Aptamer specifically bound with arabidopsis thaliana COP1 protein and preparation method thereof

Abstract

The invention belongs to the technical field of plant biology, and particularly relates to a nucleic acid aptamer with high binding force specificity with arabidopsis thaliana COP1 protein and a preparation method of the nucleic acid aptamer. In order to solve the problem that the existing screening technology wastes time and labor, the invention provides a nucleic acid aptamer specifically bound with arabidopsis thaliana COP1 protein and a preparation method thereof. The nucleic acid aptamer Lib2-11 of arabidopsis thaliana COP1 is obtained through a One-step screening technology, the nucleic acid aptamer has high binding property and high specificity, and the nucleic acid aptamer Lib2-11c with high binding property is obtained after a sequence is optimized. The nucleic acid aptamers Lib2-11 and Lib2-11c disclosed by the invention have important application prospects in determining the protein level of the arabidopsis thaliana COP1, subcellular localization and a light-operated synthesis gene route.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a nucleic acid aptamer specifically binding to Arabidopsis thaliana COP1 protein, a preparation method and an application thereof. background

[0003] Nucleic acid aptamers are a class of single-stranded DNA or RNA molecules that are screened from random oligonucleotide libraries through screening technology. They can specifically recognize various target molecules, including small molecules, proteins, cells and even entire organisms. Aptamers have been widely used in the field of biotechnology, including as diagnostic or therapeutic tools, and for detecting and quantifying specific analytes in biological systems. Compared with protein antibodies, aptamers have the advantages of easy chemical synthesis, low cost, high stability, and easy modification and updating. In the field of synthetic biology, aptamers can also be used as recognition modules of quantitative biosensors (aptasensors) for the construction of gene circuits and the labeling and detection of small molecule metabolites.

[0004] COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1) protein plays a vital role in plant light signal transduction. COP1 is an E3 ubiquitin ligase that regulates the abundance or activity of substrates by ubiquitinating substrates, thereby regulating a variety of biological processes. It plays a core role in regulating plant photomorphogenesis. Due to the versatility of COP1 in plant light signal transduction, it has become an important target in plant biology research and is of great significance for understanding how plants perceive and respond to light environments. Studying the function and regulatory mechanism of COP1 has potential application value for agricultural biotechnology, especially in crop improvement and yield increase. Therefore, the screening of COP1 protein aptamers is of great significance for plant molecular biology and synthetic biology research.

[0005] Aptamer screening technology is based on the enrichment of high-affinity and specific biorecognition molecules. The traditional aptamer screening technology is SELEX, which starts from a highly diverse oligonucleotide library and finally obtains aptamers that specifically bind to the target molecule through multiple rounds of screening and enrichment. Since the first report of SELEX technology in 1990, aptamer screening technology has continued to develop. Currently, a variety of optimized screening technologies have been developed, such as Direct SELEX, FluMag-SELEX, SolutionSELEX, Cell SELEX and GO-SELEX, each of which has its specific application scenarios and advantages.

[0006] However, traditional SELEX screening technology usually requires multiple rounds of screening and amplification, which is a time-consuming and complicated process; non-specific binding may occur during the screening process, leading to false positive results; PCR amplification deviation, active conformational changes of proteins or target molecules, etc. will also increase the uncertainty of aptamer screening results; although the synthesis cost of nucleic acid aptamers is low, the cost of the entire SELEX process may be relatively high. If a large number of oligonucleotides with different sequences need to be synthesized, the cost will be further increased; at the same time, although the traditional screening technology has been optimized, it does not have wide applicability. This application provides a simple, fast, low-cost and widely applicable nucleic acid aptamer screening method. Summary of the invention

[0007] In view of the problems existing in the above-mentioned prior art, the present application provides a method for preparing a novel nucleic acid aptamer. Using Arabidopsis thaliana COP1 as the target protein, the nucleic acid aptamer Lib2-11 is obtained by one-step screening technology, and by predicting possible binding sites, it is truncated and optimized to obtain the nucleic acid aptamer Lib2-11c with better binding performance.

[0008] In order to achieve the above invention purpose, this patent first provides a nucleic acid ligand that specifically binds to Arabidopsis COP1 protein, and its nucleotide sequence is shown in SEQ ID NO.1. SEQ ID NO.1:

[0009] GGGAGGACGATGCGGAAAAAAAGGGAATAAAGAAAGCGCAC

[0010] GACAAAAAAGAAAAAACAAACAGACGACTCGCTGAGGATCC

[0011] GAGA

[0012] The nucleic acid aptamer Lib2-11 specifically binding to the Arabidopsis COP1 protein has a secondary structure with a loop and a stem, a Gibbs free energy of -7.12, and a dissociation constant Kd of 3.741 nM.

[0013] The present invention also provides a truncated sequence Lib2-11c of the nucleic acid aptamer Lib2-11 with higher binding ability to Arabidopsis COP1 protein, and its nucleotide sequence is shown in SEQ ID NO.2. SEQ ID NO.2:AAAAAAAGGGAATAAAGAAAGCGCACGACAAAAAAGAAAAAACAAA

[0014] The preparation method of the nucleic acid aptamer Lib2-11 or Lib2-11c that specifically binds to the Arabidopsis COP1 protein comprises:

[0015] (1) Construction of vectors expressing Arabidopsis COP1 and homologous proteins;

[0016] (2) Expression and purification of Arabidopsis COP1 and homologous proteins;

[0017] (3) One-step screening process;

[0018] (4) Related analytical techniques include ELONA and gel retardation experiments.

[0019] In the one-step screening process, after binding for 1 hour, the cells were washed once every 12 hours, for a total of 5 times, and finally incubated at 95°C for 5 minutes to elute the aptamers.

[0020] The application of the above-mentioned nucleic acid aptamer Lib2-11 or Lib2-11c that specifically binds to the Arabidopsis COP1 protein in monitoring the level and subcellular localization of the COP1 protein.

[0021] Application of the nucleic acid aptamer Lib2-11 or Lib2-11c that specifically binds to Arabidopsis COP1 protein in a detection kit or a biosensor.

[0022] A kit comprises the above-mentioned nucleic acid aptamer Lib2-11 or Lib2-11c which specifically binds to Arabidopsis thaliana COP1 protein.

[0023] Application of the nucleic acid aptamer Lib2-11 or Lib2-11c that specifically binds to Arabidopsis COP1 protein in the preparation of a reagent for detecting Arabidopsis COP1 protein.

[0024] The present invention uses the one-step aptamer technology to screen out the nucleic acid aptamer Lib2-11 that specifically binds to the Arabidopsis COP1 protein for the first time, and its nucleotide sequence is shown in SEQ ID NO. 1. It has been verified that Lib2-11 can recognize and bind to the Arabidopsis COP1 protein with high affinity and high specificity, and its truncated sequence Lib2-11c, whose nucleotide sequence is shown in SEQ ID NO. 2, can also recognize and bind to the Arabidopsis COP1 protein with high affinity and high specificity.

[0025] The nucleic acid aptamer Lib2-11 described in the present invention can simply, sensitively and conveniently bind, identify and detect Arabidopsis COP1 protein. It is of great significance to establish an effective detection method for Arabidopsis COP1 protein, and is suitable for synthetic gene circuits or biosensors, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Screening process (A) and residue rate in each cleaning round (B).

[0027] Figure 2 PCR electropherograms of products after each round of cleaning.

[0028] Figure 3 The developmental tree of Arabidopsis COP1 protein nucleic acid aptamers analyzed by MEGA software (selecting the top 50 sequences in abundance from two random libraries Lib1 and Lib2).

[0029] Figure 4 Affinity test of the screened candidate nucleic acid aptamers.

[0030] Figure 5 ELONA analysis of the dissociation constants of two COP1 aptamers from different random libraries. (A) ELONA flow chart, (B) dissociation constants of Lib2-11, (C) dissociation constants of Lib1-9.

[0031] Figure 6 Analysis of truncated fragments of COP1 nucleic acid aptamer Lib2-11 (A) Secondary structure prediction, (B) ELONA analysis, (C) Dissociation constant of Lib2-11c core sequence.

[0032] Figure 7 Analysis of the binding specificity of COP1 aptamer Lib2-11 to COP1 of different species: Arabidopsisthaliana (At), Rhizoclosmatium globosum (Rg), Camellia sinensis (Cs) and Homosapiens (Hs).

[0033] Figure 8 Diagram of the binding mechanism of nucleic acid aptamer Lib2-11 and Arabidopsis COP1 protein. DETAILED DESCRIPTION

[0034] 1. Screening process ( Figure 1 A)

[0035] Pre-washed Ni-NTA microbeads and 10 μg HIS-COP1-N128 were added to 580 μL binding buffer (1× PBS, 5 mM MgCl 2 , 1 mM CaCl 2and 2.5 mM KCl) and incubated at 4°C with rotation for 30 min. Wash three times with washing solution (1×PBS, 0.2% Triton-X and 300 mM NaCl) to remove loose or physically bound proteins. 100 pmol of ssDNA library containing 40 random sequences (GGGAGGACGATGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGACGACTCGCTGAGGATCCGAGA) was added to 90 μL binding buffer (1×PBS, 5 mM MgCl 2 , 1 mM CaCl 2 and 2.5mM KCl), denature at 95℃ for 5min, then slowly cool to 4℃, add to the above system, and adjust the volume to 400μL with binding buffer, and incubate at 4℃ with rotation. Collect the binding buffer every 12h and replace it with 400μL of fresh binding buffer, and repeat this step until 60h to remove as many weakly binding DNA sequences as possible ( Figure 1 A). Finally, 100 μl of ddH 2 The aptamer candidates were eluted using primers (N40-F: GGGAGGACGATGCGG and N40-R: TCTCGGATCCTCAGCGAGTCGTCTG) under the following conditions (95°C, 10s; 55°C, 10s; 72°C, 10s), followed by agarose gel electrophoresis for 15min to observe and analyze the sequence length, abundance and purity of the PCR products ( Figure 2 ).

[0036] 2. Analysis of candidate nucleic acid aptamers for Arabidopsis thaliana COP1 protein

[0037] Then the optimal cycle number was selected for mass amplification and then NGS sequencing was performed by Shanghai Lingen Company. After obtaining high-throughput data, the affinity sequences with base numbers of 70-90 were separated using the website (https: / / usegalaxy.org / ), and the top 50 sequences in abundance were retrieved. All the results are summarized in Table 1. The developmental tree analysis was performed using MEGA software ( Figure 3 ). Combining the evolutionary tree and sequence free energy, seven candidate sequences of nucleic acid aptamers were synthesized and their binding activity was tested by retention experiments ( Figure 4 ).

[0038] 3. Determination of the dissociation constant (Kd) of nucleic acid aptamers

[0039] Determination of Kd constant using ELONA ( Figure 5A). 250 ng of COP1 protein was added to a 96-well high-binding polystyrene microplate and coated overnight at 4°C. The plate was washed three times with wash buffer (PBS containing 0.05% Tween-20, pH 7.4) and blocked with blocking buffer (wash buffer containing 2% bovine serum albumin) at 37°C for 30 min. Biotinylated Lib2-11 (0, 0.20, 0.39, 0.78, 1.56, 3.13, 6.25, 12.5, 25, 50, 100 and 200 nM) diluted in a gradient in PBS solution was added to the corresponding wells and incubated at 25°C for 1 h. The plate was washed three times with wash buffer, streptavidin-HRP (1:5000) was added and incubated at room temperature for 30 min. After washing three times with wash buffer, TMB solution was added, incubated at room temperature in the dark for 20 min, and then stop buffer (2 M sulfuric acid) was added. The optical density absorbance (OD450) at 450 nm was measured using a microplate reader. The Kd value of the nucleic acid aptamer was estimated using the following equation: Y = Bmax*X / (Kd+X).

[0040] Y represents the average value of OD450, Bmax is the maximum value of OD450, and X is the concentration of biotin-labeled aptamer. The experimental results were fitted and statistically analyzed using GraphPad Prism 8.0.1 software. Combining retention experiments and ELONA analysis, it was found that Lib2-11 had a high binding activity, with a Kd value of 3.741nM ( Figure 5 B), which is much higher than the Kd value of Lib1-9 (11.14 nM) Figure 5 C).

[0041] 4. Analysis of truncated sequences

[0042] The structure prediction of Lib2-11 sequence was performed using an online website (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) and it was found that the secondary structure of Lib2-11 mainly consists of stem and loop ( Figure 6 A). The Lib2-11 nucleic acid aptamer sequence was truncated and tested ( Figure 6 B), and finally obtained a shorter nucleic acid aptamer Lib2-11c, the nucleotide sequence of which is shown in SEQ ID NO.2. After secondary structure prediction and affinity testing, it was found that its Kd value was 1.679nM, and Lib2-11c had a higher binding ability to Arabidopsis COP1 than Lib2-11 ( Figure 6 C).

[0043] 5. Specificity analysis of the binding of aptamer Lib2-11 to Arabidopsis COP1 protein

[0044] After the biotin-labeled aptamer Lib2-11 was subjected to ELONA analysis with AtCOP1, RgCOP1, CsCOP1 and HsCOP1 proteins, data processing by Graphpad prism revealed that Lib2-11 and Arabidopsis COP1 had high specificity ( Figure 7 ).

[0045] 6. Gel Retardation Assay

[0046] 1 pmol of Fam fluorescently labeled Lib2-11 was mixed with Arabidopsis thaliana COP1 protein at corresponding ratios (1:1, 1:10, 1:20, 1:50) in binding buffer (1× PBS, 5 mM MgCl 2 , 1 mM CaCl 2 and 2.5 mM KCl) at room temperature for 30 min. Add 1 μl of loading buffer (10×), mix well and load onto 8% non-denaturing PAGE gel. After electrophoresis, collect the fluorescence of Fam for development analysis ( Figure 8 A).

[0047] 7. Analysis of the binding mechanism between nucleic acid aptamer Lib2-11 and Arabidopsis COP1 protein

[0048] Molecular simulations using Alphafold3 clarified the mechanism and binding site of the Lib2-11 aptamer sequence with the Arabidopsis COP1 protein. Figure 8 B), which laid a theoretical foundation for the nucleic acid aptamer Lib2-11 to recognize and detect Arabidopsis COP1 protein.

Claims

1. A nucleic acid aptamer Lib2-11 that specifically binds to Arabidopsis thaliana COP1, characterized in that: Its nucleotide sequence is shown as SEQ ID NO.

1.

2. The nucleic acid aptamer Lib2-11 that specifically binds to Arabidopsis thaliana COP1 according to claim 1, characterized in that: At least one of the following is met: The secondary structure has a loop and a stem, and the Gibbs free energy is DG = -7.12; The dissociation constant Kd is 3.7nmol / L.

3. A truncated sequence Lib2-11c of the nucleic acid aptamer Lib2-11 that specifically binds to Arabidopsis COP1, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

2.

4. A method for preparing nucleic acid aptamers Lib2-11 and Lib2-11c that specifically bind to Arabidopsis thaliana COP1, characterized in that The following steps are involved: (1) Enrichment of His-tagged Arabidopsis COP1 recombinant protein using Ni-NTA magnetic beads; (2) Preparation and analysis of single-stranded DNA enriched libraries; (3) elution of single-stranded DNA sequences with affinity to COP1; (4) Symmetrical PCR amplification and electrophoresis identification.

5. Application of nucleic acid aptamers Lib2-11 or Lib2-11c that specifically bind to Arabidopsis COP1 in identifying the protein level of Arabidopsis COP1.

6. Application of nucleic acid aptamers Lib2-11 or Lib2-11c that specifically bind to Arabidopsis COP1 in observing the subcellular localization of Arabidopsis COP1.

7. Application of nucleic acid aptamers Lib2-11 or Lib2-11c that specifically bind to Arabidopsis COP1 in the preparation of biosensors.

8. A kit comprising a nucleic acid aptamer Lib2-11 or Lib2-11c that specifically binds to Arabidopsis thaliana COP1.

9. Use of the nucleic acid aptamer Lib2-11 or Lib2-11c that specifically binds to Arabidopsis COP1 in the preparation of a reagent for detecting Arabidopsis COP1.

Images