3'UTR for improving mRNA translation efficiency and its application

By providing a base-free 3’UTR sequence and DNA molecule, combining vectors and in vitro transcription system, the problem of insufficient mRNA translation efficiency in ssRNA (+) viruses is solved, and the efficient expression and safety of mRNA are improved.

CN119842712BActive Publication Date: 2025-08-26BEIJING IMMUPEUTICS MEDICINE TECH LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510130981.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-06
Publication Date
2025-08-26
Estimated Expiration
2045-02-06

AI Technical Summary

Technical Problem

In the prior art, the 3'UTR sequence development of ssRNA (+) viruses is less developed, resulting in insufficient translation efficiency and stability of mRNA, affecting the expression efficiency and safety of nucleic acid drugs.

Method used

A 3’UTR sequence without base modification is provided, combining DNA molecules and vectors, to regulate mRNA translation efficiency and improve mRNA expression efficiency through in vitro transcription and translation systems.

Benefits of technology

Significantly improve the translation efficiency of mRNA, reaching 2-3 times that of commonly used 3’UTR sequences, enhance the expression efficiency of nucleic acid drugs and mRNA vaccines, and reduce potential toxicity risks and immunogenic problems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842712B_ABST
    Figure CN119842712B_ABST
Patent Text Reader

Abstract

The present invention discloses a 3'UTR for improving mRNA translation efficiency and its application, belonging to the field of biotechnology. The present invention provides a 3'UTR sequence for regulating mRNA translation efficiency, a corresponding DNA molecule, a vector, a host cell, and an RNA molecule. The present invention also provides a method for improving mRNA translation efficiency and related applications. The 3'UTR sequence provided by the present invention can significantly improve the expression efficiency of mRNA. Regardless of whether the base is modified or unmodified, the improved mRNA translation efficiency is 2-3 times that of a commonly used 3'UTR sequence.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a 3'UTR for improving mRNA translation efficiency and an application thereof. Background Art

[0002] In recent years, nucleic acid drugs, represented by DNA and RNA, have gradually become a hot topic in precision medicine and disease treatment. Compared with traditional drugs, nucleic acid drugs offer advantages such as a rich selection of candidate targets, simplified design, shortened development cycles, strong target specificity, high expression efficiency, and prolonged duration of action. Nucleic acid drugs can be broadly divided into two categories: DNA drugs and RNA drugs. Compared with DNA drugs, RNA drugs have a lower risk of genomic integration and induced mutagenesis, higher expression efficiency, and no risk of cumulative toxicity, offering broader application prospects in disease prevention and treatment.

[0003] A complete mRNA molecule includes a 5' cap structure, a 5' untranslated region (5'UTR), an antigen coding sequence, a 3' untranslated region (3'UTR), and a polyadenylated tail. In addition to the antigen coding sequence, other structural elements are crucial to the stability and transcription efficiency of mRNA. Among them, the 5' untranslated region determines the translation initiation rate, while the 3' untranslated region mainly affects the stability and expression regulation of mRNA. The design and selection of UTRs are crucial to ensure sufficient antigen production and effective vaccination. Existing technologies often use naturally occurring UTR sequences of some stable and highly expressed human genes to drive mRNA vaccine expression. These sequences have been selected through natural evolution and can improve the translation efficiency and stability of mRNA to a certain extent. However, the UTR sequences in viruses whose genetic material is ssRNA (+) have been less developed. Summary of the Invention

[0004] In order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions.

[0005] The present invention provides a 3'UTR sequence for regulating mRNA translation efficiency. The 3'UTR sequence is shown in SEQ ID NO: 1.

[0006] Furthermore, the 3'UTR sequence is a sequence without base modification.

[0007] In some embodiments, the 3'UTR sequence can be a base-modified sequence, pyridin-4-one ribonucleoside, 5-iodouridine, 5-iodine, 5-aza-uridine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thiol-pseudouridine, 2-thiol-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinemethyluridine, 1-taurinemethyl-pseudouridine, 5-taurinemethyl-2-thiol-uridine, 1-taurinemethyl-4-thiol-uridine, 5-methyl -uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, 5-methylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl -pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4 -methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylaminoformyladenosine, N6-threonylaminoformyladenosine, 2-methylthio-N6-threonylaminoformyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, 2-methoxy-adenine, inosine, 1-methyl-inosine, yamidine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxy-guanosine, 7-methyl-8-oxy-guanosine, 1-methyl-6-oxy-guanosine, N2-methyl-6-oxy-guanosine, N1-methylpseudouridine, and N2,N2-dimethyl-6-oxy-guanosine.

[0008] In some embodiments, in order to reduce safety issues (potential toxicity risks, immunogenicity issues, genetic stability issues, off-target issues, etc.) caused by base modification, the 3'UTR sequence in the present invention is base-free.

[0009] The present invention provides a DNA molecule, which comprises a nucleotide sequence for transcribing the aforementioned 3'UTR sequence, and the DNA molecule is transcribed into mRNA.

[0010] Furthermore, the DNA molecule comprises a chain having the following elements: a coding region, a nucleotide sequence encoding a 5'UTR sequence located upstream of the coding region, and a nucleotide sequence encoding a 3'UTR sequence located downstream of the coding region, wherein the 3'UTR sequence is the 3'UTR sequence described above.

[0011] Furthermore, the coding region includes a start codon at the 5' end, the coding region encodes a polypeptide, and the coding region includes a stop codon at the 3' end.

[0012] The DNA molecules of the present invention are DNA molecules that can be transcribed into mRNA molecules. Transcription is the first step in gene expression, in which a specific segment of a DNA molecule is copied into an mRNA molecule by an enzyme (RNA polymerase). During transcription, RNA polymerase reads the DNA sequence, which produces a complementary, antiparallel RNA chain, known as a primary transcript. Only one of the two DNA chains serves as a template for transcription. During transcription, DNA-dependent RNA polymerase reads the antisense strand of DNA from the 3' end to the 5' end (3' → 5'). Complementary RNA is produced in the opposite direction - in the 5' → 3' direction - to match the sequence of the sense strand, except that thymine is converted into uracil. This directionality is because RNA polymerase can only add nucleotides to the 3' end of the growing mRNA chain. The non-templated sense strand of DNA is called the coding strand because its sequence is identical to the newly generated RNA transcript (except that thymine is replaced by uracil). When representing a DNA sequence, this is a strand used conventionally and in the context of the present invention.

[0013] In this article, mRNA molecules can be decoded and translated into proteins by ribosomes according to the information provided by " genetic code ". Coding region usually starts with the start codon at its 5 ' end and ends with a stop codon. Generally, the start codon is an ATG triplet (corresponding to the AUG triplet on the RNA level), and the stop codon is TAA, TAG or TGA (corresponding to UAA, UAG or UGA on the RNA level). Except encoding protein, the part of coding region can serve as the regulatory sequence in pre-mRNA as exon splicing enhancer or exon splicing silencer. The gene coding region of the coded polypeptide or protein used according to the present invention is also referred to as coding sequence or CDS (from coding DNA sequence), and is the part of the DNA or RNA of gene, is made up of exons, and encodes polypeptide or protein. The flank (flanked) of the coding region in mRNA is 5 ' untranslated region (5 'UTR) and 3 ' untranslated region (3 'UTR), which is also the part of exons.

[0014] The present invention provides a vector comprising the aforementioned DNA molecule.

[0015] In some embodiments, the vector of the present invention may be, for example, a plasmid, a cosmid, a virus, a phage or another vector conventionally used, for example, in genetic engineering, and may comprise further genes, such as marker genes, which allow selection of the vector in a suitable host cell and under suitable conditions.

[0016] The DNA molecule of the present invention can be imported into a vector, preferably an expression vector, by standard molecular biology techniques (see, for example, Sambrook et al., Molecular Cloning, A laboratory manual, 2nd edition, 1989). Term " vector (vector) " such as " expression vector " or " cloning vector " in the meaning of the present invention is understood to be independently of chromosomal DNA and replicated in the cell and used as a circular, double-stranded unit of the vector (vehicle) that carries genetic material to the cell, wherein replication and / or expression (that is, transcription into RNA and translation into amino acid sequence) can be carried out. The vector containing foreign DNA is referred to as recombinant DNA. The vector itself is generally a DNA sequence dna that is typically composed of an insert (insert) (for example, nucleic acid molecule / DNA molecule of the present invention) and a larger sequence serving as a vector " main chain ". In the meaning of the present invention, plasmid is most often found in bacteria and used in recombinant DNA research to transfer genes between cells, and is therefore a subgroup of the " vector " used in the meaning of the present invention.

[0017] The present invention provides a host cell, which comprises the aforementioned vector.

[0018] The present invention also relates to a host cell comprising a vector of the present invention. Therefore, the present invention relates to a host transfected or transformed with a vector of the present invention or a non-human host carrying a vector of the present invention, i.e., to a host cell or host genetically modified (genetically modified) with a DNA molecule according to the present invention or with a vector comprising such a DNA molecule. The term "genetically modified" means that the host cell or host comprises a DNA molecule or vector according to the present invention that is introduced into the cell or host or into one of its ancestors / parents in addition to its natural genome. The DNA molecule or vector may be present in the genetically modified host cell or host, or as an independent molecule outside the genome, preferably as a molecule that can replicate, or it may be stably integrated into the genome of the host cell or host.

[0019] Host cells of the present invention can be any prokaryotic cell or eukaryotic cell. Suitable prokaryotic cells are prokaryotic cells such as, Escherichia coli (E.coli) or Bacillus subtilis (Bacillus subtilis) that are generally used for cloning. And eukaryotic cells include, for example, fungal cells or zooblasts. The example of suitable fungal cells is yeast cells, preferably yeast cells of Saccharomyces and most preferably yeast cells in the genus Saccharomyces cerevisiae. Suitable zooblasts are, for example, insect cells, vertebrate cells, preferably mammalian cells, such as, for example, HEK293, NSO, CHO, COS-7, MDCK, U2-OSHela, NIH3T3, MOLT-4, Jurkat, PC-12, PC-3, IMR, NT2N, Sk-n-sh, CaSki, C33A. Further suitable cell lines known in the art can be obtained from cell line repositories, such as, for example, Deutsche Sammlungvon Mikroorganismen und Zellkulturen GmbH (DSMZ) or American Type Culture Collection (ATCC). According to the present invention, it is further envisioned that primary cells / cell cultures can serve as host cells. The cells are specifically derived from insects (e.g., insects of the genus Drosophila or Blattella) or mammals (e.g., humans, pigs, mice or rats). The host cells may also include cells from and / or derived from cell lines such as neuroblastoma cell lines. The above-mentioned primary cells are well known in the art and particularly include primary astrocytes, (mixed) spinal cultures or hippocampal cultures.

[0020] The present invention provides a composition comprising the aforementioned DNA molecule, the aforementioned vector, or the aforementioned host cell.

[0021] The present invention provides an RNA molecule, which comprises the above-mentioned 3'UTR sequence.

[0022] Furthermore, the RNA molecule comprises: a coding region, a 5'UTR sequence located upstream of the coding region, and a 3'UTR sequence located downstream of the coding region, wherein the 3'UTR sequence is the 3'UTR sequence described above.

[0023] Furthermore, the coding region includes a start codon at the 5' end, and the coding region encodes a polypeptide.

[0024] In the context of the present invention, a "coding region" is understood to mean any polydeoxyribonucleotide molecule that, if introduced into a cell, is transcribed into an mRNA molecule that can be translated into a polypeptide / protein or a fragment thereof. The terms "polypeptide" and "protein" as used herein include any type of amino acid sequence, i.e., a chain of two or more amino acids, each linked by a peptide bond and also including peptides and fusion proteins.

[0025] In some embodiments, the coding region contains a DNA sequence, a deoxyribonucleotide sequence, encoding a polypeptide / protein or a fragment thereof whose function is necessary or beneficial in or near a cell, for example, a protein whose absence or defective form causes a disease or illness, whose provision can alleviate or prevent a disease or illness, or a protein that can promote a beneficial process in or near a cell. The coding region may contain the sequence of a complete protein or a functional variant thereof. In addition, the deoxyribonucleotide sequence of the coding region may encode a protein that acts as a factor, inducer, regulator, stimulator, or enzyme, or a functional fragment thereof, wherein such a protein is a protein whose function is necessary to treat a condition, particularly a metabolic disorder, or to initiate a process in the body, such as the formation of new blood vessels, new tissues, etc. Here, it should be understood that a functional variant means a fragment that can assume the function of a protein in a cell, the function of which is necessary in the cell, or whose absence or defective form is pathogenic.

[0026] In this context, according to the present invention, the transcription and translation of the DNA molecules of the present invention into mRNA and further into polypeptides or proteins can be intended to compensate for or supplement endogenous gene expression, particularly in cases where the endogenous gene is defective or silent, resulting in the gene not expressing its product, insufficient or defective gene expression products, or dysfunctional gene expression products, such as in various metabolic and genetic diseases such as cystic fibrosis, hemophilia, or muscular dystrophy. The transcription and translation of the DNA molecules of the present invention into mRNA and further into polypeptides or proteins can also be intended to cause the expressed products to interact with or interfere with any endogenous cellular processes, such as the regulation of gene expression, signaling, and other cellular processes. The transcription and translation of the DNA molecules of the present invention into mRNA and further into polypeptides or proteins can also be intended to induce an immune response in the organism in which the transfected or transduced cells reside or are resided. An example is the genetic modification of antigen-presenting cells, such as dendritic cells, so that they present antigens for vaccination purposes. Another example is the transcription and translation of the DNA molecules of the present invention into mRNA and further into polypeptides or proteins, wherein the coding region encodes a cytokine. This may be desirable, for example, in tumors in order to elicit a tumor-specific immune response.

[0027] In some embodiments, the "coding region" can be transcribed and translated into a partial length or full length protein having a cellular activity level equal to or greater than that of the native protein. In some embodiments, the "coding region" encodes a therapeutically active or pharmaceutically active polypeptide, protein, or peptide having a therapeutic or prophylactic effect, wherein the polypeptide, protein, or peptide is selected from those disclosed in existing articles or reports. The "coding region" can be used to express a partial length or full length protein having a cellular activity level equal to or less than that of the native protein. This allows the administration of RNA molecules to be indicated for the treatment of diseases.

[0028] The ribonucleic acid (RNA) molecule used according to the present invention relates to a polymeric molecule assembled into a chain of nucleotides called G, A, U, and C. Each nucleotide in RNA contains ribose, with carbon numbered 1' to 5'. Nitrogenous bases are attached to the 1' position, generally, adenine (A), cytosine (C), guanine (G), or uracil (U). In a polymeric RNA molecule, a phosphate group is attached to the 3' position of a ribose and the 5' position of the next ribose. Therefore, the nucleotides in the polymeric RNA molecule are covalently linked to each other, wherein the phosphate group from one nucleotide is bound to the 3' carbon on the subsequent nucleotide, thereby forming a phosphodiester bond. Therefore, the RNA chain has a 5' end and a 3' end, and is thus named after the carbon on the ribose ring. According to convention, upstream and downstream relate to the 5' to 3' direction in which RNA transcription occurs. Preferably, the RNA molecule is a messenger RNA (mRNA) molecule. mRNA is a large family of RNA molecules that transmit genetic information from DNA to ribosomes, wherein the RNA molecule specifies the amino acid sequence of the protein product of the gene expression. After RNA polymerase transcribes a primary transcript, mRNA (called pre-mRNA), the processed, mature mRNA is translated into a polymer of amino acids: a protein, as outlined in the central dogma of molecular biology. As in DNA, mRNA genetic information is contained in a sequence of nucleotides, arranged into codons, each consisting of three bases. Each codon codes for a specific amino acid, except for the stop codon, which terminates protein synthesis.

[0029] According to the above, the present invention provides RNA molecules / polyribonucleic acid molecules, preferably modified polyribonucleic acid molecules. The sequence of RNA molecules / polyribonucleotides can be derived from, for example, any suitable nucleic acid comprising the genetic information of a gene of interest. The example of nucleic acid includes genomic DNA, RNA or the cDNA from any bacterial cell or archaeal cell comprising a gene of interest (one or more). Polynucleotides can be derived from nucleic acids carrying mutant genes and polymorphisms.

[0030] The RNA molecules of the present invention can be easily used in in vitro translation systems known in the art for efficient expression of any desired polypeptide or protein encoded by the coding region. In vitro translation systems are known in the art and can be used directly with the RNA molecules of the present invention. Alternatively, these in vitro translation systems can be used in combination with the above-mentioned in vitro transcription system. Corresponding cell-free systems for in vitro transcription and / or in vitro translation are known and available. These cell-free systems for protein synthesis (also referred to as in vitro protein synthesis or abbreviated as CFPS) allow the use of biological mechanisms without living cells to express / generate polypeptides or proteins. In these systems, the in vitro protein synthesis environment is not restricted by the cell wall or the necessary steady-state conditions for maintaining cell viability and can directly enter and control the translation environment, which is advantageous for a variety of applications including the following: optimization of protein production, optimization of protein complexes, research on protein synthesis, incorporation of unnatural amino acids, high-throughput screening, and synthetic biology. Common components of cell-free reactions include cell extracts, energy sources, amino acid supplies, cofactors such as magnesium, and DNA or RNA encoding the desired polypeptide or protein. Cell extracts can be obtained by lysing cells of interest and centrifuging the cell wall, DNA genome, and other debris. The remainder is the necessary cellular machinery, including ribosomes, aminoacyl-tRNA synthetases, translation initiation and elongation factors, nucleases, etc. In cell-free systems for synthesizing polypeptides or proteins starting from DNA (i.e., in systems comprising the steps of in vitro transcription and in vitro translation), two types of DNA are usually used, i.e., plasmids or linear expression templates (LETs). In cell-free systems for synthesizing polypeptides or proteins starting from RNA (i.e., in systems comprising only the step of in vitro translation), RNA can be used directly.

[0031] The present invention provides a pharmaceutical composition comprising the aforementioned DNA molecule, the aforementioned vector, the aforementioned host cell, or the aforementioned RNA molecule.

[0032] Furthermore, the pharmaceutical composition optionally includes a pharmaceutically acceptable adjuvant.

[0033] The present invention provides a method for improving mRNA translation efficiency, which comprises the step of connecting the aforementioned 3'UTR sequence to the 3' end of the coding region of the mRNA to be translated.

[0034] The present invention provides the use of the aforementioned 3'UTR sequence in preparing products for improving mRNA translation efficiency, preparing nucleic acid therapeutic drugs, and preparing mRNA vaccines.

[0035] The present invention provides the use of the aforementioned 3'UTR sequence, the aforementioned DNA molecule, the aforementioned vector, the aforementioned host cell, or the aforementioned RNA molecule in preparing a gene expression reagent or kit.

[0036] Translation efficiency is the rate at which mRNA is translated into polypeptide or protein in a cell. The translation efficiency of a given mRNA is measured as the quantity of protein or polypeptide translated per mRNA per time unit. Translation is the process in which cellular ribosomes produce proteins and is well known to technicians. Briefly, in translation, the messenger RNA (mRNA) produced by DNA transcription is decoded by ribosomes to produce a specific amino acid chain or polypeptide or protein. In the context of the present invention, translation efficiency is preferably the rate at which mRNA is translated into protein at a certain time point in a cell, which is related to the amount of the mRNA encoding each protein at the same time point in the cell. Therefore, translation efficiency is the quotient of the amount of the mRNA translated into protein and the mRNA encoding each protein at a certain time point in a cell. Two parameters, that is, the amount of the mRNA translated into protein and the mRNA encoding each protein, can be determined by methods known in the art. As a non-limiting example, the amount of the mRNA translated into protein in a cell can be determined, for example, by flow cytometry (FC), while the amount of the mRNA encoding each protein can be measured by, for example, qPCR.

[0037] In the present invention, the term "expression efficiency" refers to the ability of transformed cells to express a product. Specifically, it refers to the quotient of the amount of protein (polypeptide) synthesized by the transformed cells over a certain period of time and the amount of oligonucleotide used.

[0038] Advantages and beneficial effects of the present invention:

[0039] The 3'UTR sequence provided by the present invention can significantly improve the expression efficiency of mRNA. Whether in the base-modified or unmodified state, the increased mRNA translation efficiency is 2-3 times that of the commonly used 3'UTR sequence. The nucleic acid molecules described in the present invention can be used as components for enhancing RNA expression efficiency in nucleic acid therapeutics or mRNA vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a diagram of the backbone vector for Fluc mRNA in vitro transcription.

[0041] Figure 2 The figure shows the expression efficiency test results of FLuc mRNA containing various 3'UTRs in different cells.

[0042] Figure 3This figure shows the expression efficiency test results of HepG2 cells transfected with FLuc mRNA containing the tandem 3'UTR.

[0043] Figure 4 The figure shows the expression efficiency test results of DC2.4 cells transfected with FLuc mRNA containing the tandem 3'UTR. DETAILED DESCRIPTION

[0044] Example 1 3'UTR sequence screening

[0045] The 3'UTR plays a crucial role in regulating mRNA stability and translation efficiency. Among different viral families, ssRNA(+) viruses utilize the simplest and most efficient replication and expression strategies, as the same molecule performs both genome and mRNA functions. Furthermore, the nucleotide composition and codon usage of ssRNA(+) viruses are closest to human codons. Therefore, it is theoretically feasible to screen for 3'UTR sequences of common ssRNA(+) viruses and utilize them as functional elements for regulating mRNA expression efficiency.

[0046] The present invention screened several common ssRNA(+) viruses, retrieved and downloaded their complete genomes from the National Center for Biotechnology Information (NCBI), and isolated the viral UTR sequences. The length of mRNA sequences restricts their industrial production efficiency. Excessively long UTR sequences not only require more complex mRNA production processes but also compromise mRNA translation efficiency. Therefore, the present invention further removed 3' UTR sequences exceeding 300 bp and those that were difficult to synthesize. Ultimately, three sequences suitable for testing were obtained, as shown in Table 1.

[0047] Table 1

[0048]

[0049] Example 2 3'UTR vector construction and mRNA molecule preparation

[0050] The 3'UTR sequence screened in Example 1 was obtained in full length by gene synthesis (GenScript Biotech Co., Ltd.) and ligated into a pUC57 vector backbone containing a T7 promoter sequence, an HBA1 5'UTR sequence, a FLuc CDS sequence, an hBg 3'UTR sequence, and a poly(A) sequence, replacing the original hBg 3'UTR sequence. The backbone vector map is shown in FIG. Figure 1 As shown. Correct clones identified by sequencing were purified using an endotoxin-free plasmid extraction kit (Viglas Biotechnology Co., Ltd.), and their concentrations were measured using a Nanodrop spectrophotometer. The resulting plasmids were then used to generate mRNA via in vitro co-transcription.

[0051] Take 5µg of the extracted plasmid and use the restriction endonuclease BspQI (NEB) to linearize the plasmid template. Add 2µL of the endonuclease to 10× Reaction Buffer and RNase-free water to prepare a total volume of 50µL. After thorough vortexing and mixing, centrifuge briefly to allow the liquid to accumulate at the bottom of the test tube. React at 50℃ for 3h, then inactivate at 80℃ for 20min. The obtained product is further purified and recovered using magnetic beads.

[0052] Prepare DNA magnetic beads (VAHTSⓇ DNA Clean Beads) in advance, equilibrate to room temperature, and thoroughly mix by inversion or vortexing. Add an equal volume of magnetic beads based on the volume of the digested product. Pipette thoroughly to mix. Then, proceed with template plasmid purification according to the magnetic bead recovery procedure. After purification, measure the concentration of 1µL of the purified product using a Nanodrop spectrophotometer. Then, perform 50ng of the purified product on agarose gel electrophoresis (1% TAE) to confirm adequate linearization of the plasmid template.

[0053] In this example, in vitro transcription was performed using the T7 RNA polymerase co-transcription kit (Novozymes Biotech, Inc.). The modification group used N1-methylpseuduracil to completely replace UTP. After adding all components according to the instructions, the mixture was thoroughly pipetted and mixed. The liquid was collected at the bottom of the tube by brief centrifugation and incubated at 37°C for 2 hours. Then, 5 µL of DNase I was added to the reaction product to digest the DNA template, and the reaction was continued at 37°C for 15 minutes. The mRNA in the transcript was purified and recovered using RNA magnetic beads (VAHTS RNA Clean Beads) at a dosage of 2-4 times that of the co-transcription system. After thorough mixing, the beads were processed according to the instructions. Finally, the mRNA was eluted with an appropriate amount of nuclease-free water. 1 µL of the purified RNA was used to determine its concentration using an ultramicro-spectrophotometer (RNA mode). 50 ng of the purified RNA was subjected to denaturing agarose gel electrophoresis (1% TBE + 6% urea) to verify the integrity and purity of the RNA product.

[0054] Example 3: Effects of different 3'UTRs on the expression efficiency of firefly luciferase in HepG2 and DC2.4 cells

[0055] In order to verify the effect of the screened 3'UTR sequence on the expression efficiency of firefly luciferase in different cells, the present invention selected immortalized human hepatoma cell line (HepG2) and mouse bone marrow-derived dendritic cell line (DC2.4) for transfection test. HepG2 or DC2.4 cells with good growth status were taken, digested and resuspended, and counted. 2×10 6Add 10 cells to a 50 mL centrifuge tube, add RPMI 1640 complete medium (Thermo Fisher Scientific) to make up to 20 mL, and adjust the cell density to 1 × 10 5 After thorough mixing, the cells were evenly distributed into 96-well white plates (Corning Company), 100 μL / well, and the number of cells plated per well was 1×10 4 The cells were gently tapped to mix, then cultured overnight at 37°C (18–24 hours). The next day, the cells were removed and transfected with Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific) at a dose of 0.1 μg / well of the FLuc mRNA containing different 3'UTRs prepared above. The commonly used HBB gene 3'UTR (hBg group) served as a control group. Transfection procedures were performed according to the manufacturer's instructions.

[0056] 24h and 48h after transfection, the corresponding well plates were removed for luciferase activity detection. The Bio-LiteLuciferase Assay System kit (Novozymes Biotech Co., Ltd.) was removed in advance and returned to room temperature. The kit was prepared according to the instructions. The well plates to be tested were removed, the culture supernatant was removed with a pipette, and 100μL of detection reagent was added to each well. The wells were gently tapped to mix, and the wells were allowed to stand for 1-2 minutes to allow the reaction to proceed fully. The wells were then placed on a microplate reader (BioTek, Model Synergy H1) for measurement. The test results were as follows: Figure 2 The results of the significant difference analysis are shown in Table 2.

[0057] Table 2

[0058]

[0059] from Figure 2 The results show that in HepG2 cells, FLuc mRNA containing the BF34 3'UTR had the highest expression efficiency in both the modified and unmodified groups. With the exception of the FLuc mRNA containing the MERS 3'UTR in the modified group, which had slightly lower expression efficiency, the expression efficiency of the remaining 3'UTRs was comparable to or better than that of the control group. In DC2.4 cells, the overall expression efficiency trend was largely consistent with that of HepG2 cells, indicating that the 3'UTR sequences screened in this invention have a certain effect on improving mRNA expression efficiency.

[0060] Example 4: Effect of tandem 3'UTR on mRNA expression efficiency

[0061] Previous studies have shown that two hBg 3'UTRs linked head-to-tail in cis (2hBg) improve mRNA stability compared to a single copy. Therefore, the present invention considered concatenating the selected 3'UTR sequences to test their effect on mRNA expression efficiency. Six combinations of the three 3'UTRs were developed: BF34-HAV, BF34-MERS, HAV-BF34, HAV-MERS, MERS-BF34, and MERS-HAV. The combined full-length sequences were ligated into the pIPMKC4-Fluc backbone vector, used for in vitro transcription of Fluc mRNA, using gene synthesis (GenScript Biotech Co., Ltd.), replacing the original hBg 3'UTR sequence. After sequencing verification, the plasmids were extracted and mRNA was prepared.

[0062] The BF34-HAV 3'UTR sequence is as follows: 5'-gaucgaggguacagcgauucaucaccaaucaauauaaaacuaggugaauauuauuaaucauauuaugaucuguaauauuuuagaauauugauugaaaauuuugauuggcaaaaccaaugcuuuguuuaaacaaauuuucuuaaaauuucugagguuuguuuuauuuuuaucaguaaau-3' (SEQ ID NO: 1).

[0063] BF34-MERS The 3'UTR sequence is as follows: 5'-gaucgaggguacagcgauucaucaccaaucaauauaaaacuaggugaauauuuaaucauauuaugaucuguaauauuuagaauauugauugaaa auuuugauuggcaaaaccaaugcugucacucaaaguaacaagaucgcggcaaucguuuguguuuggcaaccccaucucaccaucgcuuguccacucuugcacagaaugga aucauguuguaauuacagugcaauaagguaauuauaacccauuuaauugauagcuaugcuuuauuaaaguguguagcuguagagagaauguuaaagacugucaccucugc uugauugcaagugaacagugccccccgggaagagcucuacagugugaaauguaaauaaaaauagcuauuauucaauuagauuaggcuaauuagaugauuugc-3' (SEQ ID NO:5).

[0064] The HAV-BF34 3'UTR sequence is as follows: 5'-uuuguuuaaacaaauuuucuuaaaauuucugagguuuguuuauuucuuuuaucaguaaaugaucgaggguacagcgauucaucaccaaucaauauaaaacuaggugaauauuauuaaucauauuaugaucuguaauauuuagaauauugauugaaaauuuugauuggcaaaaccaaugc-3' (SEQ ID NO:6).

[0065] The HAV-MERS 3'UTR sequence is as follows: 5'-uuuguuuaaacaaauuuucuuaaaauuucugagguuuguuuauuucuuuuaucaguaaauugucacucaaaguaacaagaucgcggcaaucguuuguguuuggcaaccccaucucaccaucgcuuguccacucuugcacagaauggaaucauguuguaauuacagugcaauaagguaauuauaacccauuuaauugauagcuaugcuuuauuaaaguguguagcuguagagagaauguuaaagacugucaccucugcuugauugcaagugaacagugccccccgggaagagcucuacagugugaaauguaaauaaaaaauagcuauuauucaauuagauuaggcuaauuagaugauuugc-3' (SEQ ID NO:7).

[0066] The MERS-BF34 3' UTR sequence is as follows: 5'-ugucacucaaaguaacaagaucgcggcaaucguuuguguuuggcaaccccaucucaccaucgcuuguccacucuugcacagaauggaaucauguuguaauuacagugcaauaagguaauuauaacccauuuaauugauagcuaugcuuuauuaaaguguguagcuguagagagaauguuaaagacugucaccucugcuugauugcaagugaacagugccccccgggaagagcucuacagugugaaauguaaauaaaaaauagcuauuauucaauuagauuaggcuaauuagaugauuugcgaucgaggguacagcgauucaucaccaaucaauauaaaacuaggugaauauuauuaaucauauuaugaucuguaauauuuagaauauugauugaaaauuuugauuggcaaaaccaaugc-3'.

[0067] The MERS-HAV 3' UTR sequence is as follows: 5'-ugucacucaaaguaacaagaucgcggcaaucguuuguguuuggcaaccccaucucaccaucgcuuguccacucuugcacagaauggaaucauguuguaauuacagugcaauaagguaauuauaacccauuuaauugauagcuaugcuuuauuaaaguguguagcuguagagagaauguuaaagacugucaccucugcuugauugcaagugaacagugccccccgggaagagcucuacagugugaaauguaaauaaaaaauagcuauuauucaauuagauuaggcuaauuagaugauuugcuuuguuuaaacaaauuuucuuaaaauuucugagguuuguuuauuucuuuuaucaguaaau-3' (SEQ ID NO:9).

[0068] The six mRNAs containing tandem 3'UTRs and mRNAs containing individual BF34, MERS, HAV, and hBg 3'UTRs were transfected into HepG2 cells and DC2.4 cells respectively according to the same method. The cells were harvested 24h and 48h after transfection for luciferase activity detection. The results were as follows: Figure 3 and Figure 4 As shown, Figure 3 The significant difference analysis is shown in Table 3. Figure 4 The significant difference analysis is shown in Table 4.

[0069] Table 3

[0070]

[0071] from Figure 3 and Figure 4 The results show that in the modified group, the expression effect of the 3'UTR after concatenation was not significantly improved compared with the single 3'UTR. In fact, some combinations decreased. This may be because the 3'UTR sequence after concatenation is too long, resulting in reduced mRNA translation efficiency, indicating that the strategy of concatenating 3'UTR is not suitable for improving the expression of mRNA with base modification. In the non-modified group, the 3'UTR expression effect of the BF34-HAV combination was the best, reaching about 2 times that of the control group in HepG2 cells and about 3 times that of the control group in DC2.4 cells. The 3'UTR of the HAV-BF34 combination was slightly improved compared with the control group, and the 3'UTR of the other combinations did not show a significant improvement, indicating that the concatenation method is only helpful for the function of some UTRs.

[0072] Table 4

[0073]

Claims

1. A 3'UTR sequence for regulating mRNA translation efficiency, wherein the 3'UTR sequence is shown in SEQ ID NO:

1.

2. The 3'UTR sequence according to claim 1, characterized in that The 3'UTR sequence is a sequence without base modification.

3. A DNA molecule comprising a nucleotide sequence for transcribing the 3'UTR sequence of claim 1 or 2, wherein the DNA molecule is transcribed into mRNA; The DNA molecule comprises a strand having the following elements: The coding region, a nucleotide sequence encoding a 5'UTR sequence located upstream of the coding region, and a nucleotide sequence encoding a 3'UTR sequence located downstream of the coding region, wherein The 3'UTR sequence is the 3'UTR sequence according to claim 1 or 2.

4. The DNA molecule according to claim 3, characterized in that The coding region includes a start codon at the 5' end, the coding region encodes a polypeptide, and the coding region includes a stop codon at the 3' end.

5. A vector comprising the DNA molecule according to claim 3 or 4.

6. A host cell comprising the vector according to claim 5, wherein the host cell is a eukaryotic cell.

7. A composition comprising the DNA molecule of claim 3 or 4, the vector of claim 5, or the host cell of claim 6.

8. An RNA molecule comprising the 3'UTR sequence of claim 1 or 2; The RNA molecule comprises: Coding region, a 5'UTR sequence located upstream of the coding region, and a 3'UTR sequence located downstream of the coding region, wherein, The 3'UTR sequence is the 3'UTR sequence according to claim 1 or 2.

9. The RNA molecule according to claim 8, characterized in that The coding region includes a start codon at the 5' end and encodes a polypeptide.

10. A pharmaceutical composition comprising the RNA molecule of claim 8 or 9.

11. The pharmaceutical composition according to claim 10, characterized in that The pharmaceutical composition further includes a pharmaceutically acceptable adjuvant. 12 . A method for improving the translation efficiency of eukaryotic mRNA, comprising the step of linking the 3′UTR sequence of claim 1 or 2 to the 3′ end of the coding region of the mRNA to be translated.

13. Use of the 3'UTR sequence according to claim 1 or 2 in the preparation of a product for improving the translation efficiency of eukaryotic mRNA.

14. Use of the DNA molecule according to claim 3 or 4, the vector according to claim 5, the host cell according to claim 6, or the RNA molecule according to claim 8 or 9 in the preparation of a gene expression reagent or kit, wherein the host cell for gene expression is a eukaryotic cell.

Citation Information

Patent Citations

  • mRNA 3'UTR sequences leading to increase mRNA translation

    KR102624969B1

  • UTRs INCREASING THE TRANSLATION EFFICIENCY OF RNA MOLECULES

    US20190194669A1