Fucoidase gene QAUFcn2 and application thereof in degradation of fucoidan

Abstract

The invention provides a fucoidan enzyme gene QAUFcn2 and application of the fucoidan enzyme gene QAUFcn2 in degradation of fucoidan. The nucleotide of the fucoidan enzyme gene is shown as SEQ ID No.1, and the amino acid sequence of the fucoidan enzyme generated by coding is shown as SEQ ID No.2. The invention further provides a preparation method of the fucoidan enzyme gene QAUFcn2. The invention also obtains a recombinant strain of the QAUFcn2 gene, realizes heterologous expression of the QAUFcn2 gene, obtains the heterologous expression fucoidase, and proves that the fucoidase has the capability of degrading fucoidan from different sources. The fucoidase gene family is enriched, a foundation is laid for further clarification of the catalytic action mechanism of the fucoidase, development and utilization of fucoidan resources are promoted, and the fucoidase has important theoretical value and production guiding significance.

Description

Technical Field

[0001] The present invention belongs to the field of gene technology and specifically relates to a fucoidanase gene. QAUFcn2 And its application in degradation of fucoidan. Background Art

[0002] Fucoidan, also known as fucoidan, brown algae polysaccharide and fucoidan sulfate, is a functional marine polysaccharide with multiple physiological effects. It is a large class of pure natural, anionic, high molecular weight water-soluble heteropolysaccharides extracted from seaweed, with multiple biological functions such as anticoagulation, anti-tumor, anti-thrombosis, anti-virus, and antioxidant. Fucoidan mainly comes from brown algae seaweed. Fucoidan mainly comes from Fucus, Laminaria and Sargassum of the Phaeophyta. At present, it is mainly extracted from brown algae such as Fucus, Sargassum, Sargassum, Giant kelp, Kelp, Undaria, and Ascophyllum. Fucoidan not only comes from brown algae, but also from some marine invertebrates, such as Abalone, Yesso scallop, Echinococcus glabrata and Littoral Snail. Among invertebrates, fucoidan can be extracted from marine organisms such as sea cucumbers and sea urchins.

[0003] The structure of fucoidan is diverse in terms of monosaccharide composition, glycosidic bond connection mode, sulfation modification, molecular weight and substituents. Its main component, fucose, can coexist with other monosaccharides (such as galactose, mannose, etc.), and the glycosidic bond connection mode includes various types such as α-1,3, α-1,4 and α-1,2. Sulfate groups can be distributed on different carbon atoms of fucose, and the number and position vary depending on the source. In addition, fucoidan may also contain substituents such as acetyl groups, which further increases the complexity of the structure. Fucoidan from different sources also has significant differences in molecular weight, degree of sulfation and skeleton structure. These diversity and complexity make it show unique advantages in biological activity and function. However, the complexity and diversity of the molecular structure of fucoidan have led to an unclear relationship between biological function and its molecular structure, which seriously restricts the application of fucoidan in clinical medicine, health care and food. Compared with high molecular weight fucoidan, low molecular weight fucoidan oligosaccharides show certain advantages in bioavailability and biological activity, and have great application potential. Therefore, how to obtain low molecular weight fucoidan oligosaccharides with multiple physiological functions by degrading natural large molecular weight fucoidan has attracted the attention of scientific researchers at home and abroad.

[0004] Fucoidanase is the key enzyme for degrading fucoidan. Due to the rich variety of fucoidan, the strains that degrade fucoidan and the fucoidanase they produce are also different. There are 28 reported fucoidanase classified in the CAZY database. The complexity and diversity of the molecular structure of fucoidan determine the diversity of the types and functions of fucoidanase. The fucoidanase-producing strains reported so far have the problems of low enzyme production and poor enzyme activity. In the face of the above problems, the current solution is mainly to increase the enzyme production or enzyme activity by optimizing the culture medium, culture conditions and physical mutagenesis, but the effect is not significant. The commercialization of fucoidanase is still impossible. At present, the research on fucoidanase mainly focuses on heterologous expression and the most basic enzymatic property characterization. There is no more in-depth research on the related mechanism and substrate specificity analysis of fucoidanase.

[0005] GH107 family fucoidase plays an important role in the structural analysis of fucoidan and the preparation of fucoidan oligosaccharides. This type of enzyme can specifically hydrolyze the α-glycosidic bonds in fucoidan and degrade complex fucoidan into fucoidan oligosaccharides with different degrees of polymerization through endo- or exo-cutting. For example, the MfFcnA enzyme of the GH107 family can hydrolyze sulfated fucoidan to release fucoidan oligosaccharides with diverse structures, revealing the complex sulfation sites and branching structures of fucoidan. This enzymatic degradation method not only helps to analyze the fine structure of fucoidan, but also can efficiently prepare bioactive fucoidan oligosaccharides, providing an important tool for the development of new functional foods and drugs. Compared with fucoidanase of other families, GH107 family fucoidase can hydrolyze not only fucoidan from brown algae but also fucoidan from sea cucumber. This wide substrate adaptability makes it more advantageous in processing fucoidan with complex structure and high heterogeneity. Summary of the invention

[0006] The object of the present invention is to provide a fucoidanase gene QAUFcn2 And its application in degrading fucoidan. QAUFcn2 The gene can encode the production of fucoidanase, which has a highly efficient degradation effect on fucoidan from different sources.

[0007] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The present invention provides a fucoidanase gene QAUFcn2 , QAUFcn2 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0008] Furthermore, the QAUFcn2 Genes from strains Flavobacterium sp. RC2-3 strain.

[0009] The present invention also provides a method for detecting the fucoidanase gene. QAUFcn2 The amplification primers are as follows: QAUFcn2-F: 5'-ATGCTAATAGGAATCGAATC-3'; QAUFcn2-R: 5'-TTTCTTTGATGAACTTCAGG-3'.

[0010] The present invention also provides the fucoidanase gene QAUFcn2 The encoded fucoidanase, the amino acid sequence of the fucoidanase is shown in SEQ ID No.2.

[0011] The present invention also provides a method comprising the fucoidanase gene QAUFcn2 of the recombinant vector.

[0012] Furthermore, the vector is a pET-22b (+) vector.

[0013] The present invention also provides a method comprising the fucoidanase gene QAUFcn2 of the recombinant strains.

[0014] Furthermore, the recombinant strain is Escherichia coli.

[0015] The present invention also provides the fucoidanase gene QAUFcn2 Or the use of the fucoidanase in degrading fucoidan from different sources.

[0016] Furthermore, the fucoidanase gene QAUFcn2 The encoded fucoidanase degrades fucoidan by degrading the α-1,4 glycosidic bonds in fucoidan.

[0017] Furthermore, the fucoidanase can degrade fucoidan derived from Carrageenan, fucoidan derived from Sargassum fusiformis, and fucoidan derived from Fucus vesiculosus.

[0018] Furthermore, K + , Ca 2+ It has an activating effect on the fucoidanase.

[0019] Furthermore, the fucoidan solution needs to be dissolved in advance using a solution containing metal ions, and the final concentration of the metal ions is 1 mmol / L.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1. The present invention obtains a fucoidanase gene QAUFcn2The genome bioinformatics analysis was performed on it, and the sequence was compared with the reported fucoidanase. A phylogenetic tree was constructed with other identified fucoidanase. Fcn2 was grouped together with Mef1, P5AFcnA, and P19DFcnA. The Mef1 fucoidanase had the highest homology with Fcn2.

[0021] 2. The present invention further obtains QAUFcn2 Genetic recombinant strains have achieved QAUFcn2 The heterologous expression of the gene was used to obtain heterologous expressed fucoidanase, and the enzyme activity was proved to be good, and it has the ability to degrade fucoidan from different sources. The above results not only enriched the fucoidanase gene family, but also laid a foundation for further clarifying the catalytic mechanism of fucoidanase, which is helpful to promote the development and utilization of fucoidan resources, and have important theoretical value and production guidance significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is the QAUFcn2 protein homologous sequence alignment and conserved motif map.

[0023] Figure 2 for QAUFcn2 Phylogenetic relationship diagram of the amino acid sequence encoded by the gene and the existing fucoidanase amino acid sequence.

[0024] Figure 3 The family classification diagram of fucoidanase QAUFcn2 in the CAZy database was determined based on the phylogenetic tree.

[0025] Figure 4 This is the agarose gel electrophoresis result of Q5 super-fidelity enzyme PCR amplification gene.

[0026] Figure 5 The results of DNA fragment recovery by agarose gel electrophoresis.

[0027] Figure 6 Build process for seamless cloning.

[0028] Figure 7 The colonies were grown on LB plates containing ampicillin resistance.

[0029] Figure 8 Agarose gel electrophoresis verification of positive transformants.

[0030] Fig. 9 This is the SDS-PAGE gel electrophoresis picture.

[0031] Fig.10 The figure shows the enzyme activity results.

[0032] Fig.11 Agarose gel electrophoresis. DETAILED DESCRIPTION

[0033] The technical solution of the present invention is further described in detail with reference to the following specific examples.

[0034] In the following examples, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0035] Culture medium configuration: LB medium (w / v): 0.5% yeast powder, 1.0% tryptone, 1.0% NaCl, if solid medium, add 2.0% agar. Prepare with distilled water, sterilize at 121℃ for 20 min, cool to room temperature, add ampicillin (Amp) at a final concentration of 100.0 μg / mL.

[0036] Embodiment 1: QAUFcn2 Gene acquisition A marine bacterium that can degrade fucoidan was obtained from kelp Flavobacterium sp.RC2-3 strain was cultured with fucose and fucoidan as the sole carbon source, and differential metabolomics analysis was performed to screen genes that were significantly upregulated in the fucoidan treatment group compared with the fucose treatment group. Table 1 shows the information of the currently reported fucoidanase genes. The significantly upregulated genes were compared with the fucoidanase genes published in the NCBI database. A fucoidanase gene was found in the RC2-3 strain. QAUFcn2 , and Flavobacterium sp. RC2-3 strain QAUFcn2 The amino acid sequence encoded by the gene was compared with the amino acid sequence corresponding to the reported fucoidanase gene found in the literature in Table 1 using MEGA 7.0 software, and the evolutionary tree was constructed and analyzed using the Neighbor-Joining method.

[0037] Table 1 Reported fucoidanase

[0038] The results are as follows Figure 1-3 As shown in the figure, a phylogenetic tree was constructed with QAUFcn2 and other identified fucoidanase. Fcn2 was grouped with Mef1, P5AFcnA, and P19DFcnA. The Mef1 fucoidanase had the highest homology with QAUFcn2. QAUFcn2 The amino acid sequence encoded by the gene Mef1 The results of conservative sequence analysis of the amino acid sequence encoded by the gene, QAUFcn2 Gene-encoded proteins Mef1The protein encoded by the gene belongs to the same GH107 family of fucoidanase. Sequence alignment showed the presence of conserved RxxxxxDxxxxD, DxxxGH motifs. It is predicted that the catalytic site residues of GH107 fucoidanase include a conserved histidine (His276 in P5AFcnA and His270 in Mef1) and an aspartic acid (Asp201 in P5AFcnA and Asp187 in Mef1), which act as acid / base catalysts and possible nucleophiles, respectively. This family member can cleave the α-1,4-L-fucosidic bond in sulfated fucoidan composed of alternating 1,3- and 1,4-linked α-L-pyranose residues. QAUFcn2 The nucleotide sequence of the gene is shown as SEQ ID No.1, and the amino acid sequence of the fucoidanase encoded by the gene is shown as SEQ ID No.2.

[0039] Embodiment 2: QAUFcn2 Gene cloning 1. Flavobacterium sp. RC2-3 strain genome extraction extract Flavobacterium sp. RC2-3 strain genome, take the cultured Flavobacterium sp.RC2-3 bacterial solution was used to extract bacterial genomic DNA using a kit according to the instructions of the bacterial genomic DNA extraction kit of TIANGEN Company, and the extracted genomic DNA was determined by agarose gel electrophoresis.

[0040] 2. QAUFcn2 Gene primer design With the help of the SnapGene Viewer tool, primers were designed based on the gene sequence, restriction site and gene sequence of QAUFcn2 of the pET-22b (+) plasmid.

[0041] According to the principle of seamless cloning technology, primers were designed according to the primer design principles. The primer sequences are as follows: Fcn2-pET-F: 5'- CGGAGCTCGAATTCGGATCCATGCTAATAGGAATCG -3' (SEQ IDNo. ​​3); Fcn2-pET-R: 5'-CGGAATTAATTCGGATCCTTCTTTGATGAACTTC-3' (SEQ ID No. 4).

[0042] 3. Q5 ultra-fidelity DNA polymerase PCR amplification Use a gradient PCR instrument to set up multiple different temperature gradients for Q5 high-fidelity DNA polymerase Fcn2Gene amplification preliminary experiment to determine the appropriate annealing temperature. The PCR amplification program was as follows: pre-denaturation at 98 °C for 30 s; denaturation at 94 °C for 10 s, annealing at 50 °C for 15 s, and extension at 72 °C for 1 min, for 30 cycles; and extension at 72 °C for 5 min.

[0043] After PCR, agarose gel electrophoresis was used to verify Fcn2 Gene.

[0044] Agarose gel electrophoresis confirmed the results. Figure 4 As shown, Fcn2 The size of the gene amplified fragment was 1899 bp.

[0045] 4. Agarose gel DNA recovery The agarose gel containing the target DNA fragment was cut under ultraviolet light, and the target DNA fragment was recovered using the kit according to the instructions of TIANGEN's agarose gel DNA recovery kit. After recovery, agarose gel electrophoresis was performed to verify and determine the recovery concentration.

[0046] The recovery results are as follows Figure 5 As shown, the recycling QAUFcn2 The gene fragment is correct.

[0047] 5. Construction of QAUFcn2-pET-22b (+) vector The QAUFcn2-pET-22b (+) expression vector was constructed using seamless cloning technology. The specific construction process can be found in Figure 6 . According to the instructions of the operating manual, calculate the required ratio of the recombination system according to the concentration of the recovered target gene Fcn2 and the linear vector, and then accurately prepare the reaction system according to the calculated results. After fully mixing the components, perform low-speed centrifugation to concentrate the reaction solution to the bottom of the centrifuge tube. Then, perform the ligation reaction in a 50℃ water bath for 30 minutes. The specific reaction system can be found in the table.

[0048]

[0049] 6. Transformation of recombinant plasmid (1) Take out a tube of fresh or frozen DH5α competent cells and place it on ice for 5 min to thaw the competent cells.

[0050] (2) Take 10 μL of cooled QAUFcn2 -pET-22b (+) recombinant plasmid was added to 100 μL competent cells, the tube was flicked several times to mix, and the tube was placed on ice for 20 min.

[0051] (3) Heat shock the centrifuge tube in a water bath preheated to 42°C for 60 seconds. Quickly and smoothly transfer the centrifuge tube to ice and place it on ice for 3 minutes.

[0052] (4) Add 500 μL of antibiotic-free LB medium, mix well, transfer to a 37°C shaker, and incubate at 200 rpm for 60 min.

[0053] (5) Centrifuge the bacterial solution to remove the supernatant, take 50 μL of the resuspended bacteria, evenly spread it on a solid LB plate containing ampicillin at a final concentration of 100 μg / mL and invert it. Incubate it in a 37°C constant temperature incubator for 12-16 h. The recombinant strain grew on the LB plate containing 100 μg / mL ampicillin resistance, while the original strain DH5α could not grow on the LB plate due to the lack of the ampicillin resistance gene. The pLB vector itself contains a lethal gene that is not connected. Fcn2 The empty plasmid recombinant strain of the gene cannot grow, and the final growth result is as follows Figure 7 shown.

[0054] Pick a single colony grown on the plate and inoculate it into LB liquid medium containing ampicillin at a final concentration of 100 μg / mL, and culture it at 37°C, 180 rpm for 6-8 h. After preserving the positive transformant liquid, use the plasmid extraction kit of TIANGEN Company to extract the plasmid, and send the extracted plasmid to Qingdao Qingke Biotechnology Co., Ltd. for sequencing. QAUFcn2 Gene sequences were compared and verified.

[0055] 7. Screening of positive transformants Pick the grown colonies and inoculate them into LB liquid medium containing 100 μg / mL ampicillin. Incubate at 37°C, 180 rpm for 6-8 h for colony PCR verification. The PCR reaction system is as follows:

[0056] PCR amplification conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 2 min, 30 cycles; and extension at 72 °C for 5 min.

[0057] The results are as follows Figure 8 As shown in the figure, the presence of a band between 1500 bp and 2000 bp in the colony indicates that it contains QAUFcn2 If there is no band between 1500 bp and 2000 bp, it proves that it does not contain QAUFcn2 Gene is a false positive.

[0058] The obtained positive transformant bacterial liquid was preserved and the plasmid was extracted using the plasmid extraction kit of TIANGEN Company. The extracted plasmid was sent to Qingdao Qingke Biotechnology Co., Ltd. for sequencing. QAUFcn2 The gene sequence was compared and verified. The plasmid verification result was correct and it could be used for the next experiment.

[0059] 8. E. coli transformation The verified recombinant E. coli strain was inoculated into 5 mL of LB liquid medium containing ampicillin at a final concentration of 100 μg / mL, and cultured overnight at 37°C and 200 rpm to obtain seed liquid. The recombinant plasmid was extracted using the plasmid extraction kit of Tiangen Biochemical Technology Co., Ltd., and the recovery concentration was determined. The extracted recombinant plasmid was transformed into E. coli BL21 (DE3) for protein expression. The transformation steps are as follows: (1) Take 50 μL of BL21 competent cells and place them on ice to thaw. This will take about 5 minutes.

[0060] (2) Add 5 μL of BL21 competent cell suspension QAUFcn2 -pET-22b (+) recombinant plasmid. Gently rotate the centrifuge tube to mix the cells and plasmid, and place on ice for 30 min.

[0061] (3) Heat shock the centrifuge tube in a 42°C water bath for 90 seconds, then quickly and steadily transfer the tube to an ice bath for 3 minutes.

[0062] (4) Add 450 μL of sterile, antibiotic-free LB medium to the centrifuge tube and incubate at 37 °C, 180 rpm, and shake for 45 min to allow the relevant resistance marker gene on the plasmid to be expressed and the bacteria to recover.

[0063] (5) Take 100 μL of the transformed competent cells and spread them on LB plates containing ampicillin at a final concentration of 100 μg / mL, and incubate them inverted at 37°C for 12-16 h.

[0064] Embodiment 3: QAUFcn2 Preliminary study on gene induction expression and catalytic substrate specificity 1. E. coli induced expression (1) Inoculate the verified recombinant E. coli strain into 5 mL of LB liquid culture medium containing ampicillin, and culture overnight at 37°C and 200 r / min to obtain seed solution; (2) Transfer the seed solution to 50 mL LB liquid medium containing ampicillin at a 1% inoculum volume and culture at 37°C and 200 rpm until the OD600 reaches 1.0-2.0; (3) Add IPTG to a final concentration of 0.2 mM and culture at 16 °C, 200 r / min for 12-16 h to induce protein expression; (4) Collect the cells by centrifugation at 5000 r / min and 4°C for 20 min, disrupt the cells by ultrasound, and centrifuge at 12000 r / min for 30 min. Take the supernatant after ultrasound disruption and perform SDS-PAGE to determine whether the protein is expressed in a soluble form.

[0065] 3. SDS-PAGE gel electrophoresis Sample preparation: Mix the protein sample with 5× sample buffer in an Eppendorf tube, heat at 100°C for 10 min, and take the supernatant for spotting.

[0066] Preparation of separation gel and concentration gel: clean the glass plate, sample comb and spacer with detergent, rinse with ddH2O several times, wipe with ethanol and dry.

[0067] Place a spacer between two cleaned glass plates and install the glass plates according to the instructions in the Bio-Rad Mini lI / II manual.

[0068] The gel used for SDS-PAGE electrophoresis was prepared according to the following system:

[0069] First, pour the separation gel between the glass plates. After the pouring is completed, immediately cover a layer of anhydrous ethanol. After about 20 minutes, the gel polymerizes. After the separation gel polymerizes, pour off the upper layer of anhydrous ethanol, pour the concentrated gel, insert the sample comb, and wait for the gel to solidify. After the gel is completely solidified, install the electrophoresis system, add the electrode buffer, and load 20 μL; stabilize the voltage at 200 V, and stop the electrophoresis when the bromophenol blue just runs out of the separation gel, which takes about 45 min to 60 min. Remove the gel plate, put the stripped gel into the staining solution, and stain at room temperature for 1 to 2 h; add the decolorizing solution, place it on a decolorizing shaker at 80 rpm, and replace the decolorizing solution (10 mL glacial acetic acid; 45 mL ethanol; 45 mL distilled water) every 20 min until it is completely decolorized.

[0070] Test results such as Fig. 9 As shown by QAUFcn2 The gene guide encodes a protein with a predicted size of 70 kDa.

[0071] 4. Crude enzyme extraction The fermentation broth at the end of fermentation was dispensed into centrifuge tubes and centrifuged at 4°C and 5000 r / min for 15 min. The bacteria were collected by centrifugation at 5000 rpm for 5 min, resuspended in an appropriate amount of pre-cooled NTA-0 buffer, and ultrasonically disrupted in an ice bath with the parameters set to 200 W power, 3 s working, 4 s pause, and 8 min time; the working interval was 5 s. After the end, the tubes were centrifuged at 4°C and 10000 r / min for 10 min to obtain the supernatant to obtain the crude enzyme solution.

[0072] 5. Enzyme substrate specificity analysis The substrate specificity of the QAUFcn2 enzyme was investigated by measuring enzyme activity and evaluating agarose gel electrophoresis results of different fucoidans extracted from different species of brown algae.

[0073] Polysaccharide solutions were prepared by dissolving 10 mg of polysaccharide in 5 mL of Tris-HCl buffer (20 mM, pH 8.0) to prepare fucoidan solution (Mingyue Polysaccharide), Sargassum fusiformis fucoidan solution, Carrageenan fucoidan solution, Laminaria japonica fucoidan solution, Undaria pinnatifida fucoidan solution and Fucus vesiculosus fucoidan solution purchased from Qingdao Mingyue Seaweed Group Co., Ltd.

[0074] Take 2 mL of crude enzyme solution and boil it in a boiling water bath for 10 min to inactivate the enzyme. Prepare the reaction system according to the ratio of polysaccharide solution to inactivated enzyme solution / inactivated enzyme solution in a ratio of 1:1. Set up three parallel samples for the inactivated group and the inactivated group of each polysaccharide solution, and react in an incubator set at 30 °C and 120 r / min for 2 h.

[0075] Take 0.5 mL of the solution after the reaction is completed, add 0.5 mL of potassium ferrocyanide working solution, react in an 80 ℃ water bath for 15 min, cool to room temperature, add 2 mL of distilled water and mix, centrifuge at 10000 rpm for 10 min, take the supernatant and measure the absorbance at 420 nm. The blank is the absorbance measured with distilled water instead of the sample, and the enzyme activity is calculated.

[0076] The preparation method of agarose gel is as described above, except that Sparkred does not need to be added when the gel is cooled to 60°C. The reaction solution after the enzymatic hydrolysis reaction and the polysaccharide solution under the same treatment conditions are subjected to 1% agarose gel electrophoresis. After the electrophoresis, the gel is removed and stained with toluidine blue staining solution for 1 hour, and then decolorized with a decolorizing solution. The decolorizing solution is replaced every half an hour. After 3 times, it is decolorized overnight with clean water.

[0077] The enzyme activity results were Fig.10 As shown, the description QAUFcn2The genetically encoded fucoidanase has no ability to degrade kelp fucoidan and undaria fucoidan, and cannot produce a large amount of reducing sugar to react with potassium ferrocyanide, resulting in the enzyme activity being 0. QAUFcn2 The enzyme encoded by the gene has a significant degradation ability for fucoidan from Acropora foetida, Fucus fusiformis and Fucus vesiculosus, producing a large amount of reducing sugars that react with potassium ferrocyanide.

[0078] The electrophoresis results are as follows Fig.11 As shown. Lane 1 is Mingyue fucoidan, and lane 2 is the enzymatic hydrolysis product of Mingyue fucoidan; lane 3 is Fucus fucoidan, and lane 4 is the enzymatic hydrolysis product of Fucus fucoidan; lane 5 is Sargassum fucoidan, and lane 6 is the enzymatic hydrolysis product of Sargassum fucoidan; lane 7 is Carrageenan fucoidan, and lane 8 is the enzymatic hydrolysis product of Carrageenan fucoidan. Polysaccharides have different molecular weights and different mobilities in gel electrophoresis. The band of enzymatic polysaccharide migrates further downward than the band of fucoidan, and the color of the upper half of the band after enzymatic polysaccharide hydrolysis is lighter than that of the fucoidan band, indicating that after enzymatic hydrolysis of fucoidan, the high molecular weight components are reduced and the low molecular weight fucoidan increases.

[0079] The above analysis shows that the fucoidanase QAUFcn2 has obvious degradation ability on fucoidan from different sources.

[0080] 6. Effect of metal ions on enzyme activity Use 20mM buffer to dissolve the metal ions K⁺, Ca²⁺, Mg²⁺, Zn²⁺, Cu²⁺, Hg²⁺, and Mn²⁺, respectively, to ensure that each metal ion is evenly distributed in the solution and reaches the required concentration. Measure the purified enzyme solution and mix it with the fucoidan solution. It should be noted here that the fucoidan solution needs to be dissolved in advance with a solution containing different metal ions to ensure that the final concentration of metal ions in the enzyme-catalyzed reaction system is 1 mmol / L. Subsequently, the enzyme activity of each reaction system containing different metal ions is measured separately. In order to accurately evaluate the effect of metal ions on enzyme activity, the enzyme activity of the reaction system without the addition of metal ions is set as the baseline value (i.e., 100%), and the relative enzyme activity under each metal ion condition is calculated accordingly. In order to ensure the reliability and accuracy of the experimental results, each experimental condition needs to be repeated three times, and the obtained data are statistically analyzed.

[0081] The experimental results are shown in Table 2. + , Ca 2+ The enzyme is activated by Ca 2+ When present, the activation effect is the strongest, and the relative enzyme activity reaches 171.04%. Other ions have different inhibitory effects on the enzyme, among which Cu 2+ The inhibitory effect was the strongest, with the relative enzyme activity being only 51.86%.

[0082] Table 2 Effects of metal ions on the activity of fucoidanase

[0083] Fucoidanase is an endohydrolase that specifically acts on the glycosidic bonds in sulfated fucoidan. 16 endo-α-1,4-fucoidanase (EC 3.2.1.212) and 3 endo-α-1,3-fucoidanase (EC 3.2.1.211) have been reported in the GH107 family. A phylogenetic tree was constructed based on the type of hydrolyzed glycosidic bonds. The results are as follows: Figure 3 As shown, the QAUFcn2 protein is on the same branch as the fucoidanase Mef1, P5AFcnA and P19DFcnA that degrade α-1,4-L-fucosidic bonds. This result indicates that the fucoidanase QAUFcn2 has the ability to degrade α-1,4-L-fucosidic bonds.

[0084] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A Fucoidanase gene QAUFcn2 , characterized in that, Said QAUFcn2 The nucleotide sequence of the gene is shown as SEQ ID No.

1.

2. The fucoidanase gene according to claim 1 QAUFcn2 The amplification primer is characterized in that The sequences of the amplification primers are: QAUFcn2-F: 5'-ATGCTAATAGGAATCGAATC-3'; QAUFcn2-R: 5'-TTTCTTTGATGAACTTCAGG-3'.

3. The fucoidanase gene according to claim 1 QAUFcn2 The encoded fucoidanase is characterized in that The amino acid sequence of the fucoidanase is shown in SEQ ID No.

2.

4. Containing the fucoidanase gene according to claim 1 QAUFcn2 of the recombinant vector.

5. Containing the fucoidanase gene according to claim 1 QAUFcn2 of the recombinant strains.

6. The fucoidanase gene according to claim 1 QAUFcn2 Or the use of the fucoidanase according to claim 3 in degrading fucoidan.

7. The use according to claim 6, characterized in that: The fucoidanase degrades fucoidan by degrading α-1,4 glycosidic bonds in fucoidan.

8. The use according to claim 6, characterized in that: The fucoidanase can degrade fucoidan derived from Carrageenan, fucoidan derived from Sargassum fusiformis and fucoidan derived from Fucus vesiculosus.

9. The use according to claim 6, characterized in that: K + , Ca 2+ It has an activating effect on the fucoidan enzyme.

10. The use according to claim 6, characterized in that: The fucoidan solution needs to be dissolved in advance using a solution containing metal ions, and the final concentration of the metal ions is 1 mmol / L.

Images