SiRNA for targeting and inhibiting expression of chicken plcd4 gene and application thereof
By designing siRNAs that target and inhibit the chicken PLCD4 gene, and specifically knocking down PLCD4 gene expression, the problem of effectively regulating the chicken PLCD4 gene in existing technologies has been solved, achieving efficient regulation of subcutaneous fat deposition, which has economic and scientific research value.
Patent Information
- Application Number
- CN202510171242.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-17
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2045-02-17
AI Technical Summary
There is a lack of effective methods in the current technology to knock down the expression of the chicken PLCD4 gene, which affects the progress of molecular genetic selection for subcutaneous fat deposition in poultry.
We designed and used siRNA to target and inhibit the expression of the chicken PLCD4 gene. By transfecting primary chicken subcutaneous adipocytes, we specifically knocked down the expression of the PLCD4 gene, achieving an inhibition efficiency of over 50%.
It effectively reduces chicken PLCD4 gene expression, promotes subcutaneous fat cell proliferation, inhibits fat deposition, and provides molecular markers for reference in the breeding of high-quality broilers and research on human metabolic diseases.
Smart Images

Figure CN119842714B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of poultry breeding, and particularly relates to siRNA for targeted inhibition of chicken PLCD4 gene expression and application thereof. BACKGROUND
[0002] PLCD4 gene, i.e. phospholipase C, delta 4, is an important member of the phospholipase C (PLC) delta family. PLC, as a kind of key enzyme, plays a crucial role in cell signal transduction. PLCD4 produces a second messenger molecule by hydrolyzing phosphatidylinositol-4,5-bisphosphate (PIP2), and further participates in the regulation of various physiological processes in cells. Studies have shown that PLCD4 may affect the proliferation and differentiation process of animal myoblasts by regulating the signal transduction pathway in myoblasts. In poultry, there is little research on PLCD4 gene, and there is no related report on knocking down chicken PLCD4 gene expression by using siRNA in the prior art. Therefore, the use of siRNA to knock down chicken PLCD4 gene expression and determine the role of PLCD4 in chicken subcutaneous fat deposition can be applied to molecular genetic selection of high-quality broiler subcutaneous fat deposition, shorten the generation interval, and increase the selection progress. SUMMARY
[0003] The purpose of the present application is to solve the problems in the prior art, and to provide siRNA for targeted inhibition of chicken PLCD4 gene expression and application thereof. After being transferred into primary chicken subcutaneous fat cells, the siRNA can effectively reduce the expression of chicken PLCD4 gene, and the inhibition efficiency is more than 50%, with high knockdown efficiency.
[0004] In order to achieve the above purpose, the present application is realized by the following technical scheme:
[0005] In the first aspect, the present application provides siRNA for targeted inhibition of chicken PLCD4 gene expression, wherein the siRNA comprises PLCD4-853, PLCD4-528 and PLCD4-1870,
[0006] The sequence of the PLCD4-853 sense strand is GGGAGGAACGGAGAGAUAATT, and the sequence of the antisense strand is UUAUCUCUCCGUUCCUCCCTT. A TT base overhang is added to the suffix of each siRNA sequence.
[0007] The sequence of the PLCD4-528 sense strand is TTCCAGAAAGCTGACAAGAATAATT, and the sequence of the antisense strand is CCAGAAAGCUGACAAGAAUAATT. A TT base overhang is added to the suffix of each siRNA sequence.
[0008] The sequence of the PLCD4-1870 sense strand is TGCTTAAACCAGCCTTCATGAGGTT, and the sequence of the antisense strand is CUUAAACCAGCCUUCAUGAGGTT, and a TT base overhang is added to the end of each siRNA sequence.
[0009] In a second aspect, the application provides the siRNA for targeting and inhibiting the expression of the chicken PLCD4 gene in the genetic selection of chicken subcutaneous fat deposition.
[0010] Preferably, the siRNA for targeting and inhibiting the expression of the chicken PLCD4 gene is designed, and the siRNA is transfected into chicken primary subcutaneous fat cells to specifically knock down the expression of the chicken PLCD4 gene.
[0011] Preferably, the siRNA for targeting and inhibiting the expression of the chicken PLCD4 gene is designed, and the siRNA is transfected into chicken primary subcutaneous fat cells to specifically knock down the expression of the chicken PLCD4 gene.
[0012] Preferably, the siRNA for targeting and inhibiting the expression of the chicken PLCD4 gene is designed, and the siRNA is transfected into chicken primary subcutaneous fat cells to specifically knock down the expression of the chicken PLCD4 gene.
[0013] The chicken primary subcutaneous fat cells isolated and extracted from the subcutaneous fat tissue of 21-day-old chickens are used as transfection cells, and the isolated and extracted chicken primary subcutaneous fat cells are inoculated into a 12-well culture plate. When the cell density grows to 60-70%, the original culture solution in the culture dish is removed, and fresh culture medium without serum is added. The siRNA targeting the chicken PLCD4 gene is transfected into the chicken primary subcutaneous fat cells by means of the transfection reagent Lipofectamine 3000.
[0014] The specific transfection system is as follows: 175 uL of opti-MEM culture medium + 5 ul of siRNA with a final concentration of 20 uM + 8 ul of Hiperfect transfection; a transfection complex is formed by incubating for 10 minutes, and then the transfection complex is transfected into the culture medium.
[0015] The application has the following beneficial effects: the siRNA for targeting and inhibiting the expression of the chicken PLCD4 gene is provided, and after being transfected into chicken primary subcutaneous fat cells, the expression of the chicken PLCD4 gene can be effectively reduced, and the inhibition efficiency is more than 50%, and the knockdown efficiency is very high. The siRNA of the application can be used for the genetic selection of high-quality broiler subcutaneous fat deposition and the research of human metabolic diseases caused by obesity by specifically knocking down the expression of the chicken PLCD4 gene in vitro to identify the gene function, and has great economic value and scientific research value. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1The expression of PLCD4 in subcutaneous adipose tissue of different chicken strains (different letters represent significant differences (P < 0.05), the same letter represents no significant differences (P > 0.05); ** indicates significant differences (P < 0.01)); S3, H, and F analyses represent S3 strain chickens, H strain chickens, and F strain chickens;
[0017] Figure 2 The expression of PLCD4 in subcutaneous adipocytes (different letters represent significant differences (P < 0.05));
[0018] Figure 3 The expression changes of the PLCD4 gene after exogenous transfection with PLCD4 siRNA are shown in the figure (different letters represent significant differences (P < 0.05), and the same letter represents no significant differences (P > 0.05)).
[0019] Figure 4 The changes in subcutaneous adipocyte proliferation after exogenous transfection with PLCD4 siRNA (* indicates significant difference (P<0.05));
[0020] Figure 5 This study describes the changes in lipid droplet deposition in subcutaneous adipocytes after exogenous transfection with PLCD4 siRNA. Detailed Implementation
[0021] The invention is further illustrated and defined by the following examples, but not limited thereto. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. The invention will be further described below with reference to the accompanying drawings.
[0022] Example 1: Detection of PLCD4 gene expression in chicken subcutaneous adipose tissue and subcutaneous adipocytes using quantitative real-time PCR.
[0023] 1.1 Expression of PLCD4 in subcutaneous adipose tissue
[0024] The expression of PLCD4 in subcutaneous adipose tissue at different developmental stages of recessive white-feathered chickens and the sex-linked dwarf strain S3 chickens was detected using qPCR. Figure 1 As shown, the expression level of PLCD4 in subcutaneous adipose tissue of different strains and at different developmental stages exhibits significant differences based on breed and development, indicating that PLCD4 is involved in the process of subcutaneous fat deposition in chickens.
[0025] 1.2 Expression of PLCD4 in adipocytes
[0026] The expression of PLCD4 in the proliferation and differentiation phases of subcutaneous adipocytes was detected using qPCR. Figure 2As shown, the expression of PLCD4 in the proliferation period of subcutaneous fat cells was higher than that in the differentiation period, wherein the expression in the proliferation period 50% was the highest and significantly higher than that in each differentiation period (P<0.01), and the difference between the proliferation period 50% and the proliferation period 100% was not significant (P>0.05). It is preliminarily indicated that PLCD4 may have the effect of inhibiting the deposition of chicken subcutaneous fat.
[0027] Case 2: Screening of optimal siRNA sequence targeting chicken PLCD4 gene
[0028] 2.1 Design of PLCD4 siRNA
[0029] According to the NCBI online database, the mRNA sequence information of chicken PLCD4 gene (accession number: XM_040676606.2) was obtained, and 3 pairs of siRNA targeting the CDS region of chicken PLCD4 gene were designed by using si Catch TM siRNA design software, and TT base overhang was added to the suffix of each siRNA sequence. The designed siRNA was synthesized by Suzhou Jimabio Technology Co., Ltd., and each 1OD siRNA was diluted with 125ul DEPC water, and the final concentration was 20uM / ul, which was stored at -20℃ for use. The sequences of the 3 pairs of siRNA obtained by design are shown in Table 1.
[0030] Table 1: Sequences of 3 pairs of siRNA
[0031]
[0032]
[0033] 2.2 Transfection of siRNA into primary chicken subcutaneous fat cells
[0034] The chicken subcutaneous fat cells isolated and extracted from the subcutaneous fat tissue of 21-day-old chickens were used as transfection cells. The isolated and extracted chicken primary subcutaneous fat cells were inoculated into 12-well culture plates, and when the cell density grew to 60-70%, the original culture medium in the culture dish was removed and replaced with fresh serum-free culture medium. With the help of transfection reagent Lipofectamine 3000, 3 pairs of siRNA targeting chicken PLCD4 gene and negative control siRNA (NC) were respectively transfected into chicken subcutaneous fat cells, and each group had 3 repeated holes.
[0035] The specific transfection system is as follows: test group: 175 uL of opti-MEM medium + 5 ul of siRNA with a final concentration of 20 uM + 8 ul of Hiperfect transfection; control group: 175 uL of opti-MEM medium + 5 ul of Negative with a final concentration of 20 uM + 8 ul of Hiperfect transfection, a total of 10 minutes of incubation, forming a transfection complex, transfection into the culture medium.
[0036] 2.3 RNA extraction and cDNA preparation
[0037] After transfection for 24 h, each well was washed with PBS for 3 times, 0.6 ml TROZL was added to the culture dish, and the cells were collected. The total RNA of the transfected PLCD4 siRNA group and the control group cells was extracted by selecting the RNA kit (RNA isolater Total RNA Extraction Reagent) of Nanjing Nuo Weizan Biological Technology Co., Ltd. The RNA concentration was determined by nucleic acid quantifier. The cDNA synthesis was performed according to the reverse transcription kit instruction book of Dalian Bao Biological Engineering Co., Ltd.
[0038] 2.4 Real-time fluorescent quantitative PCR detection of siRNA interference efficiency
[0039] The Hi Script III RT Super Mix for q PCR (+g DNA wiper) reagent of Nanjing Nuo Weizan Biological Technology Co., Ltd. was selected, and the SYBR Green I method was used for real-time fluorescent quantitative PCR detection of the efficiency of siRNA specific interference with chicken PLCD4 gene expression, and 3 repeats were set for each sample. The Q-PCR reaction program: 95℃ 15 min; 40 cycles (94℃ 15 s, 55℃ 30 s, 70℃ 30 s).
[0040] Upstream primer (SEQ ID NO: 7): 5'-TGCCAATTCCATCAATCCTGT-3'
[0041] Downstream primer (SEQ ID NO: 8): 5'-ATAGCCTGAGTGTACTGCAA -3'
[0042] 2.5 Detection of primer pair nucleic acid sequence of chicken internal reference GAPDH gene expression:
[0043] Upstream primer (SEQ ID NO: 9): 5'-AGAAGGCTGGGGCTCATCT-3'
[0044] Downstream primer (SEQ ID NO: 10): 5'-CAATGCCAAAGTTGTCATG-3'
[0045] The efficiency of 3 pairs of siRNA-specific knockdown of chicken PLCD4 gene expression is as follows: Figure 3 As shown. By Figure 3 It was found that, compared with the control group, PLCD4-853 siRNA significantly inhibited the expression of the PLCD4 gene in cells (P<0.05), exhibiting the best interference efficiency with an inhibition rate exceeding 50%. Subsequent experiments selected PLCD4-853 to investigate the function of the PLCD4 gene in subcutaneous fat deposition in chickens. The sense strand of PLCD4-853 is GGGAGGAACGGAGAGAUAATT, and the antisense strand is UUAUCUCUCCGUUCCUCCCTT.
[0046] Effects of 2.6PLCD4 gene knockdown on the expression of genes related to cell proliferation and differentiation
[0047] Changes in cell proliferation were detected using a CCK8 assay kit 24 h and 72 h after PLCD4-853 siRNA transfection. Figure 4 As shown, transfection with PLCD4-853 siRNA significantly increased the proliferation of primary chicken subcutaneous adipocytes (P<0.05). Oil Red O staining 4 days after transfection revealed significantly lower lipid droplet deposition in adipocytes compared to the control group (P<0.01). Figure 5 Experiments have shown that the PLCD4 gene promotes the proliferation of subcutaneous fat cells in chickens and inhibits lipid deposition in these cells.
[0048] The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention. Those skilled in the art can make possible changes and modifications to the present invention based on the above-disclosed technical content without departing from the scope of the technical solution of the present invention, or modify it into equivalent embodiments with equivalent changes. Any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention shall fall within the protection scope of the technical solution of the present invention.
Claims
1. An siRNA that targets and inhibits the expression of a chicken PLCD4 gene, characterized in that, The siRNA is PLCD4-853, The sequence of the PLCD4-853 sense strand is GGGAGGAACGGAGAGAUAATT, and the sequence of the antisense strand is UUAUCUCUCCGUUCCUCCCTT.
2. The siRNA for targeting and inhibiting the expression of chicken PLCD4 gene in the genetic selection for inhibiting the subcutaneous fat deposition of chicken.
Citation Information
Patent Citations
Method for separation, identification and adipogenic differentiation of mammal fat precursor cells, composition and application
CN117625527A
Quality management method for specific cells and method for producing specific cells
CN117677707A