3 'UTR for improving mRNA translation efficiency and application thereof

Abstract

The invention discloses a 3 'UTR capable of improving mRNA translation efficiency and application of the 3' UTR, belongs to the technical field of biology, provides a 3 'UTR sequence capable of regulating mRNA translation efficiency, a corresponding DNA molecule, a carrier, a host cell and an RNA molecule, and further provides a method for improving mRNA translation efficiency and related application. And the improved mRNA translation efficiency is 2-3 times that of a common 3 'UTR sequence no matter under the condition of base modification or non-modification.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a 3'UTR for improving mRNA translation efficiency and an application thereof. Background Art

[0002] In recent years, nucleic acid drugs represented by DNA and RNA have gradually become a hot spot in precision medicine and disease treatment. Compared with traditional drugs, nucleic acid drugs have the advantages of abundant candidate targets, simple design, short R&D cycle, strong targeting specificity, high expression efficiency, and long duration of action. Nucleic acid drugs can be roughly divided into two categories: DNA drugs and RNA drugs. Compared with DNA drugs, RNA drugs have lower risks of genomic integration and induced mutations, higher expression efficiency, and no risk of continuous cumulative toxicity, and have broader application prospects in disease prevention and treatment.

[0003] The complete mRNA molecule includes a 5' cap structure, a 5' untranslated region (5'UTR), an antigen coding sequence, a 3' untranslated region (3'UTR) and a polyadenylated tail. Except for the antigen coding sequence, other structural elements are crucial to the stability and transcription efficiency of mRNA. Among them, the 5' untranslated region determines the translation initiation rate, and the 3' untranslated region mainly affects the stability and expression regulation of mRNA. The design and selection of UTR are crucial to ensure sufficient production of antigens and effective vaccination. Existing technologies often use the UTR sequences of some naturally occurring human stable and highly expressed genes to drive the expression of mRNA vaccines. These sequences can improve the translation efficiency and stability of mRNA to a certain extent after natural evolution selection. However, the UTR sequences in viruses whose genetic material is ssRNA (+) are less developed. Summary of the invention

[0004] In order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions.

[0005] The present invention provides a 3'UTR sequence for regulating mRNA translation efficiency. The 3'UTR sequence is shown in SEQ ID NO:1.

[0006] Furthermore, the 3'UTR sequence is a sequence without base modification.

[0007] In some embodiments, the 3'UTR sequence can be a base-modified sequence, pyridin-4-one ribonucleoside, 5-iodouridine, 5-iodine, 5-aza-uridine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thiouridine, 2-thiouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurine methyl uridine, 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thiouridine, 1-taurine methyl-4-thiouridine, 5-methyl -uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, 5-methylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl -pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-l-methyl-pseudoisocytidine, 4-thio-l-methyl-1-deaza-pseudoisocytidine, 1-methyl-l-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4 -methoxy-l-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylaminoformyladenosine, N6-threonylaminoformyladenosine, 2-methylthio-N6-threonylaminoformyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, 2-methoxy-adenine, inosine, 1-methyl-inosine, ybutosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxy-guanosine, 7-methyl-8-oxy-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N1-methylpseudouridine, and N2,N2-dimethyl-6-thio-guanosine.

[0008] In some embodiments, in order to reduce safety issues (potential toxicity risks, immunogenicity issues, genetic stability issues, off-target issues, etc.) caused by base modification, the 3'UTR sequence in the present invention is base-free.

[0009] The present invention provides a DNA molecule, which comprises a nucleotide sequence for transcribing the aforementioned 3'UTR sequence, and the DNA molecule is transcribed into mRNA.

[0010] Furthermore, the DNA molecule comprises a chain having the following elements: a coding region, a nucleotide sequence encoding a 5'UTR sequence located upstream of the coding region, and a nucleotide sequence encoding a 3'UTR sequence located downstream of the coding region, wherein the 3'UTR sequence is the 3'UTR sequence described above.

[0011] Further, the coding region includes a start codon at the 5' end, the coding region encodes a polypeptide, and the coding region includes a stop codon at the 3' end.

[0012] The DNA molecule of the present invention is a DNA molecule that can be transcribed into an mRNA molecule. Transcription is the first step of gene expression, in which a specific segment of a DNA molecule is copied into an mRNA molecule by an enzyme (RNA polymerase). During transcription, RNA polymerase reads the DNA sequence, which produces a complementary, antiparallel RNA chain, referred to as a primary transcript. Only one of the two DNA chains serves as a template for transcription. During transcription, DNA-dependent RNA polymerase reads the antisense strand of DNA from the 3' end to the 5' end (3' → 5'). Complementary RNA is produced in the opposite direction - in the 5' → 3' direction - to match the sequence of the sense strand, except that thymine is converted into uracil. This directionality is because RNA polymerase can only add nucleotides to the 3' end of the growing mRNA chain. The non-template sense strand of DNA is referred to as the coding strand because its sequence is identical to the newly generated RNA transcript (except that thymine is replaced by uracil). When representing a DNA sequence, this is a strand used by convention and in the context of the present invention.

[0013] In this article, mRNA molecules can be decoded and translated into proteins by ribosomes according to the information provided by "genetic code". The coding region usually starts with the start codon at its 5' end and ends with a stop codon. In general, the start codon is an ATG triplet (corresponding to the AUG triplet on the RNA level), and the stop codon is TAA, TAG or TGA (corresponding to UAA, UAG or UGA on the RNA level). In addition to encoding proteins, the part of the coding region can serve as an exon splicing enhancer or an exon splicing silencer to serve as a regulatory sequence in pre-mRNA. The gene coding region of the coded polypeptide or protein used according to the present invention is also referred to as a coding sequence or CDS (from a coding DNA sequence), and is a part of the DNA or RNA of a gene, consisting of exons, coding polypeptides or proteins. The flanks of the coding region in mRNA are 5' untranslated regions (5'UTR) and 3' untranslated regions (3'UTR), which are also parts of exons.

[0014] The present invention provides a vector, which comprises the aforementioned DNA molecule.

[0015] In some embodiments, the vector of the present invention may be, for example, a plasmid, a cosmid, a virus, a phage or another vector conventionally used, for example, in genetic engineering, and may comprise further genes, such as marker genes, which allow selection of the vector in a suitable host cell and under suitable conditions.

[0016] The DNA molecules of the present invention can be introduced into a vector, preferably an expression vector, by standard molecular biology techniques (see, for example, Sambrook et al., Molecular Cloning, A laboratory manual, 2nd edition, 1989). The term "vector" such as "expression vector" or "cloning vector" in the meaning of the present invention is understood to be a circular, double-stranded unit DNA that is replicated independently of chromosomal DNA in a cell and is used as a vector (vehicle) for carrying genetic material into a cell, in which it can be replicated and / or expressed (i.e., transcribed into RNA and translated into an amino acid sequence). A vector containing foreign DNA is referred to as recombinant DNA. The vector itself is generally a DNA sequence that is typically composed of an insert (e.g., nucleic acid molecules / DNA molecules of the present invention) and a larger sequence that serves as a vector "backbone". In the meaning of the present invention, plasmids are most commonly found in bacteria and used in recombinant DNA research to transfer genes between cells, and are therefore a subgroup of the "vector" used in the meaning of the present invention.

[0017] The present invention provides a host cell, wherein the host cell comprises the above-mentioned vector.

[0018] The present invention also relates to a host cell comprising a vector of the present invention. Therefore, the present invention relates to a host transfected or transformed with a vector of the present invention or a non-human host carrying a vector of the present invention, i.e., to a host cell or host genetically modified (genetically modified) with a DNA molecule according to the present invention or with a vector comprising such a DNA molecule. The term "genetically modified" means that a host cell or host comprises a DNA molecule or vector according to the present invention that is introduced into a cell or host or into one of its ancestors / parents in addition to its natural genome. The DNA molecule or vector may be present in a genetically modified host cell or host, or as an independent molecule outside the genome, preferably as a molecule capable of replication, or it may be stably integrated into the genome of a host cell or host.

[0019] Host cells of the present invention can be any prokaryotic cell or eukaryotic cell. Suitable prokaryotic cells are prokaryotic cells such as, Escherichia coli (E.coli) or Bacillus subtilis (Bacillus subtilis) that are generally used for cloning. And, eukaryotic cells include, for example, fungal cells or animal cells. The example of suitable fungal cells is yeast cells, preferably yeast cells of Saccharomyces cerevisiae and most preferably yeast cells in Saccharomyces cerevisiae. Suitable animal cells are, for example, insect cells, vertebrate cells, preferably mammalian cells, such as, for example, HEK293, NSO, CHO, COS-7, MDCK, U2-OSHela, NIH3T3, MOLT-4, Jurkat, PC-12, PC-3, IMR, NT2N, Sk-n-sh, CaSki, C33A. Further suitable cell lines known in the art can be obtained from cell line repositories, such as, for example, Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) or American Type Culture Collection (ATCC). According to the present invention, it is further envisioned that primary cells / cell cultures can play the role of host cells. The cells are specifically derived from insects (such as insects of the genus Drosophila or Blattella) or mammals (such as humans, pigs, mice or rats). The host cells may also include cells from and / or derived from cell lines such as neuroblastoma cell lines. The above-mentioned primary cells are well known in the art and especially include primary astrocytes, (mixed) spinal cultures or hippocampal cultures.

[0020] The present invention provides a composition comprising the aforementioned DNA molecule, the aforementioned vector, or the aforementioned host cell.

[0021] The present invention provides an RNA molecule, wherein the RNA molecule comprises the above-mentioned 3'UTR sequence.

[0022] Furthermore, the RNA molecule comprises: a coding region, a 5'UTR sequence located upstream of the coding region, and a 3'UTR sequence located downstream of the coding region, wherein the 3'UTR sequence is the 3'UTR sequence described above.

[0023] Furthermore, the coding region includes a start codon at the 5' end, and the coding region encodes a polypeptide.

[0024] In the context of the present invention, it is understood that "coding region" refers to any polydeoxyribonucleotide molecule that, if introduced into a cell, can be transcribed into an mRNA molecule that can be translated into a polypeptide / protein or a fragment thereof. The terms "polypeptide" and "protein" herein include any kind of amino acid sequence, i.e., a chain of two or more amino acids, each of which is linked by a peptide bond and also includes peptides and fusion proteins.

[0025] In some embodiments, the coding region contains a DNA sequence deoxyribonucleotide sequence encoding a polypeptide / protein or a fragment thereof, whose function is required or beneficial in or near a cell, for example, a protein whose absence or defective form causes a disease or illness, whose provision can alleviate or prevent a disease or illness, or such a protein, which can promote a process beneficial to the body in or near a cell. The coding region may contain the sequence of a complete protein or a functional variant thereof. In addition, the deoxyribonucleotide sequence of the coding region may encode a protein that acts as a factor, inducer, regulator, stimulator or enzyme, or a functional fragment thereof, wherein such a protein is a protein whose function is necessary in order to treat a condition, specifically a metabolic disorder, or in order to initiate a process in the body, such as the formation of new blood vessels, new tissues, etc. Here, it should be understood that a functional variant means a fragment that can assume the function of a protein in a cell, the function of which is required in the cell or its absence or defective form is pathogenic.

[0026] In this context, according to the present invention, the DNA molecules of the present invention are transcribed and translated into mRNA and further into polypeptides or proteins, which can be intended to compensate or supplement endogenous gene expression, especially in cases where endogenous genes are defective or silent, resulting in the gene not expressing products, insufficient or defective products of gene expression or malfunction, such as in the case of various metabolic and genetic diseases such as, for example, cystic fibrosis, hemophilia or muscular dystrophy. The DNA molecules of the present invention are transcribed and translated into mRNA and further into polypeptides or proteins, which can also be intended to make the expressed products interact with or interfere with any endogenous cell process such as the regulation of gene expression, signal transduction and other cell processes. The DNA molecules of the present invention are transcribed and translated into mRNA and further into polypeptides or proteins, which can also be intended to cause an immune response in the case of an organism in which the transfected or transduced cells reside or are resided. An example is to genetically modify antigen presenting cells such as dendritic cells so that they present antigens for vaccination purposes. Another example is that the DNA molecules of the present invention are transcribed and translated into mRNA and further into polypeptides or proteins, wherein the coding region encodes a cytokine. This may be desirable, for example, in tumors in order to elicit a tumor-specific immune response.

[0027] In some embodiments, the "coding region" can be transcribed and translated into a partial length or full-length protein, which contains a cellular activity level equal to or greater than the cellular activity level of the native protein. In some embodiments, the "coding region" encodes a therapeutically active or pharmaceutically active polypeptide, protein or peptide with a therapeutic or preventive effect, wherein the polypeptide, protein or peptide is selected from those disclosed in an existing article or report. The "coding region" can be used to express a partial length or full-length protein, which has a cellular activity level equal to or less than the cellular activity level of the native protein. This allows the administration of RNA molecules to be indicated for the treatment of diseases.

[0028] The ribonucleic acid (RNA) molecule used according to the present invention relates to a polymeric molecule assembled into a chain of nucleotides called G, A, U, and C. Each nucleotide in RNA contains ribose, with carbons numbered 1' to 5'. Nitrogenous bases are attached to the 1' position, generally, adenine (A), cytosine (C), guanine (G), or uracil (U). In a polymeric RNA molecule, a phosphate group is attached to the 3' position of a ribose and the 5' position of the next ribose. Therefore, the nucleotides in the polymeric RNA molecule are covalently linked to each other, wherein the phosphate group from one nucleotide is bound to the 3' carbon on the subsequent nucleotide, thereby forming a phosphodiester bond. Therefore, the RNA chain has a 5' end and a 3' end, and is thus named after the carbon on the ribose ring. According to convention, upstream and downstream refer to the 5' to 3' direction in which RNA transcription occurs. Preferably, the RNA molecule is a messenger RNA (mRNA) molecule. mRNA is a large family of RNA molecules that transfer genetic information from DNA to ribosomes, wherein the RNA molecule specifies the amino acid sequence of the protein product of the gene expression. After RNA polymerase transcribes the primary transcript mRNA (called pre-mRNA), the processed, mature mRNA is translated into a polymer of amino acids: a protein, as outlined in the central dogma of molecular biology. As in DNA, mRNA genetic information exists in a sequence of nucleotides, which are arranged into codons, each of which consists of three bases. Each codon encodes a specific amino acid, except for the stop codon that terminates protein synthesis.

[0029] According to the above, the invention provides RNA molecules / polyribonucleic acid molecules, preferably modified polyribonucleic acid molecules. The sequence of RNA molecules / polyribonucleic acid can be derived from, for example, any suitable nucleic acid comprising the genetic information of a gene of interest. The example of nucleic acid includes genomic DNA, RNA or cDNA from any bacterial cell or archaeal cell comprising a gene of interest (one or more). Polynucleotides can be derived from nucleic acids carrying mutant genes and polymorphisms.

[0030] The RNA molecules of the present invention can be easily used in in vitro translation systems known in the art for efficient expression of any desired polypeptide or protein encoded by the coding region. In vitro translation systems are known in the art and can be used directly with the RNA molecules of the present invention. Alternatively, these in vitro translation systems can be used in combination with the above-mentioned in vitro transcription system. The corresponding cell-free systems for in vitro transcription and / or in vitro translation are known and available. These cell-free systems for protein synthesis (also referred to as in vitro protein synthesis or abbreviated as CFPS) allow the use of biological mechanisms without living cells to express / generate polypeptides or proteins. In these systems, the in vitro protein synthesis environment is not limited by the cell wall or the necessary steady-state conditions for maintaining cell viability and can directly enter and control the translation environment, which is advantageous for including the following multiple applications: optimization of protein generation, optimization of protein complexes, research protein synthesis, incorporation of non-natural amino acids, high-throughput screening, and synthetic biology. The common components of cell-free reactions include cell extracts, energy sources, amino acid supplies, cofactors such as magnesium, and DNA or RNA encoding desired polypeptides or proteins. Cell extracts can be obtained by lysing cells of interest and centrifuging cell walls, DNA genomes, and other debris. The remainder is the necessary cellular machinery, including ribosomes, aminoacyl-tRNA synthetases, translation initiation and elongation factors, nucleases, etc. In a cell-free system for synthesizing polypeptides or proteins starting from DNA (i.e., in a system comprising the steps of in vitro transcription and in vitro translation), two DNAs are usually used, i.e., plasmids or linear expression templates (LETs). In a cell-free system for synthesizing polypeptides or proteins starting from RNA (i.e., in a system comprising only the step of in vitro translation), RNA can be used directly.

[0031] The present invention provides a pharmaceutical composition, which comprises the aforementioned DNA molecule, the aforementioned vector, the aforementioned host cell, or the aforementioned RNA molecule.

[0032] Furthermore, the pharmaceutical composition optionally includes a pharmaceutically acceptable adjuvant.

[0033] The present invention provides a method for improving the translation efficiency of mRNA, which comprises the step of connecting the aforementioned 3'UTR sequence to the 3' end of the coding region of the mRNA to be translated.

[0034] The present invention provides the use of the above-mentioned 3'UTR sequence in the preparation of products for improving mRNA translation efficiency, preparing nucleic acid therapeutic drugs, and preparing mRNA vaccines.

[0035] The present invention provides the use of the aforementioned 3'UTR sequence, the aforementioned DNA molecule, the aforementioned vector, the aforementioned host cell, or the aforementioned RNA molecule in the preparation of a gene expression reagent or kit.

[0036] Translation efficiency is the rate at which mRNA is translated into polypeptide or protein in a cell. The translation efficiency of a given mRNA is measured as the number of proteins or polypeptides translated per mRNA per time unit. Translation is the process in which cell ribosomes produce proteins and is well known to technicians. Briefly, in translation, the messenger RNA (mRNA) produced by DNA transcription is decoded by ribosomes to produce specific amino acid chains or polypeptides or proteins. In the context of the present invention, translation efficiency is preferably the rate at which mRNA is translated into protein at a certain time point in a cell, which is related to the amount of mRNA encoding each protein at the same time point in the cell. Therefore, translation efficiency is the quotient of the amount of mRNA translated into protein at a certain time point in a cell and the mRNA encoding each protein. Two parameters, that is, the amount of mRNA translated into protein and the mRNA encoding each protein, can be determined by methods known in the art. As a non-limiting example, the amount of mRNA translated into protein in a cell can be determined, for example, by flow cytometry (FC), while the amount of mRNA encoding each protein can be measured by, for example, qPCR.

[0037] In the present invention, the term "expression efficiency" refers to the ability of transformed cells to express products. Specifically, it refers to the quotient of the amount of protein (polypeptide) synthesized by transformed cells and the amount of oligonucleotide used in a certain period of time.

[0038] Advantages and beneficial effects of the present invention:

[0039] The 3'UTR sequence provided by the present invention can significantly improve the expression efficiency of mRNA, and the improved mRNA translation efficiency is 2-3 times that of the commonly used 3'UTR sequence, whether in the case of base modification or unmodification. The nucleic acid molecule of the present invention can be used as an element for enhancing RNA expression efficiency in nucleic acid therapeutic drugs or mRNA vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a diagram of the Fluc mRNA in vitro transcription backbone vector.

[0041] Figure 2 The figure is the result of detecting the expression efficiency of FLuc mRNA containing various 3'UTRs in different cells transfected.

[0042] Figure 3This is a graph showing the expression efficiency test results of HepG2 cells transfected with FLuc mRNA containing the tandem 3'UTR.

[0043] Figure 4 This is a graph showing the expression efficiency test results of DC2.4 cells transfected with FLuc mRNA containing the tandem 3'UTR. DETAILED DESCRIPTION

[0044] Example 1 3'UTR sequence screening

[0045] 3'UTR plays a crucial role in regulating the stability and translation efficiency of mRNA. Among different virus families, ssRNA(+) viruses use the simplest and most efficient replication and expression strategy because the same molecule has both genome and mRNA functions. In addition, the nucleotide composition and codon usage of ssRNA(+) viruses are closest to human codons. Therefore, it is feasible in principle to try to screen the 3'UTR sequences of common ssRNA(+) viruses and use them as functional elements to regulate mRNA expression efficiency.

[0046] The present invention screened some common ssRNA (+) viruses, queried and downloaded their complete genome information from the National Center for Bioinformatics (NCBI), and isolated the UTR sequence of the virus. The length of the mRNA sequence restricts its industrial production efficiency. Too long UTR sequences not only require higher mRNA production processes, but also burden the translation efficiency of mRNA. Therefore, the present invention further removes 3'UTR sequences with a length of more than 300bp and difficult sequence synthesis, and finally obtains 3 sequences that can be used for testing, and their information is shown in Table 1.

[0047] Table 1

[0048]

[0049] Example 2 3'UTR vector construction and mRNA molecule preparation

[0050] The 3'UTR sequence screened in Example 1 was obtained in full length by gene synthesis (GenScript Biotech Co., Ltd.) and ligated to the pUC57 vector backbone containing the T7 promoter sequence, HBA1 5'UTR sequence, FLuc CDS sequence, hBg 3'UTR sequence and poly(A) sequence, replacing the original hBg 3'UTR sequence. The backbone vector map is shown in FIG. Figure 1 As shown. The correct clones identified by sequencing were purified using an endotoxin-free plasmid extraction kit (Vigras Biotechnology Co., Ltd.), and the concentration was measured using an ultra-micro spectrophotometer Nanodrop. The obtained plasmid was used to prepare mRNA by in vitro co-transcription.

[0051] Take 5µg of the extracted plasmid, use the restriction endonuclease BspQI (NEB) to linearize the plasmid template, add 2µL of the endonuclease, add 10×Reaction Buffer and RNase-free water to prepare a total volume of 50µL, shake well and mix, then centrifuge briefly to allow the liquid to accumulate at the bottom of the test tube, react at 50℃ for 3h, then inactivate at 80℃ for 20min, and the obtained product is further purified and recovered using magnetic beads.

[0052] Prepare DNA magnetic beads (VAHTSⓇDNA Clean Beads) in advance, balance to room temperature, invert or vortex to mix the beads thoroughly, add an equal volume of magnetic beads according to the volume of the enzyme digestion product, use a pipette to mix thoroughly, and then purify the template plasmid according to the magnetic bead recovery steps. After purification, take 1µL of the purified product and use the ultra-micro spectrophotometer Nanodrop to measure the concentration, and then take 50ng of the purified product for agarose gel electrophoresis (1% TAE) to confirm whether the plasmid template is sufficiently linear.

[0053] In this example, T7 RNA polymerase co-transcription kit (Novozyme Biotech Co., Ltd.) was used for in vitro transcription. N1-methyl pseudouracil was used to completely replace UTP in the modification group. After adding all components according to the instructions, the mixture was fully pipetted and mixed. The liquid was collected to the bottom of the tube by brief centrifugation, incubated at 37°C for 2h, and then 5µL of DNaseI was added to the reaction product to digest the DNA template. The reaction was carried out at 37°C for 15min. The mRNA in the transcription product was purified and recovered using RNA magnetic beads (VAHTS RNA Clean Beads). The amount of magnetic beads used was 2 to 4 times that of the co-transcription system. After fully mixing, the operation was carried out according to the instructions for use of the magnetic beads. Finally, an appropriate amount of Nuclease-free water was used for elution. 1µL of the purified RNA was taken and the concentration was detected using an ultra-micro spectrophotometer (RNA mode). 50ng of the purified RNA was taken for denaturing agarose gel electrophoresis (1% TBE + 6% urea) to detect the integrity and purity of the RNA product.

[0054] Example 3: Effects of different 3'UTRs on the expression efficiency of firefly luciferase in HepG2 and DC2.4 cells

[0055] In order to verify the effect of the screened 3'UTR sequence on the expression efficiency of firefly luciferase in different cells, the present invention selected immortalized human liver cancer cell line (HepG2) and mouse bone marrow derived dendritic cell line (DC2.4) for transfection test. Take HepG2 or DC2.4 cells with good growth status, digest and resuspend them, and count them. Take 2×10 6Add 10 cells to a 50 mL centrifuge tube and add RPMI 1640 complete medium (Thermo Fisher Scientific) to make up to 20 mL. Adjust the cell density to 1 × 10 5 After thorough mixing, the cells were evenly distributed into a 96-well white plate (Corning Company), 100 μL / well, and the number of cells plated in each well was 1×10 4 , pat gently to mix, and then place it in a 37℃ incubator for overnight culture (18~24h). The next day, the cells were taken out and Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific) was used to add the FLuc mRNA containing different 3'UTRs prepared by the above transcription into the cells at a dose of 0.1μg / well for transfection. The commonly used HBB gene 3'UTR (hBg group) was used as the control group, and the transfection steps were carried out according to the instructions.

[0056] 24h and 48h after transfection, take out the corresponding well plates for luciferase activity detection. Take out the Bio-LiteLuciferase Assay System kit (Novozyme Biotech Co., Ltd.) in advance and restore it to room temperature. Prepare it according to its instructions. Take out the well plate to be tested, use a pipette to remove the culture medium supernatant, then add 100μL of detection reagent to each well, tap to mix, let it stand for 1-2min to allow the reaction to proceed fully, and then place it on the microplate reader (BioTek, model Synergy H1) for measurement. The test results are as follows: Figure 2 The results of the significant difference analysis are shown in Table 2.

[0057] Table 2

[0058]

[0059] from Figure 2 The results show that in HepG2 cells, the expression efficiency of FLuc mRNA containing BF34 3'UTR is the highest in both the modified group and the non-modified group. Except for the slightly lower expression efficiency of FLuc mRNA containing MERS 3'UTR in the modified group, the expression effects of the other 3'UTRs are equivalent to or better than those of the control group. In DC2.4 cells, the overall expression efficiency trend is basically consistent with that of HepG2 cells, indicating that the 3'UTR sequence screened in the present invention has a certain effect on improving the mRNA expression efficiency.

[0060] Example 4: Effect of tandem 3'UTR on mRNA expression efficiency

[0061] Previous literature studies have shown that two head-to-tail cis-linked hBg 3'UTRs (2hBg) are superior to single copies in improving mRNA stability. Therefore, the present invention considers testing the effect of the screened 3'UTR sequences on mRNA expression efficiency after concatenation. There are 6 combinations of 3 3'UTRs, namely BF34-HAV, BF34-MERS, HAV-BF34, HAV-MERS, MERS-BF34 and MERS-HAV. The combined full-length sequence was connected to the backbone vector pIPMKC4-Fluc for in vitro transcription of Fluc mRNA by gene synthesis (GenScript Biotech Co., Ltd.), replacing the original hBg 3'UTR sequence. After sequencing verification, the plasmid was extracted and mRNA was prepared.

[0062] Among them, the BF34-HAV3'UTR sequence is as follows: 5'-gaucgaggguacagcgauucaucaccaaucaauauaaaacuaggugaauauuauuaaucauauuaugaucuguaauauuuuagaauauugauugaaaauuuugauuggcaaaaccaaugcuuuguuuaaacaaauuuucuuaaaauuucugagguuuguuuuuuuuuuucaguaaau-3' (SEQ ID NO: 1).

[0063] BF34-MERS The 3'UTR sequence is as follows: 5'-gaucgaggguacagcgauucaucaccaaucaauauaaaacuaggugaauauuuaaucauauuaugaucuguaauauuuagaauauugauugaaa auuuugauuggcaaaaccaaugcugucacucaaaguaacaagaucgcggcaaucguuuguguuuggcaaccccaucucaccaucgcuuguccacucuugcacagaaugga aucauguuguaauuacagugcaauaagguaauuauaacccauuuaauugauagcuaugcuuuauuaaaguguguagcuguagagagaauguuaaagacugucaccucugc uugauugcaagugaacagugccccccgggaagagcucuacagugugaaauguaaauaaaaauagcuauuauucaauuagauuaggcuaauuagaugauuugc-3' (SEQ ID NO:5).

[0064] The HAV-BF34 3’UTR sequence is as follows: 5’-uuuguuuaaacaaauuuucuuaaaauuucugagguuuguuuauuucuuuuaucaguaaaugaucgaggguacagcgauucaucaccaaucaauauaaaacuaggugaauauuauuaaucauauuaugaucuguaauauuuagaauauugauugaaaauuuugauuggcaaaaccaaugc-3’ (SEQ ID NO:6).

[0065] The HAV-MERS 3’UTR sequence is as follows: 5’-uuuguuuaaacaaauuuucuuaaaauuucugagguuuguuuauuucuuuuaucaguaaauugucacucaaaguaacaagaucgcggcaaucguuuguguuuggcaaccccaucucaccaucgcuuguccacucuugcacagaauggaaucauguuguaauuacagugcaauaagguaauuauaacccauuuaauugauagcuaugcuuuauuaaaguguguagcuguagagagaauguuaaagacugucaccucugcuugauugcaagugaacagugccccccgggaagagcucuacagugugaaauguaaauaaaaaauagcuauuauucaauuagauuaggcuaauuagaugauuugc-3’ (SEQ ID NO:7).

[0066] The MERS-BF34 3'UTR sequence is as follows: 5'-ugucacucaaaguaacaagaucgcggcaaucguuuguguuuggcaaccccaucucaccaucgcuuguccacucuugcacagaauggaaucauguuguaauuacagugcaauaagguaauuauaacccauuuaauugauagcuaugcuuuauuaaaguguguagcuguagagagaauguuaaagacugucaccucugcuugauugcaagugaacagugccccccgggaagagcucuacagugugaaauguaaauaaaaaauagcuauuauucaauuagauuaggcuaauuagaugauuugcgaucgaggguacagcgauucaucaccaaucaauauaaaacuaggugaauauuauuaaucauauuaugaucuguaauauuuagaauauugauugaaaauuuugauuggcaaaaccaaugc-3'.

[0067] The MERS-HAV 3'UTR sequence is as follows: 5'-ugucacucaaaguaacaagaucgcggcaaucguuuguguuuggcaaccccaucucaccaucgcuuguccacucuugcacagaauggaaucauguuguaauuacagugcaauaagguaauuauaacccauuuaauugauagcuaugcuuuauuaaaguguguagcuguagagagaauguuaaagacugucaccucugcuugauugcaagugaacagugccccccgggaagagcucuacagugugaaauguaaauaaaaaauagcuauuauucaauuagauuaggcuaauuagaugauuugcuuuguuuaaacaaauuuucuuaaaauuucugagguuuguuuauuucuuuuaucaguaaau-3' (SEQ ID NO:9).

[0068] According to the same method, the obtained 6 mRNAs containing tandem 3'UTRs and mRNAs containing individual BF34, MERS, HAV and hBg 3'UTRs were transfected into HepG2 cells and DC2.4 cells respectively. The cells were collected 24h and 48h after transfection for luciferase activity detection. The results were as follows: Figure 3 and Figure 4 As shown, Figure 3 The significant difference analysis is shown in Table 3. Figure 4 The significant difference analysis is shown in Table 4.

[0069] Table 3

[0070]

[0071] from Figure 3 and Figure 4 The results show that in the modified group, the expression effect of the 3'UTR after tandem was not significantly improved compared with the single 3'UTR, and some combinations even decreased. This may be due to the fact that the 3'UTR sequence after tandem was too long, resulting in reduced mRNA translation efficiency, indicating that the strategy of tandem 3'UTR is not suitable for improving the expression of mRNA with base modification. In the non-modified group, the 3'UTR expression effect of the BF34-HAV combination was the best, reaching about 2 times that of the control group in HepG2 cells and about 3 times that of the control group in DC2.4 cells. The 3'UTR of the HAV-BF34 combination was slightly improved compared with the control group, and the 3'UTR of the other combinations did not show a significant improvement, indicating that the tandem method is only helpful for the function of some UTRs.

[0072] Table 4

[0073]

Claims

1. A 3'UTR sequence for regulating mRNA translation efficiency, wherein the 3'UTR sequence is as shown in SEQ ID NO: 1; Preferably, the 3'UTR sequence is a sequence without base modification.

2. A DNA molecule comprising a nucleotide sequence for transcribing the 3'UTR sequence of claim 1, wherein the DNA molecule is transcribed into mRNA; Preferably, the DNA molecule comprises a strand having the following elements: A coding region, a nucleotide sequence encoding a 5'UTR sequence located upstream of the coding region, and a nucleotide sequence encoding a 3'UTR sequence located downstream of the coding region, wherein: The 3'UTR sequence is the 3'UTR sequence of claim 1; Preferably, the coding region includes a start codon at the 5' end, the coding region encodes a polypeptide, and the coding region includes a stop codon at the 3' end.

3. A vector comprising the DNA molecule according to claim 2.

4. A host cell comprising the vector of claim 3.

5. A composition comprising the DNA molecule of claim 2, the vector of claim 3, or the host cell of claim 4.

6. An RNA molecule comprising the 3'UTR sequence of claim 1; Preferably, the RNA molecule comprises: A coding region, a 5'UTR sequence located upstream of the coding region, and a 3'UTR sequence located downstream of the coding region, wherein: The 3'UTR sequence is the 3'UTR sequence of claim 1; Preferably, the coding region includes a start codon at the 5' end, and the coding region encodes a polypeptide.

7. A pharmaceutical composition comprising the DNA molecule of claim 2, the vector of claim 3, the host cell of claim 4, or the RNA molecule of claim 6; Preferably, the pharmaceutical composition further comprises optionally a pharmaceutically acceptable adjuvant.

8. A method for improving mRNA translation efficiency, the method comprising the step of connecting the 3'UTR sequence of claim 1 to the 3' end of the coding region of the mRNA to be translated.

9. Use of the 3'UTR sequence of claim 1 in preparing products for improving mRNA translation efficiency, preparing nucleic acid therapeutic drugs, and preparing mRNA vaccines.

10. Use of the 3'UTR sequence of claim 1, the DNA molecule of claim 2, the vector of claim 3, the host cell of claim 4, or the RNA molecule of claim 6 in preparing a gene expression reagent or kit.

Images