Method for identifying escargots and ampullaria gigas based on real-time fluorescent PCR (polymerase chain reaction) and application

Abstract

The invention provides a group of probe primer combination, a kit, a real-time fluorescent PCR (Polymerase Chain Reaction) detection method and application of the real-time fluorescent PCR detection method in identifying escargots and ampullaria gigas.

Description

Technical Field

[0001] The invention belongs to the field of species identification, and in particular relates to a specific probe primer combination, a kit, a detection method and applications thereof in distinguishing field snails and golden apple snail samples and food materials. Background Art

[0002] With the decline in the production of domestic freshwater snails in my country and the ban and withdrawal policies, there is a clear gap in the market for field snails. Pomacea ) are recognized worldwide as malignant invasive aquatic organisms, among which the Pomacea canaliculata ( Pomacea canaliculata ) was introduced into my country as an aquatic product in 1981 and promoted for breeding. Later, due to its poor taste, it gradually lost the market and was abandoned in large numbers (Lv S, Zhang Y, Liu HX, et al. Invasive snails and an emerging infectious disease: results from the first national survey on Angiostrongylus cantonensis in China. PLoS Negl Trop Dis. 2009;3 (2):e368). Existing studies have shown that the Apple snails that invaded my country include the small tube Apple snail and the spotted Apple snail ( Pomacea maculata ) and the new species of Pomacea canaliculata and the cryptic species of Pomacea canaliculata ( Pomacea sp), of which the first two are more widely distributed (Yang QQ, Yu X P. A New Species of AppleSnail in the Genus Pomacea (Gastropoda: Caenogastropoda: Ampullariidae)[J].Zoological Studies, 2019, 58.). The main risk of eating golden apple snails comes from parasite contamination, and the flesh of golden apple snails is thick, and it is not easy to kill the parasites in it by heating. If the cooking method is improper, eating it raw or undercooked may cause parasitic infections such as Guangzhou roundworms, and may cause eosinophilic meningitis. In severe cases, paralysis, lethargy, coma and even death may occur (Lei Bo. A brief analysis of the living habits and key points of prevention and control technology of golden apple snails[J].Hubei Plant Protection, 2024, (02): 62-64,68.). In the Guangzhou outbreak of Angiostrongylus cantonensis in Beijing in 2006, as many as 160 patients became ill after eating cold-mixed golden apple snails and related dishes, and developed symptoms such as headache, fever, neck stiffness, and skin abnormalities to varying degrees (Yin Yingxuan, Wu Yinjuan, He Qing, et al. The current status, hazards and prevention and control measures of the invasion of major snail species in my country [J]. Chinese Journal of Vector Biology and Control, 2022, 33(02): 305-312.).

[0003] The appearance of golden apple snails is similar to that of field snails, with strong reproductive capacity and low price. Although there are differences in shape, color and size, it is difficult to identify them with the naked eye after cooking or peeling the snail meat. Many businesses have come up with the trick of "stealing peaches and plums" to harm the interests of consumers. Molecular detection technologies such as PCR have been widely used in the identification of food authenticity (Guo Yaning, Liu Yaxuan, Zhou Jian, et al. Research Progress on Authenticity Identification Technology of Animal-derived Foods [J]. Meat Research, 2024, 38(11): 55-63.). Establishing a rapid molecular identification method for golden apple snails and field snails is of great significance to combat the adulteration of golden apple snails impersonating field snails and ensure consumer food safety. At present, the molecular identification of golden apple snails is based on DNA barcoding technology (Yang Qianqian, Liu Suwen, Ru Weiding, Liu Guangfu, Yu Xiaoping. 2016. Molecular identification of invasive golden apple snails in Zhejiang Province based on DNA barcoding technology. Biodiversity Science, 24(3): 341–350.) and PCR technology (Cooke GM, King AG, Miller L, et al. A rapid molecular method to detect the invasive golden apple snail Pomacea canaliculata (Lamarck, 1822)[J]. Conserv Genet Resour, 2012, 4(3):591⁃593.), focusing on the identification of different species of Pomacea canaliculata, but no reports have been reported on the identification of the genus Pomacea canaliculata; there are few studies on the identification of river snails. Existing reports use multiplex PCR methods (Hu Jiangru, Jiang Yan, Han Susu, et al. Establishing a genetic detection method for river snails using multiplex PCR technology [J]. Modern Food, 2022, 28(07):195-197+201), microsatellites (Pan Xianhui, Zhou Kangqi, Lin Yong, et al. A river snail microsatellite molecular marker and its primers and applications [P]. Guangxi Zhuang Autonomous Region: CN202310832044.X, 2023-11-07) and real-time fluorescence PCR methods (Rees HC, Measures GH, KaneSD, et al.Quantitative PCR (qPCR) assay for the specific detection of theChinese mystery snail (Cipangopaludina chinensis) in the UK [J]. PLoS ONE, 2023, 18(10).e0292163) for detection and use in aquatic environment monitoring.

[0004] The source detection method based on ordinary PCR technology requires sequencing confirmation for positive results (SN / T2978-2011, PCR detection method for chicken-derived ingredients in animal-derived products [S]), which not only increases the detection cost, but also makes it impossible to carry out high-throughput detection. Compared with ordinary PCR methods, real-time fluorescence PCR has the advantages of high sensitivity, no need for electrophoresis, and simple operation. It is used in the identification of source component adulteration and forms an inspection standard (GB / T 38164-2019, Real-time fluorescence PCR method for common livestock and poultry animal-derived component detection methods [S]). Real-time fluorescence PCR methods can be divided into two types: dye method and probe method. The fluorescent dye in the dye method real-time fluorescence PCR can bind to double-stranded DNA to emit fluorescence, and its binding is non-specific. The primer dimer and DNA template in the system will bind to it, so the specificity of the dye method is not high. The probe in the probe method can specifically bind to the template, and its amplification curve reflects the accumulation of specific products, and does not contain non-specific amplification components. The sensitivity is 10 times higher than that of the dye method. In addition, the dye method only supports single-channel reactions. If multi-channel tests are required, or if different targets of the same sample are to be detected, the probe method is the most commonly used. The MGB probe increases the specificity of the probe by connecting a minor groove binder (MGB) to the 3′ or 5′ end of the probe to increase the melting temperature (Tm value). This enables the probe to more accurately identify the target sequence and reduce the possibility of nonspecific amplification. Theoretically, as long as there is a mismatch between the MGB probe and the target fragment, the MGB probe will not bind to the target fragment, will not be hydrolyzed, and will not have a fluorescent signal. ‌ At present, there are no reports on the use of real-time fluorescence PCR technology based on TaqMan-MGB to detect golden apple snails and field snails in food.

[0005] To this end, the present invention utilizes the mitochondrial genome data of Pomacea canaliculata, Pomacea punctata, newly invasive Pomacea canaliculata, Pomacea chinensis, and Pomacea sinensis published in GenBank, designs specific probes and primers in species-specific regions through sequence comparison analysis, and establishes a method capable of effectively identifying Pomacea canaliculata and Pomacea canaliculata based on TaqMan-MGB real-time fluorescence PCR technology, so as to provide technical support for combating the illegal acts of adulteration or impersonation of Pomacea canaliculata by Pomacea canaliculata and serving market supervision, thereby protecting consumers' right to know and food safety. Summary of the invention

[0006] The technical problem to be solved by the present invention is to develop a set of specific probe primer combinations, a detection kit and a real-time fluorescence PCR method which can effectively identify field snails and golden apple snails.

[0007] To this end, the present invention provides a probe and primer combination, characterized in that the probe and primer combination comprises the following two groups of probe and primer combinations: The nucleotide sequence of the probe in set 1 was 5′-TGGAGAGTTCTTATTAAAA-3′, and the nucleotide sequences of the primers were 5′-TAGTTACCATAGGGATAACAGCATAATCTT-3′ and 5′-TAGTCCAACATCGAGGTCACAA-3′; The nucleotide sequence of the second set of probes was 5'-TTAGGAGTTCTAATCGAAA-3', and the nucleotide sequences of the primers were 5'-TAGTTACCATAGGGATAACAGCATAATCTT-3' and 5'-TAGTCCAACATCGAGGTCACAA-3', respectively.

[0008] In some embodiments, the 5' end of the probe is labeled with a fluorescent group FAM, and the 3' end is labeled with a quencher group MGB.

[0009] The present invention also provides a detection kit, characterized in that the detection kit comprises the above-mentioned probe and primer combination and a field snail-derived sample and a Pomacea canaliculata-derived sample; Among them, the field snail-derived sample is a field snail genomic DNA sample with a concentration of not less than 0.1 ng / μL; the Pomacea canaliculata-derived sample is a Pomacea canaliculata genomic DNA sample with a concentration of not less than 0.1 ng / μL.

[0010] The present invention also provides a real-time fluorescence PCR detection method, characterized in that the real-time fluorescence PCR detection is performed using the above-mentioned detection kit, wherein the final concentration of primers in the PCR reaction system is 0.8 μM, and the final concentration of the probe is 0.4 μM.

[0011] The present invention also provides the use of the above-mentioned probe and primer combination, the above-mentioned detection kit, and the above-mentioned detection method in effectively identifying samples and food materials of field snails and golden apple snails.

[0012] The beneficial effects of the present invention are as follows: utilizing the genome data of golden apple snails and field snails published in GenBank, through sequence comparison analysis, designing probe and primer combinations in species-specific regions, and screening out the probe and primer combinations with the best specificity from multiple combinations, optimizing the real-time fluorescence PCR detection system on this basis, establishing a real-time fluorescence PCR method for rapidly and effectively distinguishing field snails from golden apple snails, and being able to complete the detection and identification of field snail samples with a concentration of not less than 0.1 ng / μL and golden apple snail samples with a concentration of not less than 0.1 ng / μL, with extremely high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Other features, objects and advantages of the present application will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings.

[0014] Figure 1 Amplification curve of primer-probe combination T1.

[0015] 1: snail DNA; 2: DNA of Pomacea canaliculata; 3: DNA of Pomacea canaliculata; 4: Hybrid apple snail DNA of the small-tubular apple snail and the spotted apple snail.

[0016] Figure 2 Amplification curve of primer-probe combination F1.

[0017] 1: snail DNA; 2: DNA of Pomacea canaliculata; 3: DNA of Pomacea canaliculata; 4: Hybrid apple snail DNA of the small-tubular apple snail and the spotted apple snail.

[0018] Figure 3 Amplification curve of T1 combination primer-probe concentration optimization, using river snail DNA as template.

[0019] 1: Primer / probe concentration is 0.8 µM / 0.4 µM; 2: Primer / probe concentration is 0.6 µM / 0.3 µM; 3: Primer / probe concentration is 0.4 µM / 0.2 µM; 4: Primer / probe concentration is 0.2 µM / 0.1 µM; 5: Primer / probe concentration is 0.1 µM / 0.05 µM.

[0020] Figure 4 Amplification curve of the optimized F1 combination primer-probe concentration. Red represents the tubular Pomacea canaliculata and green represents the spotted Pomacea canaliculata.

[0021] 1: Primer / probe concentration is 0.8 µM / 0.4 µM; 2: Primer / probe concentration is 0.6 µM / 0.3 µM; 3: Primer / probe concentration is 0.4 µM / 0.2 µM; 4: Primer / probe concentration is 0.2 µM / 0.1 µM; 5: Primer / probe concentration is 0.1 µM / 0.05 µM.

[0022] Figure 5 Amplification curve of T1 combined sensitivity test.

[0023] 1: Snail DNA concentration is 10 ng / μL; 2: Snail DNA concentration is 1 ng / μL; 3: Snail DNA concentration is 0.1 ng / μL; 4: Snail DNA concentration is 0.01 ng / μL; 5: Snail DNA concentration is 0.001 ng / μL; 6: Snail DNA concentration is 0.0001 ng / μL; 7: Snail DNA concentration is 0.00001 ng / μL; 8: ddH 2 O.

[0024] Figure 6 F1 combination sensitivity test amplification curve, red represents small tube apple snails, green represents spotted apple snails, and brown represents hybrid apple snails.

[0025] 1: The concentration of Pomacea canaliculata DNA is 10 ng / μL; 2: The concentration of Pomacea canaliculata DNA is 1 ng / μL; 3: The concentration of Pomacea canaliculata DNA is 0.1 ng / μL; 4: The concentration of Pomacea canaliculata DNA is 0.01 ng / μL; 5: The concentration of Pomacea canaliculata DNA is 0.001 ng / μL; 6: The concentration of Pomacea canaliculata DNA is 0.0001 ng / μL; 7: The concentration of Pomacea canaliculata DNA is 0.00001 ng / μL; 8: ddH 2 O.

[0026] Figure 7 Amplification curve of sensitivity test of adulterated snail samples.

[0027] 1: 100% Pomacea canaliculata; 2: The mass percentage of golden apple snails in the adulterated field snails is 50%; 3: The mass percentage of golden apple snails in adulterated field snails is 10%; 4: The mass percentage of golden apple snails in the adulterated field snails is 1%; 5: The mass percentage of golden apple snails in adulterated field snails is 0.1%; 6: The mass percentage of golden apple snails in adulterated field snails is 0.01%; 7: The mass percentage of golden apple snails in adulterated field snails is 0.001%; 8: ddH 2 O. DETAILED DESCRIPTION

[0028] The present invention will be further described below in conjunction with the accompanying drawings. The following examples are only used to illustrate the present invention but do not limit the scope of the present invention.

[0029] Example 1 Design and screening of specific primer / probe combinations 1. Primer probe design Download Pomacea canaliculata from GenBank Pomacea canaliculata , Spotted Apple Snail Pomacea maculata Newly discovered invasive species Pomacea occulta The mitochondrial genome sequences of Cipangopaludina(C. chinensis and C.cahayensis ) mitochondrial gene sequences (sequence numbers are KX688549, NC_025577, and NC_035734), and multiple alignments of sequences were performed using ClustalW Alignment. Primers and probes for detecting components derived from Pomacea canaliculata were designed by selecting regions that are conserved in various Pomacea canaliculata and specific to field snails, and primers and probes for detecting components derived from field snails were designed by selecting regions that are conserved in field snails and specific to Pomacea canaliculata. Specific information of the designed primers and probes is shown in Tables 1 and 2.

[0030] Table 1 Information on candidate primers and probes for real-time fluorescence PCR detection of snail-derived

[0031] Table 2 Information on candidate primers and probes for real-time fluorescence PCR detection of Pomacea canaliculata

[0032] 2. Sample Collection and Genomic DNA Extraction The golden apple snails collected from the wild and the fresh field snails purchased from the market are subjected to morphological and molecular biological identification in the laboratory before being pre-processed for genome extraction.

[0033] Pre-treatment: References for pre-treatment of snails (He Chao, Yang Qianqian, Liu Suwen, et al. Multiplex PCR identification method for species of Pomacea canaliculata, an alien invasive organism in my country [J]).

[0034] Pretreatment of snail tissue: Take a living adult snail and place it at the bottom of a 500 mL beaker. When the snail's ventral foot and head extend the operculum and crawl, quickly pour about 10 times the volume of the snail into the beaker, gently shake the beaker for 3 minutes, and then transfer the snail and immerse it in 95% ethanol. This process is not only conducive to the separation of the snail soft tissue and the shell, but also removes the mucus on the surface of the snail to avoid adverse effects on subsequent PCR. Wash the whole with 75% ethanol three times and place it on a clean filter paper. After the surface alcohol evaporates, transfer it to a 1.5 mL centrifuge tube, take the whole snail and add an appropriate amount of liquid nitrogen to fully grind it. Pretreatment of commercially available samples: Take an appropriate amount of snail meat, wash it with 75% ethanol three times and place it on a clean filter paper. After the surface alcohol evaporates, add an appropriate amount of liquid nitrogen to fully grind it.

[0035] Genomic DNA extraction (using the whole blood genomic DNA extraction kit produced by Bio-Rad Biotechnology (Beijing) Co., Ltd.): Refer to the DNA extraction kit instructions for steps.

[0036] Take 25 mg of tissue and place it in a 1.5 mL centrifuge tube. Add 180 μL of Buffer GL, 20 μL of Proteinase K and 10 μL of RNase A (10 mg / mL). Incubate in a 56°C water bath until the tissue is completely lysed. Centrifuge at 12,000 rpm for 2 minutes after lysis. Remove impurities before proceeding. Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol to the lysate and mix thoroughly by pipetting. Place the adsorption column on the collection tube, add the mixed solution to the adsorption column, centrifuge at 12,000 rpm for 2 minutes, and discard the filtrate. Add 500 μL of buffer WA to the adsorption column, centrifuge at 12,000 rpm for 1 minute, and discard the filtrate. Add 700 μL of buffer WB to the adsorption column, centrifuge at 12,000 rpm for 1 minute, and discard the filtrate. Repeat by adding 700 μL of buffer W to elute. Place the adsorption column in the collection tube and centrifuge at 12,000 rpm for 2 minutes. Place the adsorption column in a new 1.5 mL centrifuge tube, add 100 μL of dissolving solution preheated to 65°C to the center of the filter membrane, place at room temperature for 5 minutes, and centrifuge at 12,000 rpm for 2 minutes. Add the centrifuged liquid to the center of the adsorption column and repeat the elution once. Obtain the corresponding DNA. Use an ultra-micro UV spectrophotometer for concentration detection.

[0037] 3. Screening of primers and probes The genomic DNA of identified golden apple snails and field snails was used as a template, and amplification was performed with the designed primer and probe combinations (shown in Tables 1 and 2), and primer and probe combinations specific to the target gene were screened.

[0038] The primers in the primer probe combination T1-T3 were used to amplify the DNA of the river snail, and the primers in the primer probe combination F1-F3 were used to amplify the DNA of the golden apple snail.

[0039] PCR reaction system: 2×Premix TaqTM mixed solution 12.5 μL, 10 μM primers 1 μL each, template DNA 1 μL, ddH 2 0 to a total volume of 25 μL.

[0040] PCR amplification conditions: 94°C for 5 min; 94°C for 30 s, annealing for 30 s, 72°C for 1 min, 35 cycles; 72°C for 10 min, 4°C. Among them, 4 different annealing temperatures were set at 53°C, 56°C, 56°C, and 62°C.

[0041] After PCR amplification is completed, electrophoresis is performed and the annealing temperature of the brightest target band is selected as the annealing temperature of the real-time fluorescence PCR reaction.

[0042] The experimental results showed that the target band was brightest when the annealing temperature was 56°C, and 56°C was selected as the annealing temperature for subsequent real-time fluorescence PCR.

[0043] Real-time fluorescence PCR amplification of genomic DNA of river snail and golden apple snail was performed using primer probe combination T1-T3 and F1-F3.

[0044] Real-time fluorescence PCR reaction system: 2× Probe qPCR mix 12.5 μL, 10 μM primers 1 μL each, 10 μM probe 0.5 μL, DNA template 1 μL, ddH 2 0 to a total volume of 25 μL.

[0045] Real-time fluorescence PCR reaction conditions: 94°C for 5 min; 94°C for 30 s, 56°C annealing for 30 s, 72°C for 1 min, 40 cycles.

[0046] When an amplification curve is formed and the Ct value is ≤35, it is judged as positive. If there is no typical amplification curve or the Ct value is >35, it is judged as negative. Among the primer and probe combinations T1-T3 for river snails, only the amplification result of combination T1 meets expectations ( Figure 1 ), that is, it can specifically amplify the genomic DNA of river snails, but cannot amplify the DNA samples of golden apple snails; among the primer and probe combinations F1-F3 for golden apple snails, only the amplification result of combination F1 met expectations ( Figure 2 ), that is, it can specifically amplify the genomic DNA of Golden Apple Snail, but cannot amplify the DNA sample of Field Snail.

[0047] The specific sequences and positions of the probes and primers of the T1 combination are as follows (the underline indicates the position of the primer, and the bold part indicates the position of the probe): KX688549: GAGA TAGTTACCATAGGGATAACAGCATAATCTT CTTGGAGAGTTCTTATTAAAAAGGGGGG TTGTGAC CTCGATGTTGGACTA AAATATCCTAAGGGTG NC_025577: GAGA TAGTTACCATAGGGATAACAGCATAATCTT CTTGGAGAGTTCTTATTAAAAAGGGGGG TTGTGAC CTCGATGTTGGACTA AAATATCCTAAGGGTG NC_035734: GAGA TAGTTACCATAGGGATAACAGCATAATCTT CTTGGAGAGTTCTTATTAAAAAGGGGGG TTGTGAC CTCGATGTTGGACTA AAATATCCTAATGGTG The sequences of the T1 combination primers and probe are as follows: Primer T1-F: 5'-TAGTTACCATAGGGATAACAGCATAATCTT-3' Primer T1-R: 5′-TAGTCCAACATCGAGGTCACAA-3′ Probe T1-P: FAM-TGGAGAGTTCTTATTAAAA-MGB The specific sequences and positions of the probes and primers of the F1 combination are as follows (the underline indicates the position of the primer, and the bold part indicates the position of the probe): KJ739609: GAAT TAGTTACCATAGGGATAACAGCATAATCTT TCTTAGGAGTTCTAATCGAAAGAAAGGA TTGTGAC CTCGATGTTGGACTA GAATATCCTAAAGGTG MF401379: GAAT TAGTTACCATAGGGATAACAGCATAATCTT TCTTAGGAGTTCTAATCGAAAGAAAGGA TTGTGAC CTCGATGTTGGACTA GAATACCCTAAAGGTG KR350466: GAAT TAGTTACCATAGGGATAACAGCATAATCTT TCTTAGGAGTTCTAATCGAAAGAAAGGA TTGTGACCTCGATGTTGGACTA GAATATCCTAAAGGTG The primer and probe sequences of the F1 combination are as follows: Primer F1-F: 5'-TAGTTACCATAGGGATAACAGCATAATCTT-3' Primer F1-R: 5'-TAGTCCAACATCGAGGTCACAA-3' Probe F1-P: FAM-TTAGGAGTTCTAATCGAAA-MGB Example 2 Optimization of real-time fluorescence PCR reaction system The present invention obtains a usable probe and primer combination through the operation of Example 1, and preliminarily establishes a real-time fluorescence PCR reaction system. However, whether the specific real-time fluorescence PCR reaction system can have a better effect is also affected by factors such as the concentration of primers and probes. Therefore, in order to obtain efficient and accurate identification results, the PCR reaction system needs to be further optimized.

[0048] The final concentration of the primers was set to 5 concentration gradients, namely 0.1 μM, 0.2 μM, 0.4 μM, 0.6 μM and 0.8 μM, and the corresponding probe concentration was 1 / 2 times the primer concentration. Three replicates were set for each treatment. The amplification curve of the T1 combination for the snail DNA template is shown in Figure 3 The amplification curve of the F1 combination for the DNA templates of Pomacea canaliculata and Pomacea canaliculata is shown in Figure 4 .

[0049] The results showed that when the T1 and F1 combinations were used to amplify the same template, the Ct value of the PCR reaction was the smallest and the fluorescence signal value was the highest when the final concentration of the primer was 0.8 μM and the final concentration of the probe was 0.4 μM. Therefore, the final concentration of the primer in the subsequent experiments was determined to be 0.8 μM and the concentration of the probe was 0.4 μM.

[0050] The optimized reaction system is: 2× Probe qPCR mix 12.5 μL, 10 μM primers 2 μL each, 10 μM probe 1 μL, template DNA 1 μL, ddH 2 0 to a total volume of 25 μL.

[0051] Example 3 Sensitivity test Sensitivity refers to the lowest copy number of a sample that can be detected by the PCR amplification reaction, that is, the lowest detection limit. When real-time fluorescence PCR is used to detect samples of different concentrations, when a sample of a certain concentration can form an amplification curve but the Ct value is >35, it is considered that the concentration exceeds the lowest detection limit of the PCR system.

[0052] The extracted genomic DNA was measured by ultra-micro UV spectrophotometer for DNA concentration and adjusted to 10 ng / μL, and diluted to 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, 0.0001 ng / μL and 0.00001 ng / μL according to a 10-fold gradient, and 1.0 μL of each concentration of DNA was taken as a template, and amplified according to the real-time fluorescence PCR method optimized in Example 2, and the experiment was repeated 3 times. When a certain concentration of template cannot form an amplification curve or the Ct value is >35, it is considered that the concentration exceeds the minimum detection limit of the real-time fluorescence PCR system.

[0053] 1. Sensitivity detection of snail origin According to the above method, 7 snail DNA templates with concentrations of 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, 0.0001 ng / μL and 0.00001 ng / μL were obtained. Real-time fluorescence PCR amplification was performed on the 7 concentration gradient DNA templates using the T1 combination according to the optimized method in Example 2, with 3 parallel replicates.

[0054] The amplification conditions were 94°C for 5 min, 94°C for 30 s, 56°C for 30 s, 72°C for 1 min, and 40 cycles. The amplification results are shown in Table 3, and the amplification curves are shown in Figure 5 .

[0055] Table 3 Results of amplifying snail DNA templates at different concentration gradients using T1 combination

[0056] The Ct value is expressed as the average of repeated experiments, and “NA” indicates no amplification curve.

[0057] The above-mentioned sensitivity test results of snail-derived samples showed that the minimum detection limit of snail samples was 0.1 ng / μL.

[0058] 2. Sensitivity detection of Pomacea canaliculata The same method was used to obtain DNA templates of Pomacea canaliculata, Pomacea maculata, and hybrids of Pomacea canaliculata and Pomacea maculata at concentrations of 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL, 0.001 ng / μL, 0.0001 ng / μL, and 0.00001 ng / μL. The templates of 7 concentration gradients were amplified using the F1 combination according to the method optimized in Example 2, with 3 parallel replicates.

[0059] The amplification conditions were 94°C for 5 min, 94°C for 30 s, 56°C for 30 s, 72°C for 1 min, and 40 cycles. The amplification results are shown in Table 4, and the amplification curves are shown in Figure 6 .

[0060] Table 4 Results of amplifying DNA templates of Pomacea canaliculata at different concentration gradients using the F1 combination

[0061] The Ct value is expressed as the average of repeated experiments, and “NA” indicates no amplification curve.

[0062] The sensitivity test results of the above Pomacea canaliculata sources showed that the minimum detection limit for Pomacea canaliculata and hybrid Pomacea canaliculata was 0.01 ng / μL, and the detection limit for Pomacea punctata was 0.1 ng / μL. Overall, the minimum detection limit for Pomacea canaliculata was 0.1 ng / μL.

[0063] Example 4 Detection Kit The kit for detecting river snails and golden apple snails was prepared according to the following composition: 2× Probe qPCR mix, probe primer combination (primer and probe concentrations were 10 μM), river snail-derived genomic DNA sample (concentration not less than 0.1 ng / μL), golden apple snail-derived genomic DNA sample (concentration not less than 0.1 ng / μL), and ddH 2 O.

[0064] The primers and probes were the combination T1 and F1 described in Example 1.

[0065] The reaction system of this kit can be: 2× Probe qPCR mix 12.5 μL, 10 μM primers 2 μL each, 10 μM probes 1 μL each, template DNA 1 μL, ddH 2 0 to a total volume of 25 μL.

[0066] The reaction program of the kit for real-time fluorescence PCR is: 94°C for 5 min; 94°C for 30 s, 56°C for 30 s, 72°C for 1 min, and 40 cycles.

[0067] When the kit is used to detect a sample, an amplification curve is obtained through the fluorescent signal detected by the instrument, and whether the sample contains field snails or golden apple snails is identified based on the Ct value.

[0068] Example 5 Sensitivity test of adulterated snail samples 1. Preparation of adulterated snail samples Add different amounts of Pomacea canaliculata to field snails. Take 25 mg of Pomacea canaliculata tissue, extract DNA from Pomacea canaliculata and field snails according to the DNA extraction method in Example 1, and obtain 100 μL of Pomacea canaliculata DNA. Repeat the process for 6 tubes, mix the obtained Pomacea canaliculata DNA, and obtain 600 μL of 100% Pomacea canaliculata DNA, which is recorded as a sample with an adulteration mass percentage of 100%. Use the same method to obtain 600 μL of field snail DNA.

[0069] Take 50 μL of 100% Pomacea canaliculata DNA and mix it with 50 μL of 100% river snail DNA to obtain 100 μL of 50% adulterated DNA. Take 10 μL of 100% Pomacea canaliculata DNA and mix it with 90 μL of 100% river snail DNA to obtain 100 μL of 10% adulterated DNA. Take 10 μL of 10% adulterated DNA and mix it with 90 μL of 100% river snail DNA to obtain 100 μL of 1% adulterated DNA. DNA with adulteration percentages of 0.1%, 0.01%, and 0.001% were obtained in turn.

[0070] 2. Adulteration sensitivity detection Real-time fluorescence PCR amplification was performed using the detection kit described in Example 4 and the reaction system optimized in Example 2 to detect adulterated snail samples. The amplification results are shown in Tables 5 and Figure 7 shown.

[0071] Table 5 Results of amplifying adulterated snail samples using the F1 combination

[0072] The Ct value is expressed as the average of repeated experiments, and “NA” indicates no amplification curve.

[0073] The test results of the above-mentioned adulterated snail samples showed that the minimum detection limit of adulteration was 1%.

[0074] Example 6: Detection of online purchased food Using "field snails", "snails" and "snail meat" as keywords, we searched online and randomly purchased 26 ingredients, including 14 instant field snail snacks, 3 snail noodles and 9 frozen snail meat skewers. Among them, only 4 snail meat skewers had golden apple snail ingredients in the ingredient list (labeled as "rice field bottle snail"); the ingredient list of other ingredients did not have golden apple snail ingredients.

[0075] The samples were randomly sampled and mixed evenly, and the genomic DNA of the food was extracted using the method of Example 1. Real-time fluorescence PCR amplification was performed using the kit described in Example 4 and the reaction system optimized in Example 2. The detection results are shown in Table 6.

[0076] The Ct values ​​of samples 1 to 17 amplified by T1 combination were all less than 35, indicating that they contained snail components. No fluorescence signals were detected in amplified samples 18 to 26, indicating that they did not contain snail components.

[0077] The Ct values ​​of samples 5, 18-26 amplified by F1 combination were all less than 35, indicating that they contained Pomacea canaliculata components; no fluorescence signals were detected in the remaining samples, indicating that they did not contain Pomacea canaliculata components.

[0078] The ingredients of samples 23-26 were marked as "rice field bottle snails", and the test results were consistent with the label. Sample 5 was detected with both river snails and golden apple snails, indicating that the sample was an adulterated sample. The ingredients of samples 18-22 were marked with river snails but not golden apple snails, and only golden apple snails were detected, indicating that golden apple snails were impersonated as river snails.

[0079] It can be seen that the detection system established by the present invention has good specificity and can quickly and effectively identify river snails and golden apple snails.

[0080] Table 6 Test results of online food samples

[0081] The above is only a preferred embodiment of the present invention, and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with this profession can use the technical content disclosed above to make changes or modifications to equivalent embodiments of equivalent changes without departing from the scope of the technical solution of the present invention. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A probe and primer combination, characterized in that The probe and primer combination comprises the following 2 sets of probes and primers: The nucleotide sequence of the probe in set 1 was 5′-TGGAGAGTTCTTATTAAAA-3′, and the nucleotide sequences of the primers were 5′-TAGTTACCATAGGGATAACAGCATAATCTT-3′ and 5′-TAGTCCAACATCGAGGTCACAA-3′; The nucleotide sequence of the second set of probes was 5'-TTAGGAGTTCTAATCGAAA-3', and the nucleotide sequences of the primers were 5'-TAGTTACCATAGGGATAACAGCATAATCTT-3' and 5'-TAGTCCAACATCGAGGTCACAA-3', respectively.

2. The probe and primer combination according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group MGB.

3. A detection kit, characterized in that: The detection kit comprises the probe and primer combination according to any one of claims 1 to 2 and a sample derived from a river snail and a sample derived from a golden apple snail; Among them, the field snail-derived sample is a field snail genomic DNA sample with a concentration of not less than 0.1 ng / μL; the Pomacea canaliculata-derived sample is a Pomacea canaliculata genomic DNA sample with a concentration of not less than 0.1 ng / μL.

4. Real-time fluorescence PCR detection method, characterized in that, The detection kit according to claim 3 is used for real-time fluorescence PCR detection, wherein the final concentration of primers in the PCR reaction system is 0.8 μM, and the final concentration of the probe is 0.4 μM.

5. Use of the probe and primer combination according to any one of claims 1 to 2, the detection kit according to claim 3, and the detection method according to claim 4 in identifying samples of river snails and golden apple snails.

Images