A proteinase mutant npr-m136 with improved degradation rate of soybean meal antigenic protein, its coding gene and application

Abstract

The application provides a proteinase mutant NPR-M136 with improved degradation rate of soybean meal antigen protein, and a coding gene and application thereof. The proteinase belongs to a metalloproteinase family member, and after random mutation and directional screening, a proteinase mutant NPR-M136 is obtained. Compared with a wild-type proteinase, the degradation rate of the proteinase mutant NPR-M136 to soybean meal antigen protein is increased from 46% to 59.5% under the condition of the same enzyme activity addition, and the increase range is between 25% and 30%, and the degradation rate effect is remarkable. When the proteinase mutant is applied in the fields of feed and additive, the degradation efficiency of soybean antigen protein can be remarkably improved, the application effect of protein feed raw materials can be effectively improved, the adverse reactions such as allergic diarrhea are reduced, the cost is reduced and the efficiency is increased, and the proteinase mutant has a good market application prospect.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering and enzyme engineering, and particularly relates to a proteinase mutant NPR-M136 with improved degradation rate of soybean meal antigen protein, a coding gene thereof and application. BACKGROUND

[0002] Soybean antigen protein refers to some macromolecular proteins or glycoproteins in soybean and its products, which can cause allergic reactions in humans or livestock and poultry. There are 32 kinds of soybean antigen proteins that have been confirmed, among which glycinin and beta-conglycinin are the most immunogenic soybean antigen proteins, accounting for 65% to 80% of the total protein in soybean seeds, and are the main antigen proteins in soybean. The main anti-nutritional effects of soybean antigen proteins are: reducing the utilization rate of feed protein; increasing the secretion of endogenous protein, leading to increased fecal nitrogen; some sensitive animals can have allergic reactions, resulting in diarrhea, reduced production performance and even death. For example, globulin and conglobulin in soybean can cause intestinal allergy in piglets, calves and other animals, causing intestinal damage, villus atrophy, crypt hyperplasia, decreased intestinal digestive and absorptive capacity, and reduced number and activity of mucosal disaccharidase.

[0003] Proteinase is a kind of enzyme that catalyzes the hydrolysis of peptide bonds in proteins, and widely exists in animals, plants and microorganisms. Adding proteinase preparation is one of the effective means to degrade soybean antigen protein. In this study, a proteinase mutant with improved degradation rate of soybean meal antigen protein was screened through candidate gene screening, active site mutation and other methods, which has a broad application prospect in the fields of feed additives, breeding and the like. SUMMARY

[0004] The application provides a proteinase mutant NPR-M136 with improved degradation rate of soybean meal antigen protein, a coding gene thereof and application. When the proteinase mutant is applied in the fields of feed, additive and the like, the degradation efficiency of soybean antigen protein can be improved, the application effect of protein feed raw materials can be effectively improved, adverse reactions such as allergic diarrhea can be reduced, and the effect of reducing cost and increasing efficiency can be achieved.

[0005] In order to achieve the above application purposes, the following technical solutions are adopted in the application:

[0006] The application provides a proteinase mutant NPR-M136 with improved degradation rate of soybean meal antigen protein, and the amino acid sequence of the proteinase mutant NPR-M136 is shown as SEQ ID NO: 3, wherein the amino acid sequence is obtained by changing lysine at position 184 of the proteinase of SEQ ID NO: 1 into arginine, changing asparagine at position 223 into aspartic acid and changing phenylalanine at position 267 into leucine.

[0007] The application also provides a coding gene of the protease mutant NPR-M136, and the nucleotide sequence is shown as SEQ ID NO: 4.

[0008] The application also provides a recombinant expression vector containing the coding gene of the protease mutant.

[0009] The application also provides a recombinant engineering bacterium containing the coding gene of the protease mutant.

[0010] Further, the recombinant engineering bacterium is any one of Bacillus subtilis, Bacillus licheniformis, yeast GS115 and Escherichia coli BL21.

[0011] The application also provides a preparation method of the protease mutant, comprising the following steps:

[0012] (1) connecting the coding gene of the protease mutant NPR-M136 to a pWB980 vector to obtain a recombinant expression vector, transforming the recombinant expression vector into a competent cell, screening positive clones by using a resistance marker, and obtaining a recombinant genetic engineering bacterium;

[0013] (2) performing shake flask fermentation on the recombinant genetic engineering bacterium, performing shock culture, and producing the protease mutant through fermentation;

[0014] (3) inoculating the recombinant genetic engineering bacterium after shake flask fermentation into a fermentation tank to perform large-scale fermentation culture, and obtaining a fermentation liquor or spray-dried powder of the protease mutant NPR-M136.

[0015] Further, the parameters of the large-scale fermentation culture are as follows: natural pH, temperature 35-40 DEG C, stirring speed 600-800 rpm, ventilation amount 1.5 (v / v), and dissolved oxygen controlled to be more than 20%.

[0016] Further, the culture medium of the large-scale fermentation culture comprises the following components in percentage by mass: soybean meal 5-10%, corn flour 1-5%, PPG-20000 0.1-1.0%, protease 0.1-1.0%, amylase 0.1-1.0%, 12 water disodium hydrogen phosphate 0.2-0.5%, and the rest is water.

[0017] The application also provides an application of the protease mutant NPR-M136 in preparation of a feed additive or a food additive.

[0018] Further, the feed additive or the food additive contains the protease mutant NPR-M136 or the recombinant bacterium containing the protease mutant NPR-M136.

[0019] Compared with the prior art, the proteinase mutant gene provided by the application belongs to a metalloprotease family member, after random mutation and directional screening, a proteinase mutant NPR-M136 is obtained, and compared with wild-type proteinase, the degradation rate of antigen protein in soybean meal is increased from 46% to 59.5% at the same enzyme activity addition amount, and the increase range is between 25%-30%. Therefore, the degradation efficiency of antigen protein and the utilization rate of protein feed are improved, the cost is saved, the environmental pollution is reduced, and the application prospect in the market is good. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 is the enzymatic property result of the proteinase mutant NPR-M136 in the application.

[0021] Figure 2 is the degradation of soybean meal and SDS-PAGE of the proteinase mutant NPR-M136 in the application, wherein the number M is a protein marker; the numbers 1-2 are a control group, the numbers 3-5 are other samples; the numbers 6-7 are an experimental group; and the number 8 is a blank group (soybean meal plus water).

[0022] Figure 3 is the determination of the degradation rate of soybean antigen protein by the proteinase mutant NPR-M136 in the application. DETAILED DESCRIPTION

[0023] In order to facilitate the understanding of the application, the application will be described more fully below with reference to the accompanying drawings and examples, but the scope of protection of the application is not limited to the following specific examples.

[0024] The molecular biology experimental methods not specifically described in the following examples can be performed according to the specific methods listed in the book of Molecular Cloning Experiment Guide (third edition) J. Sambrook, or according to the instructions of the kit and product. The reagents and biological materials used in the specific examples can be obtained from commercial channels if not specifically stated.

[0025] 1. Strains and vectors

[0026] Bacillus subtilis WB600, plasmid pWB980, Escherichia coli BL21, and plasmid pET-21a(+) were purchased from Invitrogen Company, and T vector and DH5a Escherichia coli competent cells were purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0027] 2. Reagents and culture medium

[0028] Plasmid extraction kit, fragment purification recovery kit, restriction endonuclease were purchased from Baosheng Bioengineering (Dalian) Co., Ltd.; GeneMorph II random mutation PCR kit was purchased from Stratagene Company; Ampicillin, IPTG, etc. were purchased from Shengong Bioengineering (Shanghai) Co., Ltd.; Protein Marker: Blue Plus II Protein Marker (14-120 kDa) was purchased from Beijing Zhenbisai Biological Technology Co., Ltd.

[0029] LB medium formula: 1% tryptone, 0.5% yeast extract, 1% NaCl.

[0030] Fermentation medium: soybean meal powder 50-80 g / L, corn starch 60-100 g / L, sodium phosphate dibasic 2-4 g / L, sodium carbonate 1-2 g / L, pH natural.

[0031] 3. Soybean antigen protein detection kit is a soybean globulin and hemoglobin kit from Longke New Area Factory, and the determination method is carried out according to the kit instruction.

[0032] Example 1: Error-prone PCR to construct protease mutant library

[0033] The primers were designed according to the amino acid sequence (SEQ ID NO: 1) and the optimized DNA sequence (SEQ ID NO: 2) of the protease derived from the reference metalloprotease (NCBI: WP_013524383.1), with a BamH I restriction enzyme site designed at the 5' end and a Xho I restriction enzyme site designed at the 3' end.

[0034] Using the GeneMorph II random mutation PCR kit, the SEQ ID NO: 2 gene was used as a template for random mutation, and the primer sequences used were as follows:

[0035] N36-F1: CGC GGATCC AAAGAAAGATCAATGGTTTG (SEQ ID NO: 5);

[0036] N36-R1: GCC CTCGAG TTAATAAACGCCAACTGCAT (SEQ ID NO: 6).

[0037] The reaction conditions were: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s and 72℃ extension for 1 min 30 s, for a total of 30 cycles.

[0038] The amplified random mutation PCR product was double-digested with Xho I and BamH I, and then ligated to pET-21a(+) vector after purification and recovery. The ligation product was transformed into E. coli BL21-DE3, and positive clones were screened on LB plates containing ampicillin to obtain pET-NPR0x. The synthetic original gene was also ligated to pET-21a(+) vector and transformed into E. coli BL21-DE3 to obtain pET-NPR0.

[0039] The screened single colonies were inoculated into 96-well deep plates. Two single colonies expressing NPR0 were inoculated into each plate as controls. Each well was inoculated with 300 μL of LB liquid medium containing 100 μg / mL ampicillin. After incubation at 37°C and 200 rpm for 4 hours, 50 μL of the bacterial solution was transferred to a new 96-well plate for preservation. Then, 200 μL of LB-Amp medium containing IPTG was added to the remaining bacterial solution in the plate to make the final concentration of IPTG 1 mM and the final concentration of ampicillin 100 μg / mL. The plate was incubated at 37°C and 200 rpm for 10 hours to induce the expression of protease.

[0040] The induced bacterial solution was repeatedly frozen and thawed for disruption. The disrupted cell solution was centrifuged to obtain the supernatant. Substrate plate verification screening was performed by spotting an appropriate amount of the fermentation broth onto a substrate plate containing 1% soybean meal powder and incubating at 37°C overnight. The samples were preliminarily screened according to the size of the hydrolysis ring. The larger the hydrolysis ring, the better the effect of hydrolyzing soybean meal protein. Then, the activity of the protease was detected. After retesting, the mutant gene with a larger hydrolysis ring than the control was sequenced.

[0041] The mutant NPR-M136 with improved degradation rate of soybean meal antigen protein was screened using NPR0 as the starting template. The amino acid sequence of the mutant NPR-M136 is shown in SEQ ID NO: 3, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO: 4. The mutation sites are K184R / N223D / F267L.

[0042] SEQ ID NO: 3

[0043] KERSMVWNEQWKTPSFVSGPLLKGEDAPEELVYRYLDQEKNTFQLGGQARERLSLIGKQTDELGHTVMRFEQRYHGIPVYGAVLVAHVNDGELSSLSGTLIPNLDKRTLKTEAAISVQQAEMIAKQDVADAVTKERPAAEEGKPTRLVIYPDGETPRLAYEVNVRFLTPVPGNWIYMIDAADGRVLNKWNQMDEAKPGGGQSVAGASTVGVGRGVLGDQKYIDTTYSSYYGYYYLQDNTRGSGIFTYDGRNRTVLPGSLWADGDNQLFASYDAAAVDAHYYAGVVYDYYKNVHGRLSYDGSNAAIRSTVHYGRGYNNAFWNGSQMVYGDGDGQTFLPFSGGIDVVGHELTHAVTDYTAGLVYQNESGAINEAMSDIFGTLVEFYANRNPDWEIGEDIYTPGIAGDALRSMSDPAKYGDPDHYSKRYTGTQDNGGVHTNSGIINKAAYLLSQGGVHYGVSVTGIGRDKMGKIFYRALVYYLTPTSNFSQLRAACVQAAADLYGSTSQEVNSVKQAFNAVGVY.

[0044] SEQ ID NO: 4

[0045]

[0046] Example 2: Expression verification of protease mutants in B. subtilis

[0047] The mutants NPR-M136 and NPR0 of Example 1 were respectively amplified and digested with the following primers and cloned into the Xho I and BamH I sites of plasmid pWB980; the recombinant plasmids were transformed into B. subtilis WB600 by referring to the transformation method of B. subtilis created by Spizizen to obtain recombinant bacteria. After plate screening, the mutant of NPR-M136 was obtained. After the recombinant bacteria were subjected to shake flask fermentation in a fermentation medium for 78 h, the supernatant was obtained by centrifugation of the culture solution, the average enzyme activity of the supernatant of each mutant was determined, and the transformant with the highest enzyme activity was used to determine the enzymatic properties of the supernatant.

[0048] The primer sequences used are as follows:

[0049] N36-F2: CGC CTCGAG GAAAGAAAGATCAATGGTTTG (SEQ ID NO: 7);

[0050] N36-R2: GCC GGATCC TTAATAAACGCCAACTGCAT (SEQ ID NO: 8).

[0051] The partial enzymatic property results are as shown in Table 1. Figure 1 The mutant NPR-M136 is relatively heat-resistant, and the residual enzyme activity reaches more than 80% after 3 minutes of treatment at 75°C; it maintains more than 80% of the enzyme activity at pH 7.0 or above, and has high acid resistance, which is more conducive to its application in the fields of feed and food.

[0052] Example 3: Fermentation and preparation of protease mutants in a 30L fermenter

[0053] The recombinant bacteria expressing protease NPR0 and protease mutant NPR-M136 in Example 2 were respectively streaked on LB plates containing kanamycin (final concentration of 20 μg / mL) and incubated at 37°C until single colonies were formed. Well-grown single colonies were picked and streaked on LB plates containing kanamycin (final concentration of 20 μg / mL) for further incubation. The recombinant B. subtilis colonies obtained after three generations of activation were inoculated in 50 mL of LB medium containing kanamycin (final concentration of 20 μg / mL) and incubated at 37°C and 200 rpm for 24 h. The culture was inoculated in 1 L of LB medium containing kanamycin (final concentration of 20 μg / mL) at an inoculation amount of 2%, and incubated at 37°C and 200 rpm until the OD600 was about 5, which was used as the seed liquid to inoculate the fermenter.

[0054] Fermentation production process: soybean meal 5-10%, corn flour 1-5%, PPG-20000 0.1-1.0%, protease 0.1-1.0%, amylase 0.1-1.0%, disodium hydrogen phosphate (12 water) 0.2-0.5%, pH natural, temperature 37°C, stirring rate 600 rpm, ventilation volume 1.5 (v / v), dissolved oxygen controlled above 20%. The pH is natural during fermentation, and the enzyme activity is determined after 24h of fermentation, every 4h, until the end of fermentation (48h).

[0055] The obtained protease NPR0 and protease mutant NPR-M136 were centrifuged or spray-dried to obtain fermentation broth for subsequent experiments.

[0056] Example 4: Application of protease mutants in enzymatic hydrolysis of soybean meal experiments

[0057] (1) Soybean meal enzymatic hydrolysis fermentation

[0058] Soybean meal was ground through a 40-mesh sieve, and 100g of soybean meal powder was taken in a sealed bag. According to the above-mentioned addition amount of protease enzyme activity, it was added to the soybean meal (10 U / g), and the final moisture content was 35-45%. The protease was appropriately diluted with deionized water, and then the volume was adjusted to 50ml. After mixing, it was poured into the weighed soybean meal powder. The soybean meal in the sealed bag was mixed with the fermentation broth evenly, and placed in a 37°C incubator for anaerobic fermentation for 3d. After fermentation, the protein gel qualitative detection of enzymatic hydrolysis band was carried out.

[0059] Grouping: the experimental group is protease mutant NPR-M136 and 100g soybean meal powder; the control group is protease NPR0 and 100g soybean meal powder; the blank group is 100g soybean meal powder and water.

[0060] After 3 days of fermentation, the fermented soybean meal was poured into a tray and dried overnight at 65 degrees. The powder was ground in a grinder for 20 seconds. 3.000g of ground soybean meal powder was accurately weighed from each group, and the antigen protein was extracted according to the instructions for 1 hour.

[0061] (2) SDS-PAGE to investigate the removal of antigen protein

[0062] Take 100μL of the sample reacted and extracted in step (1) and add 100μL of Loading Buffer. Boil for 10 min. Take 20μL for loading.

[0063] Electrophoresis conditions: concentration gel voltage 80-90mv, current 30mA; separation gel voltage 110-120mv, current 40mA. The sample was placed 1cm away from the gel edge, and the electrophoresis was stopped. The gel was peeled off, stained for 2h, and decolorized for 24h, during which the decolorizing solution was replaced.

[0064] The test results are shown in Table 1: under the same conditions and the same enzyme activity unit, the degradation effect of the protease mutant NPR-M136 on soybean meal is obviously better than that of the control group, and the macromolecular glycinin can be better degraded. Figure 2

[0065] Example 5: Quantitative detection of protease mutant enzymolysis of soybean meal experiment-reagent kit method

[0066] According to the soybean meal enzymolysis experiment in Example 4, the extracted supernatant was subjected to quantitative detection of the contents of glycinin and β-conglycinin by the reagent kit method.

[0067] Experimental steps:

[0068] (1) Extraction: weigh the sample 0.3000 g, add 30 mL of 1x sample extraction working solution, and oscillate for extraction at 37°C for 1 h;

[0069] (2) Dilution: centrifuge at 4000 rpm for 5 min, dilute 70 times with distilled water, and mix well for detection;

[0070] (3) Sample addition: add 50 L of calibrant / detected sample and 50 L of antibody working solution, incubate at 37°C for 10 min;

[0071] (4) Plate washing: wash the plate 4 times with 1x washing working solution, and pat dry;

[0072] (5) Enzyme addition: add 100 L / well of enzyme-labeled reagent, and incubate at 37°C for 10 min;

[0073] (6) Plate washing: wash the plate 4 times with 1x washing working solution, and pat dry;

[0074] (7) Color development: add 100 L / well of color developing solution, and incubate at 37°C in the dark for 10 min;

[0075] (8) Termination: add 100 L / well of termination solution, and read the data by the enzyme-labeled instrument (read as soon as possible);

[0076] (9) Calculation: input the data into the calculation software.

[0077] The determination steps of glycinin and β-conglycinin are the same, and the solutions in the reagent kit are used for determination. After determination, the results are shown in Table 2: Figure 3 ​As shown, compared with the original gene NPR0, the degradation rate of the soybean meal antigen protein of the protease mutant NPR-M136 is increased from 46% to 59.5% at the same enzyme activity addition, and the increase range is between 25% and 30%, thus the degradation efficiency of the antigen protein and the utilization rate of the protein feed are improved, the cost is saved, the environmental pollution is reduced, and the protease mutant NPR-M136 has a good market application prospect.

[0078] The above examples are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing examples, the technical solutions recorded in the foregoing examples can still be modified by those of ordinary skill in the art, or some technical features thereof can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions claimed by the present application.

Claims

1. A protease mutant NPR-M136 with improved degradation rate of soybean meal antigenic proteins, characterized in that, The amino acid sequence of the protease mutant NPR-M136 is shown in SEQ ID NO:

3. Its amino acid sequence is obtained by changing lysine at position 184 to arginine, asparagine at position 223 to aspartic acid, and phenylalanine at position 267 to leucine in the protease of SEQ ID NO:

1.

2. The gene encoding the protease mutant NPR-M136 according to claim 1, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO:

4.

3. A recombinant expression vector comprising the encoding gene of claim 2.

4. A recombinant engineered bacterium containing the encoding gene of claim 2.

5. The recombinant engineered bacteria according to claim 4, characterized in that, The host of the recombinant engineered bacteria is any one of Bacillus subtilis, Bacillus licheniformis, yeast GS115, and Escherichia coli BL21.

6. The method for preparing the protease mutant NPR-M136 according to claim 1, characterized in that, Includes the following steps: (1) The coding gene of the protease mutant NPR-M136 was ligated into the pWB980 vector to obtain a recombinant expression vector, which was then transformed into competent cells. Positive clones were screened using resistance markers to obtain recombinant engineered bacteria. (2) The recombinant engineered bacteria were subjected to shake-flask fermentation and cultured with shaking to produce a protease mutant. (3) Inoculate the recombinant engineered bacteria after shake-flask fermentation into a fermenter to expand the fermentation culture and obtain the fermentation broth or spray-dried powder of the protease mutant NPR-M136.

7. The preparation method according to claim 6, characterized in that, The parameters for the expanded fermentation culture are: natural pH, temperature 35~40℃, stirring speed 600~800rpm, aeration rate 1.5 v / v, and dissolved oxygen controlled above 20%.

8. The preparation method according to claim 6, characterized in that, The culture medium for the expanded fermentation culture contains the following components, by mass percentage: 5-10% soybean meal, 1-5% corn flour, 0.1-1.0% PPG-20000, 0.1-1.0% protease, 0.1-1.0% amylase, 0.2-0.5% disodium hydrogen phosphate dihydrate, and the balance being water.

9. The use of the protease mutant NPR-M136 according to claim 1 in the preparation of feed additives and / or food additives.

10. The application according to claim 9, characterized in that, The feed additive contains the protease mutant NPR-M136 or a recombinant strain containing the protease mutant NPR-M136.

Images