value L* value 22.00±1.72, few veins and no wrinkles, regular edges, and single ear pieces.

[0049] The ITS sequence of the *Auricularia auricula-judae* strain described in this invention is shown in SEQ ID NO.1. A phylogenetic tree constructed based on the ITS sequences of the wild *Auricularia auricula-judae* strain Ji 5 and other *Auricularia auricula-judae* varieties proved that Ji 5 belongs to the same genus as the *Auricularia auricula-judae* strain, thus identifying it as a new strain and naming it Ji 5. Compared with the fruiting body characteristics of commercially available *Auricularia auricula-judae* from different regions, the obtained new strain Ji 5 exhibits excellent agronomic traits such as fewer hairs, regular ear margins, small ear base, and high rehydration rate.

[0050] The novel *Auricularia auricula-judae* strain Ji 5, obtained by field collection, isolation, and purification in this invention, can be used for the screening, breeding, and cultivation of *Auricularia auricula-judae*. This includes, but is not limited to, the basidiospores, mycelium, and fruiting bodies of the wild *Auricularia auricula-judae* strain Ji 5, as well as the culture medium and cultivation method for culturing *Auricularia auricula-judae* strain Ji 5 as described in this invention. The novel *Auricularia auricula-judae* strain Ji 5 of this invention can also be used in the extraction process of *Auricularia auricula-judae* components, such as directly extracting melanin, polysaccharides, and other substances from the mycelium or fruiting bodies; or fermenting *Auricularia auricula-judae* to extract active substances from the fermentation products. Those skilled in the art can further process the wild *Auricularia auricula-judae* strain Ji 5 and its resulting mycelium and fruiting bodies, adding or not adding other food ingredients or medicinal materials, to produce food or health products.

[0051] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0052] The Auricularia auricula strain used in the following examples was isolated and purified from wild Auricularia auricula collected by the Edible Fungi Research Laboratory of the Institute of Biology, Hebei Academy of Sciences, in the Guniujiang National Nature Reserve, Huangshan City, Anhui Province.

[0053] Example 1

[0054] Collection and purification of Ji 5

[0055] Select whole, disease-free wood ear mushrooms and cut them off with scissors, trying to cut them intact to avoid tearing or damaging the mycelium. Wash the surface of the wood ear mushrooms with clean water to remove dirt and impurities, then transfer them to a laminar flow hood and wash them with sterile distilled water. After that, gently wipe them twice with 75% alcohol wipes to disinfect the surface of the fruiting bodies. After disinfection, transfer them to sterile empty petri dishes and place them in a laminar flow hood where sterile air is blown until there are no water stains on the surface.

[0056] Remove the fruiting bodies of *Auricularia auricula-judae* from the petri dish, cut open the epidermis with a scalpel, and use forceps to remove the tissue blocks from the surface (the tissue blocks should not be too large). Gently press the tissue blocks with sterile filter paper to absorb the moisture, then use forceps to pick up the tissue blocks again, evenly coat the surface with a small amount of sodium penicillin, and place them on PDA-resistant medium supplemented with gentamicin. Incubate at 25°C in the dark for 5–7 days. Once obvious white hyphae have grown around the tissue blocks, immediately use forceps to transfer the mycelial blocks to normal PDA medium and incubate at 25°C in the dark for 5–7 days for purification.

[0057] Basic culture medium screening

[0058] Basic culture medium 1: 200.00g potato, 20.00g glucose, 15.00g agar, 2.00g yeast powder, 3.00g potassium dihydrogen phosphate, 1.50g magnesium sulfate;

[0059] Basic culture medium 2: 200.00g potato, 20.00g glucose, 20.00g agar, 2.00g peptone, 3.00g potassium dihydrogen phosphate, 1.50g magnesium sulfate;

[0060] Basic culture medium 3: 200.00g potato, 20.00g glucose, 20.00g agar, 2.00g peptone, 2.00g potassium dihydrogen phosphate, 1.00g magnesium sulfate, 0.01g vitamin B1;

[0061] Basic culture medium 4: 200.00g potato, 20.00g glucose, 15.00g agar, 3.00g peptone, 1.00g potassium dihydrogen phosphate, 0.45g magnesium sulfate.

[0062] Using a Ф=5 punch, holes were made at the edge of the mycelium of the tested strain Ji 5 on the plate. The inoculum was then transferred to four different basal media, with six replicates for each treatment. The media were placed in a constant temperature incubator and incubated at 25°C in the dark, and the growth rate was calculated. Figure 1 There was no significant difference in colony growth rate when inoculated onto basal media 1, 2, and 3 (P>0.05), while the colony growth rate when inoculated onto basal media 4 was significantly lower than that of the other three media (P<0.05). Among basal media 1, 2, and 3, the colony growth rate when inoculated onto basal media 2 showed the smallest error and the most stable growth rate.

[0063] Example 2

[0064] Effects of different single-factor experiments on the mycelial growth of wild Auricularia auricula-judae strain Ji 5

[0065] In the basal culture medium 2 obtained in Example 1, the carbon source glucose was replaced with sucrose, lactose, dextrin powder, mannose, maltose, fructose, and soluble starch, respectively, with the amount added remaining unchanged and the pH remaining natural. The nitrogen source peptone was replaced with yeast powder, beef extract, yeast extract, ammonium chloride, diammonium hydrogen phosphate, and urea, respectively, with the amount added remaining unchanged and the pH remaining natural. Based on basal culture medium 2, sawdust was added at 50.00 g, 100.00 g, 200.00 g, 300.00 g, and 400.00 g, respectively, with the pH remaining natural. Using basal culture medium 2 as a control, each treatment was repeated in 6 replicates and cultured at 25°C in the dark.

[0066] like Figure 2 As shown, the mycelial growth rate of wild Auricularia auricula-judae 'Ji' 5 was particularly outstanding in the culture medium with sucrose as the carbon source, increasing by 46.75% compared to the control culture medium. The colony morphology was also more dense and had more regular edges compared to the control group. Figure 3 );like Figure 4 As shown, the mycelial growth rate of wild Auricularia auricula-judae 'Ji' 5 was particularly outstanding in the culture medium with diammonium hydrogen phosphate as the nitrogen source, increasing by 38.17% compared to the control culture medium. The colony morphology was also more dense and had more regular edges compared to the control group. Figure 5 The effect of different sawdust contents on the colony morphology of wild Auricularia auricula-judae 'Ji' 5 is as follows: Figure 6 As shown, the mycelial growth was strongest when the sawdust content was 100.00g, with a growth rate 39.05% higher than the control. The mycelia were white and dense, with regular colony edges. Figure 7 ).

[0067] Example 3

[0068] Effects of different levels of different influencing factors on the growth of wild Auricularia auricula-judae 'Ji' 5

[0069] Orthogonal experimental design was used to investigate the effects of five factors (carbon source, nitrogen source, sawdust, potassium dihydrogen phosphate, magnesium sulfate, and their four levels) on the growth of wild Auricularia auricula-judae 'Ji' colony. The optimal culture medium ratio for the growth of wild Auricularia auricula-judae 'Ji' was optimized. The orthogonal experimental levels of each factor are shown in Table 1.

[0070] Table 1. Level Table of Orthogonal Experiment for Each Factor

[0071]

[0072] Table 2 Orthogonal Experimental Design Table

[0073]

[0074]

[0075] Analysis of the range in Table 2 shows that the order of influence of each factor on the mycelial growth rate of wild Auricularia auricula-judae 'Ji' 5 is potassium dihydrogen phosphate > carbon source > sawdust > nitrogen source > magnesium sulfate. The optimal compound ratio is A2B3C1D4E2, which means that the culture medium ratio that promotes the mycelial growth rate of wild Auricularia auricula-judae 'Ji' 5 the most is 200g potato, 15g agar, 20.00g carbon source, 3.00g nitrogen source, 75.00g sawdust, 3.00g potassium dihydrogen phosphate, and 1.00g magnesium sulfate.

[0076] The effects of different levels of different influencing factors on the colony morphology of wild Auricularia auricula-judae 'Ji' 5, such as Figure 8 As shown, compared with the control group, the mycelia in media 1, 5, 8, 9, 10, 11, and 13 (media ratios are shown in Table 2) were longer but less uniform, with dense mycelia in the central part and sparse mycelia in the peripheral part; the mycelia in media 1, 3, 4, 6, 12, 14, 15, and 16 were white and dense, with uniform growth, but the mycelia were relatively short; the mycelia in media 7 were longer, white and dense, with uniform growth.

[0077] Example 4

[0078] The effects of different growth conditions on the growth of Auricularia auricula-judae

[0079] Using the optimal formula obtained in Example 3 as the culture medium, the fungus was cultured for 15 days under different temperature (25℃, 27℃, 30℃, 32℃, 35℃, pH natural) and different pH (5, 6, 7, 8, 9, 25℃) conditions to observe its mycelial growth radius and growth status.

[0080] like Figure 9 The results showed that the mycelial growth rate of *Auricularia auricula-judae* was fastest at pH 5 (5.51 mm / d), while the growth rate at pH 6 was not significantly different from that at pH 5 (P>0.05). Therefore, a culture medium pH of 5–7 is suitable for the growth of *Auricularia auricula-judae*, resulting in dense mycelial growth and relatively regular colony morphology. Figure 10 );like Figure 11 As shown, the fastest growth rate of *Auricularia auricula-judae* was observed at 25℃ (5.28 mm / d), significantly higher than at other temperatures (P<0.05). The mycelia were also denser and more regular at these temperatures. Figure 12 ).

[0081] Example 5

[0082] Determination of fruiting body yield and morphological indicators of wild Auricularia auricula-judae strain Ji 5

[0083] The following cultivation substrate formula was used: 50% sawdust, 30% cottonseed hulls, 18% wheat bran, 1% gypsum, and 1% sucrose. For fruiting experiments, 36 bags of 600g dry substrate were inoculated and the fruiting bodies were cultivated in an outdoor greenhouse at room temperature. The plants were sprayed with water for 1 hour each in the morning and at noon. The yield and morphological indicators of the fruiting bodies of Auricularia auricula-judae were determined through the fruiting experiment.

[0084] Yield was measured using a random sampling method. Ten bars were randomly selected, and the yield per bar was recorded. The average yield per bar was then calculated.

[0085] Fresh yield of a single batch of Auricularia auricula-judae (per stick) = Fresh weight of Auricularia auricula-judae from 10 sticks / 10;

[0086] The yield of a single batch of Auricularia auricula-judae (per stick) = the dry weight of Auricularia auricula-judae from 10 sticks / 10;

[0087] Total fresh production biological efficiency = Total fresh weight / Number of mushroom logs / Dry substrate weight of mushroom logs (600g);

[0088] Total dry weight biological efficiency = Total dry weight / Number of mycelium sticks / Dry weight of mycelium sticks (600g);

[0089] Table 3 shows that, based on actual measurements, Ji 5 can produce 8 harvests, with each harvest having a growth cycle of 3-4 days. The total fresh yield is 21610g, and the total dry yield is 2567.31g. The proportions of fresh yield for each harvest are 18.92%, 12.40%, 19.07%, 14.58%, 4.49%, 10.18%, 15.50%, and 4.86%, respectively, and the proportions of dry yield are 16.96%, 13.84%, 15.93%, 13.12%, 5.36%, 13.33%, 13.56%, and 7.90%, respectively. The total biological efficiency of Ji 5's fresh yield is 100.05%, and the total biological efficiency of its dry yield is 11.89%.

[0090] Table 3. Production statistics of Auricularia auricula-judae var. ji 5.

[0091]

[0092] The morphology of the fruiting body of the wild Auricularia auricula strain Ji 5 is as follows: Figure 13 As shown, the ear has few ridges and no wrinkles, regular edges, a single ear piece, and is large and thick. The ear's dimensions, as measured in Table 4, are: ear piece thickness 2.08±0.17mm, ear base thickness 7.28±1.05mm, ear piece length 50.65±5.47mm, ear piece width 80.91±9.96mm, ear piece length-to-width ratio 0.63±0.06, and ear piece L... * The value is 22.00 ± 1.72 (lightness L). * (0 to 100 represent black to white).

[0093] Table 4 Morphological Indicators of Five Fruiting Bodies of Auricularia auricula-judae

[0094]

[0095]

[0096] Example 5

[0097] Identification of wild Auricularia auricula-judae strain Ji 5ITS

[0098] Using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) as primers, the ITS sequence of the collected wild Auricularia auricula-judae strain Ji 5 was amplified, obtaining the 5' to 3' ends of the wild Auricularia auricula-judae strain Ji 5 sequence: (SEQ ID NO.1). A phylogenetic tree was constructed using the Neighbor-Joining (NJ) Bootstrap test in MAGA6 software, repeated 1000 times. Figure 14 As shown, the wood ear fungus Ji 5 collected in the wild is a hairy wood ear fungus variety.

[0099] Example 6

[0100] Comparison of agronomic traits between wild Auricularia auricula strain Ji 5 and commercial Auricularia auricula.

[0101] Compared with commercially available black fungus from Northeast China, Fujian, Yunnan, and Sichuan, the dried product is as follows: Figure 15 As shown, the dried ear pieces of Ji 5 are smaller and have regular edges compared to the other four varieties; Figure 16 As shown, Ji 5 has shorter and sparser back hairs compared to the other four varieties, resulting in a smoother and more tender texture.

[0102] Different varieties of hairy wood ear mushrooms, after being soaked in warm water for 2 hours, will have the following appearance: Figure 17 As shown in Table 5, the earlobes of Ji 5 have regular edges without wrinkles, while those of Fujian have relatively regular edges with wrinkles. The earlobes of Northeast, Sichuan, and Yunnan all have serrated edges with wrinkles. Table 5 also shows that after rehydration, the earlobes of Ji 5 have moderate thickness, but the ear base is significantly smaller than the other four varieties (P<0.05). (Brightness L) * The range from 0 to 100 represents a color from black to white, with Ji 5 having a darker fruiting body than the other four varieties; for example... Figure 18 As shown, after soaking in warm water for 2 hours, the rehydration rate of Ji 5 was significantly higher than that of the other four varieties (P<0.05), with a rehydration rate of 636.70%.

[0103] Table 5. Determination of indicators of Hebei 5 and other commercially available Auricularia auricula-judae after rehydration from different origins.

[0104]

[0105] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A strain of Auricularia auricula-judae, characterized in that, The Auricularia polytricha strain is Auricularia polytricha Ji 5, with the preservation number of CCTCC NO: M 20242312.

2. The *Auricularia auricula-judae* strain according to claim 1, characterized in that, The ITS sequence of the Auricularia polytricha strain is as shown in SEQ ID NO.

1.

3. The basidiospores of the Auricularia polytricha strain according to any one of claims 1 to 2.

4. The mycelium of the Auricularia polytricha strain according to any one of claims 1 to 2.

5. The fruiting body of the Auricularia polytricha strain according to any one of claims 1 to 2.

6. The mushroom stick containing the Auricularia polytricha strain according to any one of claims 1 to 2.

7. The fermentation broth of the Auricularia polytricha strain according to any one of claims 1 to 2.

8. A method for culturing the *Auricularia auricula-judae* strain according to any one of claims 1 to 2, characterized in that, The Auricularia polytricha strain is inoculated into a culture medium, and each liter of the culture medium is added with: 200 g of potato, 20.00 g of sucrose, 3.00 g of diammonium hydrogen phosphate, 75.00 g of sawdust, 3.00 g of potassium dihydrogen phosphate, and 1.00 g of magnesium sulfate; the pH of the culture medium is adjusted to 5 - 7, and it is cultured in the dark at 25 - 27 °C.

9. The application of the Auricularia polytricha strain according to any one of claims 1 to 2, the basidiospores according to claim 3, the mycelium according to claim 4, the fruiting body according to claim 5, the mushroom stick according to claim 6, or the fermentation broth according to claim 7 in any one of the following: (1) Screening and breeding of Auricularia polytricha; (2) Cultivation of Auricularia polytricha; (3) Extraction of Auricularia polytricha components; (4) Processing of Auricularia polytricha food and health products.

Images