A fucanase gene QAUFcn2 and application thereof in degrading fucan

By providing the fucoidanase gene QAUFcn2 and its heterologous expression in Escherichia coli, the problems of low enzyme yield and poor enzyme activity of existing fucoidanases have been solved, achieving efficient degradation of fucoidan from different sources and promoting the preparation of fucoidan oligosaccharides and the development of functional products.

CN119842759BActive Publication Date: 2025-11-04QINGDAO AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510114138.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-24
Publication Date
2025-11-04
Estimated Expiration
2045-01-24

AI Technical Summary

Technical Problem

The existing fucoidan enzymes have low production rates and poor enzyme activity, making it difficult to commercialize them. Furthermore, there is insufficient research on the molecular structure analysis of fucoidan and the preparation of low molecular weight fucoidan oligosaccharides.

Method used

We provide the fucoidanase gene QAUFcn2 and its encoded enzyme, and achieve efficient degradation of fucoidan from different sources through heterologous expression in Escherichia coli. We utilize the GH107 family of fucoidanases to specifically hydrolyze α-glycosidic bonds, combined with the activation effect of metal ions, and optimize culture conditions to enhance enzyme activity.

Benefits of technology

This study achieved efficient degradation of fucoidan from different sources, enriched the research on the fucoidan enzyme gene family, laid the foundation for the development and utilization of fucoidan resources, and promoted the development of functional foods and drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842759B_ABST
    Figure CN119842759B_ABST
Patent Text Reader

Abstract

The application provides a fucoidanase gene QAUFcn2 and application thereof in degrading fucoidan, wherein the nucleotide sequence of the fucoidanase gene is shown as SEQ ID No. 1, and the amino acid sequence of the fucoidanase produced is shown as SEQ ID No. 2. The application also obtains a recombinant strain of the gene, QAUFcn2 achieves heterologous expression of the gene, QAUFcn2 obtains the heterologously expressed fucoidanase, and proves that the enzyme has the ability to degrade fucoidan from different sources. The application not only enriches the fucoidanase gene family, lays a foundation for further elucidating the catalytic mechanism of fucoidanase, helps to promote the development and utilization of fucoidan resources, and has important theoretical value and production guiding significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene technology, specifically relating to a fucoidanase gene. QAUFcn2 And its application in the degradation of fucoidan. Background Technology

[0002] Fucoidan, also known as fucoidan, fucoidan sulfate, and fucoidan sulfate, is a functional marine polysaccharide with various physiological effects. It is a large class of pure, natural, anionic, high-molecular-weight, water-soluble heteropolysaccharides extracted from seaweed, possessing multiple biological functions such as anticoagulation, antitumor, antithrombosis, antiviral, and antioxidant properties. Fucoidan mainly originates from brown algae, specifically from genera such as *Fucus*, *Laminaria*, and *Sargassum*. Currently, it is primarily extracted from brown algae such as *Fucus*, *Sargassum*, *Sargassum fusiforme*, giant kelp, kelp, wakame, and *Leptochloa crus-galli*. Besides brown algae, fucoidan also comes from some marine invertebrates, such as abalone, scallops, sea urchins, and snails. In invertebrates, fucoidan can be extracted from marine organisms such as sea cucumbers and sea urchins.

[0003] Fucoidan exhibits structural diversity in monosaccharide composition, glycosidic bond linkages, sulfation modifications, molecular weight, and substituents. Its main component, fucose, can coexist with other monosaccharides (such as galactose and mannose), and the glycosidic bond linkages include various types such as α-1,3, α-1,4, and α-1,2. Sulfate groups can be distributed on different carbon atoms of fucose, with the number and position varying depending on the source. Furthermore, fucose may contain substituents such as acetyl groups, further increasing structural complexity. Fucoidan from different sources also shows significant differences in molecular weight, degree of sulfation, and skeletal structure. This diversity and complexity endows it with unique advantages in biological activity and function. However, the complexity and diversity of fucose molecular structures lead to an unclear relationship between biological function and molecular structure, severely limiting the application of fucose in clinical medicine, health care, and food. Compared with high-molecular-weight fucose, low-molecular-weight fucoidan oligosaccharides show certain advantages in bioavailability and biological activity, possessing great application potential. Therefore, how to obtain low molecular weight fucoidan with multiple physiological functions by degrading natural high molecular weight fucoidan has attracted the attention of researchers at home and abroad.

[0004] Fucoidase is a key enzyme in the degradation of fucoidan. Due to the rich diversity of fucoidan, the bacterial strains that degrade fucoidan and the fucoidases they produce also vary. A total of 28 fucoidases have been reported and classified in the CAZY database. The complexity and diversity of fucoidan molecular structures determine the diversity of fucoidase types and functions. Currently reported fucoidase-producing strains suffer from low enzyme yield and poor enzyme activity. Current solutions mainly focus on optimizing culture media, culture conditions, and physical mutagenesis to increase enzyme yield or activity, but the effects are not significant, and the commercialization of fucoidase remains impossible. Current research on fucoidase mainly focuses on heterologous expression and basic enzymatic characterization; however, there is a lack of in-depth research on the related mechanisms and substrate specificity of fucoidase.

[0005] GH107 family fucoidans play a crucial role in the structural analysis of fucoidan and the preparation of fucoidan oligosaccharides. These enzymes specifically hydrolyze α-glycosidic bonds in fucoidan, degrading complex fucoidan into fucoidan oligosaccharides of varying degrees of polymerization through endo- or exo-cleavage. For example, the GH107 family enzyme MfFcnA hydrolyzes sulfated fucoidan, releasing structurally diverse fucoidan oligosaccharides and revealing the complex sulfation sites and branched structures of fucoidan. This enzymatic degradation method not only helps in elucidating the fine structure of fucoidan but also efficiently prepares bioactive fucoidan oligosaccharides, providing an important tool for developing novel functional foods and drugs. Compared to other families of fucoidans, GH107 family fucoidans can hydrolyze fucoidan from both brown algae and sea cucumber, demonstrating broad substrate adaptability that gives them an advantage in processing structurally complex and highly heterogeneous fucoidan. Summary of the Invention

[0006] The purpose of this invention is to provide a fucoidanase gene. QAUFcn2 And its application in the degradation of fucoidan. QAUFcn2 The gene can encode a fucoidanase, which has a highly efficient degradation effect on fucoidan from different sources.

[0007] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0008] This invention provides a fucoidanase gene. QAUFcn2 The QAUFcn2 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0009] Furthermore, the aforementioned QAUFcn2 Genes derived from strains Flavobacterium sp. RC2-3 strain.

[0010] The present invention also provides a method for detecting the aforementioned fucoidanase gene. QAUFcn2 The amplification primers, the sequences of which are:

[0011] QAUFcn2-F: 5'-ATGCTAATAGGAATCGAATC-3';

[0012] QAUFcn2-R: 5'-TTTCTTTGATGAACTTCAGG-3'.

[0013] The present invention also provides the fucoidanase gene. QAUFcn2 The encoded fucoidanase, the amino acid sequence of which is shown in SEQ ID No. 2.

[0014] The present invention also provides a fucoidanase gene containing the aforementioned fucoidanase. QAUFcn2 Recombinant carriers.

[0015] Furthermore, the carrier is a pET-22b (+) carrier.

[0016] The present invention also provides a fucoidanase gene containing the aforementioned fucoidanase. QAUFcn2 Recombinant strains.

[0017] Furthermore, the recombinant strain is Escherichia coli.

[0018] The present invention also provides the fucoidanase gene. QAUFcn2 Or the application of the fucoidanase in the degradation of fucoidan from different sources.

[0019] Furthermore, the fucoidanase gene QAUFcn2 The encoded fucoidanase degrades fucoidan by degrading the α-1,4 glycosidic bonds in fucoidan.

[0020] Furthermore, the fucoidanase can degrade fucoidan from *Sargassum fusiforme*, fucoidan from *Sargassum fusiforme*, and fucoidan from *Fucus vesiculosus*.

[0021] Furthermore, K + Ca 2+ It has an activating effect on the fucoidanase.

[0022] Furthermore, the fucoidan solution needs to be dissolved in a solution containing metal ions beforehand, with a final concentration of 1 mmol / L for the metal ions.

[0023] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0024] 1. This invention obtains a fucoidanase gene. QAUFcn2 Genomic bioinformatics analysis was performed on it, and the sequence was compared with that of previously reported fucoidanases. A phylogenetic tree was constructed with other identified fucoidanases. Fcn2 was grouped with Mef1, P5AFcnA, and P19DFcnA. The fucoidanase with the highest homology to Fcn2 was Mef1.

[0025] 2. The present invention further obtains QAUFcn2 Recombinant strains of genes have achieved QAUFcn2 Heterologous expression of the gene yielded a heterologous fucoidanase, and its enzymatic activity and ability to degrade fucoidan from different sources were demonstrated. These results not only enrich the fucoidanase gene family and lay the foundation for further elucidating the catalytic mechanism of fucoidanases, but also contribute to promoting the development and utilization of fucoidan resources, possessing significant theoretical value and production guidance. Attached Figure Description

[0026] Figure 1 This is a sequence alignment diagram and conserved pattern diagram of the QAUFcn2 protein homology sequence.

[0027] Figure 2 for QAUFcn2 A diagram showing the phylogenetic relationship between the amino acid sequence encoded by the gene and the amino acid sequences of existing fucoidanases.

[0028] Figure 3 To determine the family classification of fucoidanase QAUFcn2 in the CAZy database based on a phylogenetic tree.

[0029] Figure 4 The results of agarose gel electrophoresis of the Q5 superfidelity enzyme PCR amplification gene are shown.

[0030] Figure 5 Results of agarose gel electrophoresis recovery of DNA fragments.

[0031] Figure 6 For a seamless clone build process.

[0032] Figure 7 These are colonies grown on LB agar plates containing ampicillin resistance.

[0033] Figure 8 This is an agarose gel electrophoresis image verifying the positive transformants.

[0034] Figure 9 This is an image from an SDS-PAGE gel electrophoresis.

[0035] Figure 10 This is a graph showing the enzyme activity results.

[0036] Figure 11 This is an agarose gel electrophoresis image. Detailed Implementation

[0037] The technical solution of the present invention will be further described in detail with reference to the following specific examples.

[0038] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0039] Preparation of culture medium:

[0040] LB medium (w / v): 0.5% yeast extract, 1.0% tryptone, 1.0% NaCl. If using solid medium, add 2.0% agar. Prepare with distilled water, sterilize at 121℃ for 20 min, cool to room temperature, and then add ampicillin (Amp) to a final concentration of 100.0 μg / mL.

[0041] Example 1: QAUFcn2 Acquisition of genes

[0042] A marine bacterium capable of degrading fucoidan was screened from kelp. Flavobacterium strain sp. RC2-3 was cultured in media using fucose and fucoidan as the sole carbon source, respectively, followed by differential metabolomics analysis to screen for genes significantly upregulated in the fucoidan-treated group compared to the fucose-treated group. Table 1 shows the currently reported fucoidanase gene information. Significantly upregulated genes were compared with fucoidanase genes published in the NCBI database. One fucoidanase gene was found in strain RC2-3. QAUFcn2 and will Flavobacterium sp. RC2-3 strain QAUFcn2 The amino acid sequence of the gene-guided coding was compared with the amino acid sequences of the reported fucoidanase genes found in the literature in Table 1. The amino acid sequences were then compared with those of the gene-guided coding sequence using MEGA 7.0 software, and a phylogenetic tree was constructed and analyzed using the Neighbor-Joining method.

[0043] Table 1. Reported Fucoidanases

[0044]

[0045] The results are as follows Figure 1-3 As shown, a phylogenetic tree was constructed for QAUFcn2 and other identified fucoidanases. Fcn2 was grouped with Mef1, P5AFcnA, and P19DFcnA, while Mef1 fucoidanase showed the highest homology with QAUFcn2. QAUFcn2 The amino acid sequence encoded by the gene and Mef1 Results of conserved sequence analysis of the amino acid sequence encoded by the gene. QAUFcn2 Gene-encoded proteins and Mef1 The protein encoded by the gene belongs to the same GH107 family of fucosaccharases. Sequence alignment revealed the presence of conserved RxxxxxDxxxxD and DxxxGH motifs. It is predicted that the catalytic site residues of GH107 fucosaccharases include a conserved histidine (His276 in P5AFcnA and His270 in Mef1) and an aspartic acid (Asp201 in P5AFcnA and Asp187 in Mef1), which act as an acid / base catalyst and a possible nucleophile, respectively. This family member can cleave the α-1,4-L-fucoside bonds in sulfated fucose, which consists of alternating 1,3- and 1,4-linked α-L-pyranose fucose residues. QAUFcn2 The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the amino acid sequence of the fucopolysaccharide enzyme it encodes is shown in SEQ ID No. 2.

[0046] Example 2: QAUFcn2 Gene cloning

[0047] 1. Flavobacterium Genome extraction of sp. RC2-3 strain

[0048] extract Flavobacterium Genome of sp. RC2-3 strain, taken from well-cultured strains. Flavobacterium For sp. RC2-3 bacterial culture, bacterial genomic DNA was extracted using the kit according to the instructions of TIANGEN's bacterial genomic DNA extraction kit. The extracted genomic DNA was then analyzed by agarose gel electrophoresis.

[0049] 2. QAUFcn2 Gene primer design

[0050] Primers were designed using the SnapGene Viewer tool, based on the gene sequence and restriction sites of the pET-22b (+) plasmid and the gene sequence of QAUFcn2.

[0051] Based on the principles of seamless cloning technology, primers were designed according to primer design principles, and the primer sequences are as follows:

[0052] Fcn2-pET-F: 5'- CGGAGCTCGAATTCGGATCCATGCTAATAGGAATCG -3' (SEQ IDNo. ​​3);

[0053] Fcn2-pET-R: 5'-CGGAATTAATTCGGATCCTTCTTTGATGAACTTC-3' (SEQ ID No. 4).

[0054] 3. Q5 ultra-fidelity DNA polymerase PCR amplification

[0055] Using a gradient PCR instrument, multiple different temperature gradients were set for Q5 high-fidelity DNA polymerase. Fcn2 Preliminary gene amplification experiments were conducted to determine the appropriate annealing temperature.

[0056] The PCR amplification program was as follows: 98 °C pre-denaturation for 30 s; 94 °C denaturation for 10 s, 50 °C annealing for 15 s, 72 °C extension for 1 min, 30 cycles; 72 °C extension for 5 min.

[0057] Verification was performed by agarose gel electrophoresis after PCR. Fcn2 Gene.

[0058] The results of agarose gel electrophoresis verification are as follows: Figure 4 As shown, Fcn2 The gene amplification fragment is 1899 bp in size.

[0059] 4. Agarose gel DNA recovery

[0060] The agarose gel containing the target DNA fragment was cut under ultraviolet light, and the target DNA fragment was recovered using the kit according to the instructions of the TIANGEN agarose gel DNA recovery kit. After recovery, agarose gel electrophoresis was performed to verify and determine the recovery concentration.

[0061] The recycling results are as follows Figure 5 As shown, this proves the recycling QAUFcn2 The gene fragment is correct.

[0062] 5. Construction of QAUFcn2-pET-22b (+) vector

[0063] The QAUFcn2-pET-22b (+) expression vector was constructed using seamless cloning technology. For detailed construction procedures, please refer to [link to documentation / reference]. Figure 6 Following the instructions, the required ratio for the recombinant system was calculated based on the concentrations of the recovered target gene Fcn2 and the linear vector. The reaction system was then precisely prepared according to the calculation results. After thoroughly mixing all components, the reaction solution was collected at the bottom of the centrifuge tube by low-speed centrifugation. Subsequently, the ligation reaction was carried out in a 50°C water bath for 30 minutes. The specific reaction system can be found in the table.

[0064]

[0065] 6. Transformation of recombinant plasmids

[0066] (1) Take out a tube of fresh or frozen DH5α competent cells and place it on ice for 5 min to thaw the competent cells.

[0067] (2) Take 10 μL of cooled QAUFcn2 Add the -pET-22b (+) recombinant plasmid to 100 μL of competent cells, gently tap the tube wall a few times to mix, and place on ice for 20 min.

[0068] (3) Place the centrifuge tubes in a water bath preheated to 42°C for 60 seconds for heat shock, and then quickly and smoothly transfer the centrifuge tubes to ice for 3 minutes for ice bath.

[0069] (4) Add 500 μL of antibiotic-free LB medium, mix well, transfer to a shaker at 37°C, and incubate at 200 rpm for 60 min.

[0070] (5) Centrifuge the bacterial culture to remove the supernatant, take 50 μL to resuspend the bacterial cells, spread evenly on LB solid plates containing ampicillin at a final concentration of 100 μg / mL, invert the plates, and incubate at 37℃ for 12-16 h. Recombinant strains grew on LB plates containing 100 μg / mL ampicillin resistance, while the original strain DH5α could not grow on LB plates due to the lack of the ampicillin resistance gene. The pLB vector itself contained a lethal gene that was not ligated. Fcn2 The recombinant strain with the empty plasmid of the gene could not grow, and the final growth result was as follows. Figure 7 As shown.

[0071] Single colonies grown on plates were picked and inoculated into LB liquid medium containing ampicillin at a final concentration of 100 μg / mL. The culture was incubated at 37 ℃ and 180 rpm for 6-8 h. After preserving the positive transformants, plasmids were extracted using a plasmid mini-prep kit from TIANGEN. The extracted plasmids were sent to Qingdao Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were then compared with... QAUFcn2 Gene sequences were compared and verified.

[0072] 7. Screening of positive transformants

[0073] Select the grown colonies and inoculate them into LB liquid medium containing 100 μg / mL ampicillin. Incubate at 37 ℃ and 180 rpm for 6-8 h for colony PCR verification. The PCR reaction system is as follows:

[0074]

[0075] PCR amplification conditions: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 55 ℃ annealing for 30 s, 72 ℃ extension for 2 min, 30 cycles; 72 ℃ extension for 5 min.

[0076] The results are as follows Figure 8 As shown in the figure, the presence of bands between 1500 bp and 2000 bp in the colonies indicates that they contain [the bacteria / organisms]. QAUFcn2 If a gene is a positive transformant and no band is found between 1500 bp and 2000 bp, it indicates that the gene does not contain [a specific gene]. QAUFcn2 The gene test result was a false positive.

[0077] After preserving the obtained positive transformant bacterial culture, plasmids were extracted using a plasmid miniprep kit from TIANGEN. The extracted plasmids were then sent to Qingdao Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were then compared with... QAUFcn2 The gene sequence was compared and verified. The plasmid verification result was correct, and it can be used for the next step of the experiment.

[0078] 8. Escherichia coli transformation

[0079] The validated recombinant *E. coli* strain was inoculated into 5 mL of LB broth containing ampicillin at a final concentration of 100 μg / mL and cultured overnight at 37°C and 200 rpm to obtain a seed culture. Recombinant plasmids were extracted using a plasmid mini-prep kit from Tiangen Biotech Co., Ltd., and the recovery concentration was determined. The extracted recombinant plasmids were transformed into *E. coli* BL21(DE3) for protein expression. The transformation steps are as follows:

[0080] (1) Take 50 μL of BL21 competent cells and place them on ice to thaw, which takes about 5 minutes.

[0081] (2) Add 5 μL to the BL21 competent cell suspension QAUFcn2 -pET-22b (+) recombinant plasmid. Gently rotate the centrifuge tube to mix the cells and plasmid, and incubate on ice for 30 min.

[0082] (3) Place the centrifuge tubes in a 42 ℃ water bath for 90 s heat shock, and then quickly and steadily transfer them to an ice bath for 3 min.

[0083] (4) Add 450 μL of sterile, antibiotic-free LB medium to the centrifuge tube and incubate at 37 °C and 180 rpm for 45 min with shaking. This will allow the expression of the relevant resistance marker gene on the plasmid and revive the bacteria.

[0084] (5) Take 100 μL of transformed competent cells and spread them on LB plates containing ampicillin at a final concentration of 100 μg / mL. Incubate at 37°C upside down for 12-16 h.

[0085] Example 3: QAUFcn2 Preliminary investigation on gene-induced expression and catalytic substrate specificity

[0086] 1. Escherichia coli induced expression

[0087] (1) The recombinant strain of Escherichia coli obtained from the verification was inoculated into 5 mL of liquid medium containing ampicillin LB and cultured overnight at 37°C and 200 r / min to obtain seed culture;

[0088] (2) Transfer the seed culture to 50 mL of LB liquid medium containing ampicillin at an inoculation rate of 1%, and incubate at 37 °C and 200 r / min until the OD600 reaches 1.0-2.0;

[0089] (3) Add IPTG to a final concentration of 0.2 mM and incubate at 16 ℃ and 200 r / min for 12-16 h to induce protein expression;

[0090] (4) Collect bacterial cells by centrifugation at 5000 r / min and 4 ℃ for 20 min, sonicate the bacterial cells, centrifuge at 12000 r / min for 30 min, and take the supernatant after sonication of the bacterial cells for SDS-PAGE detection to determine whether the protein is expressed in soluble form.

[0091] 3. SDS-PAGE gel electrophoresis

[0092] Sample preparation: Mix the protein sample with 5× sample buffer in an Eppendorf tube, heat at 100°C for 10 min, and then collect the supernatant for spotting.

[0093] To prepare the separating and stacking gels, the glass plate, sample comb, and spacer were washed with detergent, rinsed several times with ddH2O, wiped with ethanol, and then air-dried.

[0094] Insert the Spacer between the two clean glass plates and install the glass plates according to the instructions in the Bio-Rad Mini 1I / II manual.

[0095] Prepare the gel for SDS-PAGE electrophoresis according to the following system:

[0096]

[0097] First, pour the separating gel between the glass plates. Immediately after pouring, cover with a layer of anhydrous ethanol. After about 20 minutes, the gel polymerizes. After polymerization, pour off the top layer of anhydrous ethanol, pour the stacking gel, insert the sample comb, and wait for the gel to solidify. Once the gel has completely solidified, assemble the electrophoresis system, add electrode buffer, and load 20 μL of sample. Maintain a stable voltage of 200 V. Stop electrophoresis when the bromophenol blue just starts to run off the separating gel, which takes about 45 to 60 minutes. Remove the gel plates, place the stripping gel in staining solution, and stain at room temperature for 1 to 2 hours. Add destaining solution and place on an 80 rpm destaining shaker. Change the destaining solution (10 mL glacial acetic acid; 45 mL ethanol; 45 mL distilled water) every 20 minutes until completely removed.

[0098] Test results as follows Figure 9 As shown, by QAUFcn2 The predicted size of the gene-guided encoded protein is 70 kDa.

[0099] 4. Crude enzyme extraction

[0100] The fermentation broth after fermentation was aliquoted into centrifuge tubes and centrifuged at 4 ℃ and 5000 r / min for 15 min. The cells were then collected by centrifuging at 5000 rpm for 5 min and resuspended in an appropriate amount of pre-cooled NTA-0 buffer. The cells were then sonicated in an ice bath with the following parameters: power 200 W, working time 3 s, pause time 4 s, time 8 min, and working interval 5 s. After the operation was completed, the cells were centrifuged at 4 ℃ and 10000 r / min for 10 min, and the supernatant was collected to obtain the crude enzyme solution.

[0101] 5. Enzyme substrate specificity analysis

[0102] The substrate specificity of the QAUFcn2 enzyme was investigated by measuring enzyme activity and evaluating agarose gel electrophoresis results of different fucoidan extracted from different species of brown algae.

[0103] Prepare polysaccharide solutions by dissolving 10 mg of polysaccharide in 5 mL of Tris-HCl buffer (20 mM, pH 8.0) for fucoidan (Mingyue polysaccharide), Sargassum fusiforme fucoidan, Caryota spp. fucoidan, Kelp fucoidan, Undaria pinnatifida fucoidan, and Fucus vesiculosus fucoidan, all purchased from Qingdao Mingyue Seaweed Group Co., Ltd.

[0104] Take 2 mL of crude enzyme solution and boil it in a boiling water bath for 10 min to inactivate the enzyme. Prepare the reaction system according to the polysaccharide solution and the inactivated enzyme solution / non-inactivated enzyme solution in a 1:1 ratio. Set up three parallel samples for each polysaccharide solution in both the inactivated and non-inactivated groups. React in an incubator with the conditions set at 30 ℃ and 120 r / min for 2 h.

[0105] After the reaction was completed, 0.5 mL of the solution was added to 0.5 mL of potassium ferricyanide working solution. The mixture was reacted in an 80 °C water bath for 15 min. After cooling to room temperature, 2 mL of distilled water was added and mixed. The mixture was centrifuged at 10,000 rpm for 10 min. The absorbance of the supernatant was measured at 420 nm. The blank was the absorbance measured with distilled water instead of the sample. The enzyme activity was calculated.

[0106] The preparation method of agarose gel is as described above. The difference is that Sparkred does not need to be added when the gel is cooled to 60°C. Take the reaction solution after enzymatic hydrolysis and the polysaccharide solution under the same treatment conditions for 1% agarose gel electrophoresis. After electrophoresis, remove the gel and stain it with toluidine blue staining solution for 1 hour. Then destain it with destaining solution. Change the destaining solution every half hour. After 3 times, destain it overnight with water.

[0107] Enzyme activity results as follows Figure 10 As shown, this illustrates QAUFcn2 The gene-encoded fucoidanase has no ability to degrade fucoidan from kelp and wakame seaweed, and cannot produce a large amount of reducing sugar to react with potassium ferricyanide, resulting in an enzyme activity of 0. QAUFcn2 The gene-encoded enzyme has a significant ability to degrade fucoidan from *Sargassum fusiforme*, fucoidan from *Sargassum fusiforme*, and fucoidan from *Fusarium oxysporum*, producing a large amount of reducing sugars that react with potassium ferricyanide.

[0108] Electrophoresis results as follows Figure 11 As shown in the diagram. Lane 1 contains *Fucoidan* polysaccharide, lane 2 contains enzymatic hydrolysis products of *Fucoidan* polysaccharide; lane 3 contains *Fusarium oxysporum* fucoidan, lane 4 contains *Fusarium oxysporum* fucoidan hydrolysis products; lane 5 contains *Sargassum fusiforme* fucoidan, lane 6 contains *Sargassum fusiforme* fucoidan hydrolysis products; lane 7 contains *Ceratophyllum demersum* fucoidan, lane 8 contains *Ceratophyllum demersum* fucoidan hydrolysis products. The different molecular weights of the polysaccharides result in different migration rates in gel electrophoresis. The bands of enzymatically hydrolyzed polysaccharides migrated further downwards than those of fucoidan, and the upper half of the enzymatically hydrolyzed polysaccharide band was lighter in color than the fucoidan band, indicating that enzymatic hydrolysis of fucoidan reduced the high molecular weight components and increased the low molecular weight components.

[0109] The above analysis shows that the fucoidanase QAUFcn2 has a significant degradation ability for fucoidan from different sources.

[0110] 6. The effect of metal ions on enzyme activity

[0111] Metal ions K⁺, Ca²⁺, Mg²⁺, Zn²⁺, Cu²⁺, Hg²⁺, and Mn²⁺ were dissolved separately using 20 mM buffer to ensure uniform distribution and reach the desired concentration in the solution. The purified enzyme solution was then mixed with the fucoidan solution. It is important to note that the fucoidan solution must be pre-dissolved in solutions containing different metal ions to ensure a final metal ion concentration of 1 mmol / L in the enzyme-catalyzed reaction system. Subsequently, enzyme activity was measured for each reaction system containing different metal ions. To accurately assess the effect of metal ions on enzyme activity, the enzyme activity of the reaction system without added metal ions was set as the baseline (i.e., 100%), and the relative enzyme activity under each metal ion condition was calculated accordingly. To ensure the reliability and accuracy of the experimental results, each experimental condition was repeated three times, and the data were statistically analyzed.

[0112] The experimental results are shown in Table 2, K + Ca 2+ It has an activating effect on this enzyme, in which Ca 2+ In its presence, the activating effect is strongest, with a relative enzyme activity reaching 171.04%. Other ions have different inhibitory effects on this enzyme, among which Cu... 2+ The inhibitory effect was the strongest, with a relative enzyme activity of only 51.86%.

[0113] Table 2. Effects of metal ions on fucoidanase activity

[0114]

[0115] Fucoidases are endo-hydrolases that specifically act on the glycosidic bonds in sulfated fucoidan. Sixteen endo-α-1,4-fucoidases (EC 3.2.1.212) and three endo-α-1,3-fucoidases (EC 3.2.1.211) have been reported in the GH107 family. A phylogenetic tree was constructed based on the types of glycosidic bonds hydrolyzed, and the results are as follows: Figure 3 As shown, the QAUFcn2 protein is on the same branch as the fucopolysaccharides Mef1, P5AFcnA, and P19DFcnA that degrade α-1,4-L-fucoside bonds, indicating that the fucopolysaccharide enzyme QAUFcn2 has the ability to degrade α-1,4-L-fucoside bonds.

[0116] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A fucoidanase gene QAUFcn2 Its characteristics are, The QAUFcn2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The fucoidanase gene according to claim 1 QAUFcn2 The encoded fucoidanase is characterized by, The amino acid sequence of the fucoidanase is shown in SEQ ID No.

2.

3. Contains the fucoidanase gene as described in claim 1 QAUFcn2 Recombinant carriers.

4. Contains the fucoidanase gene as described in claim 1 QAUFcn2 Recombinant strains.

5. The fucoidanase gene according to claim 1 QAUFcn2 Or the application of the fucoidanase according to claim 2 in the degradation of fucoidan, characterized in that... The fucoidanase degrades fucoidan by degrading the α-1,4 glycosidic bonds in fucoidan.

6. The application according to claim 5, characterized in that, The fucoidanase can degrade fucoidan from *Sargassum fusiforme*, fucoidan from *Sargassum fusiforme*, and fucoidan from *Fucus vesiculosus*.

7. The application according to claim 5, characterized in that, K + Ca 2+ It has an activating effect on the fucoidanase.

8. The application according to claim 5, characterized in that, The fucoidan solution needs to be dissolved in a solution containing metal ions beforehand, with a final concentration of 1 mmol / L for the metal ions.

Citation Information

Patent Citations

  • Application of fucoidin degrading enzyme OUC-MgFucD1 in preparation of fucoidin oligosaccharide

    CN119913226A