Deacetylcephalosporin C producing strain as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biology, and discloses a deacetylated cephalosporin C producing strain as well as a preparation method and application thereof. The method comprises the following steps: knocking out a CPC related gene from Acremonium chrysogenum to generate a CPC related gene, and introducing a deacetylated cephalosporanic acid related gene to obtain a deacetylated cephalosporanic acid production strain. High-yield and high-purity DAOC can be directly prepared through microbial fermentation, and an important brand-new way is provided for synthesis of 7-ADCA.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, in particular to the technical field of engineering bacteria construction, and specifically to a deacetylcephalosporin C producing bacterium and a preparation method and application thereof. Background Art

[0002] Cephalosporins are a class of antibiotics with important therapeutic significance, belonging to the β-lactam antibiotic family. At present, cephalosporins account for 51% of the antibiotic drug market in my country. In industrial production, cephalosporins are mainly prepared by two routes: one is to use Cephalosporium acremonium fermentation; the other is to expand the tetrahydrothiazolidine ring of penicillin to a dihydrothiazine ring by chemical methods. By inserting side chains at different positions of its β-lactam and dihydrothiazine rings, many cephalosporins with stronger antibacterial ability or better pharmacokinetic properties can be synthesized. In recent years, people's interest in the research of this type of semi-synthetic antibiotics has continued to increase, and many optimizations and innovations have been achieved in its preparation process and methods.

[0003] 7-Aminodeacetoxycephalosporanic acid (7-ADCA) is an important intermediate for the synthesis of semi-synthetic cephalosporins such as cephalexin, cefadroxil, and cephradine. Compared with 7-aminocephalosporanic acid (7-ACA), the unstable acetoxy group is removed at the 3-position of 7-ADCA, so it has a broader application prospect. At present, the synthesis of 7-ADCA mainly relies on chemical methods, and its raw material is penicillin G, which is cheap and easily available. The chemical synthesis process includes the following steps: penicillin G is oxidized by oxyacetic acid at low temperature and then esterified with bis-trimethylsilyl urea; heating under the action of pyridine and bromoacetyl for ring opening, dehydration and molecular rearrangement to generate a 6-membered cephalosporin ring structure; then the trimethylsilyl protecting group is removed by hydrolysis, and the side chain is removed by acylase catalysis to finally obtain 7-ADCA. However, the chemical synthesis method inevitably has the problems of toxicity and pollution of chemical solvents.

[0004] Desacetylcephalosporanic Acid C (DAOC) structural formula is shown in Figure 1 . Compared with 7-ADCA, DAOC has α-aminoadipic acid removed from the C7 position. Studies have shown that acetoxycephalosporin C (DAOC) can be converted into 7-ADCA through the coordinated catalysis of D-amino acid oxidase (DAO) and glutaryl acylase (GLA), or DAOC can be directly catalyzed to synthesize 7-ADCA through cephalosporin acylase, but these methods have not yet been industrialized. DAOC can also be obtained during the fermentation of cephalosporin C (CPC), but the products of CPC fermentation also include CPC and deacetylcephalosporin C (DAC), so DAOC is a by-product and it is difficult to obtain pure products alone. Summary of the invention

[0005] The present invention provides a method for preparing deacetyl cephalosporin C. The method comprises knocking out a CPC-related gene in Acremonium chrysogenum and introducing a deacetylcephalosporanic acid-related gene to obtain the deacetylcephalosporanic acid-producing strain; preferably, the initial strain is Acremonium chrysogenum CGMCC 3.3795 or a highly productive CPC recombinant Acremonium chrysogenum.

[0006] Specifically, the CPC-generating gene is a deacetyloxycephalosporin C synthetase / hydroxylase gene (NCBI: QP1354), and the deacetyloxycephalosporin C synthetase is capable of expanding the penicillin 5-membered ring into the cephalosporin 6-membered ring.

[0007] Preferably, the deacetoxycephalosporin C synthetase gene or its mutant is found in CN202110676893.1, and the amino acid sequence encoded by it is shown in SEQ ID NOs: 6 to 12, and the protein encoded by the mutant corresponds to the wild-type deacetoxycephalosporin C synthetase shown in SEQ ID No: 7, and has one or more of the following substitution mutations: I285M, K279P, D279V, M180K, H244K, K239A, C281A, N2689, C226G, A249V, D290K, G235N or G300V.

[0008] Specifically, the gene encoding the deacetyloxycephalosporin C synthetase is introduced into Cephalosporium acremonium in the form of an expression vector of an expression cassette, including a promoter and a terminator.

[0009] Preferably, the promoter is the endogenous gpdA promoter of Cephalosporium acremonium; preferably, the promoter sequence is SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5 or a mutant thereof.

[0010] In a specific embodiment, the vector backbone of the expression vector is plasmid pAN.

[0011] More specifically, the genes related to the deacetylcephalosporin acid synthesis pathway are produced by gene editing or homologous recombination.

[0012] The invention provides a 7-aminocephalosporanic acid producing strain obtained by the preparation method.

[0013] Furthermore, the invention provides application of the deacetylcephalosporanic acid producing strain in preparing deacetylcephalosporanic acid.

[0014] Also provided is a method for preparing deacetylcephalosporanic acid, comprising the following steps: fermenting the deacetylcephalosporanic acid producing strain to obtain deacetylcephalosporanic acid; optionally, further comprising the step of collecting the deacetylcephalosporanic acid.

[0015] The present invention knocks out CPC-related genes in Acremonium chrysogenum and introduces deacetylcephalosporanic acid-related genes to obtain the deacetylcephalosporanic acid production strain. High-yield and high-purity DAOC can be directly prepared by microbial fermentation, which will provide an important new approach for the synthesis of 7-ADCA. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is the structural formula of deacetylcephalosporin C;

[0017] Figure 2 It is the synthetic pathway of deacetylcephalosporin C;

[0018] Figure 3 Map of plasmid pAN7-cefEF;

[0019] Figure 4 Schematic diagram of Ac-ΔcefEF::cefE validation diagram;

[0020] Figure 5 PCR verification of gene knockout. DETAILED DESCRIPTION

[0021] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0022] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0023] In the following examples, there is no particular limitation on the method for detecting the concentration of deacetylcephalosporin C, and any detection method known to those skilled in the art may be used.

[0024] The following is a further detailed introduction of a deacetylcephalosporin C producing bacterium and a method for producing deacetylcephalosporin C of the present invention in conjunction with specific examples. The technical solutions of the present invention include but are not limited to the following examples.

[0025] The detection method of DAOC production used in the embodiment is as follows:

[0026] The mobile phases for shake flask fermentation and product DAOC detection were: A: 5‰ formic acid in water; B: 90% acetonitrile + 10% water + 5‰ formic acid.

[0027] Instrument: High performance liquid chromatography

[0028] Detector: UV detector

[0029] Detection wavelength: 254nm

[0030] Chromatographic column: ZORBAX Eclipse AAA Analytical 4.6×150mm, 5-Micron

[0031] Running time: 25min

[0032] Mobile phase A: 5‰ formic acid in water; Mobile phase B: 90% acetonitrile + 10% water + 5‰ formic acid.

[0033] Flow rate: 0.8 mL / min

[0034] Injection volume: 10uL

[0035] Column oven temperature: 30°C

[0036] The liquid phase detection conditions are shown in Table 1.

[0037] Table 1. DAOC liquid phase detection conditions

[0038] Time (min) A(％) B(％) 0 100 0 3 100 0 4 95 5 7 90 10 10 80 20 14 100 0 18 100 0

[0039] 1) Seed solution: inoculate the mature slant excavated pieces into a 20 ml test tube with a liquid volume of 5 ml, culture at 28°C, 220 rpm, and shake for 72 h. Then, dilute the seed solution with 50% glycerol at a ratio of 1:1 and store at -80°C.

[0040] 2) Fermentation shake flask: The seed solution was inoculated at 10% to a 100 ml seed shake flask with a liquid volume of 20 ml, and cultured at 28°C and 220 rpm for 72 h to detect DOAC and CPC.

[0041] Example 1. Obtaining pAN7-cefEF gene knockout plasmid

[0042] The cefEF protein sequence was obtained by querying the UniProt protein sequence database, and the nucleic acid sequence was obtained by tblastn comparison. The wild-type Cephalosporium acremonium ATCC11550 cefEF gene sequence (GenBank: KFH44919.1) was compared with the sequencing results of Cephalosporium acremonium CGMCC3.3795, and it was determined that the cefEF gene sequence (as shown in SEQ ID NO.1) had not mutated. The target sequence was designed through the sgRNA design website (https: / / gt-scan.csiro.au / submit / ): 5'-gcgcgccgttctcaactctgTGG-3', and primers (P1cefEF-F1: accggggcttcgaggacgtcgttttagagct agaaatagcaagtt, P1cefEF-R1: gacgtcctcgaagccccggttgcgtaatctgggaatcgaac) were designed. The pAN7 plasmid was used as a template for PCR amplification, and the amplified product was recovered. The plasmid was prepared for host bacterial competence, and the preferred host bacteria was Escherichia coli DH5α. Single colonies were picked for colony PCR verification, and the plasmids that were successfully verified were sequenced to obtain specific sgRNA plasmids that can recognize the cefEF gene.

[0043] In order to further transform Cephalosporium acremonium, the hygromycin gene was replaced with the bleomycin gene, and primers Bleo-F: cctattctacccaagcatATGGCCAAGCTCACCTCCGCCG and Bleo-R: acgttaagtggTCAGTCCTGCTCCTCGGCGACGAAG were designed to obtain the bleomycin gene fragment, and primers ZF: GCCGAGGAGCAGGACTGAccacttaacgttactgaaatcatc and ZR: CGGAGGTGAGCTTGGCCATatgcttgggtagaataggtaagtc were designed. The vector fragment was obtained using the above-obtained plasmid as a template, and the vector fragment was further purified and recombined with Novozymes one-step recombination reagent and transformed into Escherichia coli DH5α. Single colonies were picked for colony PCR verification, and the plasmids that were initially successfully verified were sequenced to obtain a specific sgRNA plasmid that can recognize the cefEF gene and a plasmid with a cas9 protein expression cassette, named pAN7-cefEF. The plasmid map is shown in Figure 3 .

[0044] Example 2: Construction of homologous repair fragments and recombinant strains

[0045] 1. Construction of homology repair fragments

[0046] The genome of industrial Cephalosporium 1-D1 was extracted using a fungal genomic DNA extraction kit and used as a template to design primers (cefEF-LA-F: ggattgtcctgaccactcgatat, cefEF-LA--R: gttgatgctgtggttttgagcgatg) and (cefEF-RL-F: ggaacccgccgatcgagtaataaatctacg, cefEF-RL--R: tacggccatgaatttgaaagcacccgc) to amplify homologous arm LA and RL gene fragments with lengths of 1551 bp and 1470 bp, respectively. Using SEQ ID No: 6 (H7) to SEQ ID No: 12 (727M2, E727M3, E727M5, E735M2, E735M3, E727M5) expandase in patent CN202110676893.1 as template, primers (cefE-F: cgctcaaaaccacagcatcaacATG GACACCACCGTCCCCACCTT, cefE-R: tactcgatcggcgggttccGGCCTTGGTCTTGGTGCGGAG) were designed to PCR amplify 727M2, E727M3, E727M5, E735M2, E735M3, E727M5 deacetoxycephalosporin C synthetase fragments to obtain a gene fragment with a length of 933 bp, and primers (H7-F: cgctcaaaaccacagcatcaacATG GACACCACCGTCCCCACCTT, cefE-R: tactcgatcggcgggttccGGCCTTGGTCTTGGTGCGGAG) were designed to ... catcaacatggataccaccgtgccgac, H7-R:tactcgatcggcgggttccttaggctttgctggtgcggcgcat) amplified the 936bp fragment of H7 deacetoxycephalosporin C synthetase gene, and the above-mentioned LA, RL and deacetoxycephalosporin C synthetase gene fragments after gel recovery were fused into three fragments to obtain the homologous repair fragments shown in Table 2. In order to further adjust the coordinated expression of deacetoxycephalosporin C synthetase with other enzymes in Cephalosporium acremonium. Different promoters were designed in front of deacetoxycephalosporin C synthetase. They are the endogenous gpdA promoter of Cephalosporium acremonium (SEQ ID NO: 1), Ptef1 promoter (SEQ ID NO: 2), the promoter PtrpC of the tryptophan synthesis gene trpC of Aspergillus nidulans (SEQ ID NO: 3),

[0047] The promoter of the tripeptide synthase of C. acrosporum, Pacv (SEQ ID NO: 4), the promoter of the cyclase of Pipns (SEQ ID NO: 5).

[0048] The above gene fragments were homologously recombined by PCR to obtain the corresponding homologous repair fragments as shown in Table 2. In order to increase the expression amount of deacetoxycephalosporin C synthetase, 2 copies, 3 copies, and 4 copies of deacetoxycephalosporin C synthetase were synthesized by gene synthesis, and the corresponding gene fragments were further obtained by homologous repair as shown in Table 2.

[0049] Table 2 Homologous repair fragments

[0050]

[0051]

[0052] 2. Construction of recombinant Cephalosporium acremonium engineering bacteria

[0053] 1. Protoplast transformation

[0054] The constructed knockout plasmid pAN7-cefEF and homologous repair fragment were added with 5ug and 10ug respectively for protoplast co-transformation. The total volume of exogenous DNA was 15ul, and it was gently mixed with the protoplasts. The system was mixed with the upper culture medium and poured into the plate containing the lower culture medium. It was cultured at 28°C for 15-20 days. When translucent white colonies grew on the transformation plate, they were transferred to the malt juice plate (bleomycin resistance: 50ug / ml) using a sterilized toothpick and cultured at 28°C for 10 days.

[0055] 2. Protoplast transformation screening and verification

[0056] See also Figure 4 , is a schematic diagram of the verification principle of the recombinant Cephalosporium acremonium engineered bacteria Ac-ΔcefEF::cefE, the transformant bacteria were verified by colony PCR using 4 pairs of primers, in the embodiment of the present invention, (cefEF-F:gcaaggtcctcaccgagctcgccgagg, cefEF-R:cggcttatccctccgcatgttgacat) were used as primers to amplify the target gene sequence, and there should be no amplified fragment in the experimental group, see Figure 5 ; Use (LA1-F: tgtacggagaattaagg, cefF1-R: CGAGGAAGGCGTCGACACCGCCGTCGGGC); (cefF1-F: GCCCGACGGCGGTGTCGACGCCTTCC TCG, RL1-R: ggagcagatgcgcgagaaagctaaagacg) as primers to amplify the upstream homology arm LA and the expression cassette cefE promoter part (1152 bp), the expression cassette cefE part and the downstream homology arm B2 (1054 bp), respectively. The experimental group should have amplified fragments, see Figure 5The amplified strains were sent for sequencing verification, and the verified strains were used for fermentation to check the production of DAOC. The principles for other strains were the same as above.

[0057] The yield of DAOC was detected and the results are shown in Table 3.

[0058] Table 3. DAOC production identification

[0059]

[0060]

[0061] The wild strain did not produce DAOC but CPC, while the genetically modified strain produced DAOC but not CPC. The promoters before the 727M2 and H7 genes in the genetically modified strains were the promoters of the strains themselves, PgpdA, Pipns and Pacv promoters, and the DAOC production was relatively higher than that of other promoters. With the increase in the number of copies of the 727M2 and H7 genes, the production of DAOC also gradually increased. At present, the strain with the highest production is the strain SWC09 obtained by using the promoter of the chromosome itself and three copies of the 727M2 gene, and the DAOC production is 698ug / ml.

[0062] Therefore, by knocking out the deacetoxycephalosporin C synthetase / hydroxylase gene on the Cephalosporium acremonium genome, blocking the pathway for CPC production, and introducing deacetoxycephalosporin C synthetase, multiple strains producing DAOC were obtained.

[0063] Example 3: Screening of deacetyloxycephalosporin C synthetase mutants

[0064] In order to further improve the activity of deacetoxycephalosporin C synthetase in Cephalosporium acremonium, the error-prone PCR method was used to establish a random mutant library with the E727M2 gene sequence as a template to obtain a higher product DAOC conversion rate. The error-prone PCR reaction conditions are as follows: using E727M2 in Example 2 as a template, the system includes 10ng template, 50mM KCl, 2mM MgCl2, 0.05-0.075mM MnCl2, 0.2mM dATP, 0.2mMdGTP, 1.0mM dCTP, 1.0mMdTTP, 0.2μM upstream and downstream primers, and 5U Taq enzyme. The reaction conditions of PCR are: 94℃3min; (94℃, 20s; 55℃, 20s; 72℃, 60s)) 25 cycles; 72℃3min, and the E727M2 gene mutation fragment is obtained. The homologous repair fragment is constructed according to Example 2.

[0065] The relevant recombinant strains were obtained by referring to the above method, and the production of DAOC was detected after fermentation. The results are shown in Table 4.

[0066] Table 4

[0067] name DAOC (ug / ml) CPC(ug / ml) SWC01-I285M 753 0 SWC01-K279P 689 0 SWC01-D279V 633 0 SWC01-M180K 635 0 SWC01-H244K 644 0 SWC01-K239A 741 0 SWC01-C281A 639 0 SWC01-N2689 644 0 SWC01-C226G 698 0 SWC01-A249V 795 0 SWC01-D290K 782 0 SWC01-G235N 710 0 SWC01-G300V 648 0

[0068] In order to further improve the activity of deacetoxycephalosporin C synthetase in Cephalosporin C, random mutations were performed based on the SWC01 strain, and 13 mutant strains with higher DAOC products than the SWC01 strain were obtained (Table 3), among which SWC01-I285M and SWC01-A249V had production of 753ug / ml and 795ug / ml, respectively, which were higher than those of other strains.

Claims

1. A method for preparing a deacetylcephalosporanic acid producing strain, characterized in that: The deacetylcephalosporanic acid producing strain is obtained by knocking out the CPC-producing related genes in Acremonium chrysogenum and introducing the deacetylcephalosporanic acid synthesizing related genes; preferably, the initial strain is Acremonium chrysogenum CGMCC 3.3795 or a highly productive CPC recombinant Acremonium chrysogenum.

2. The preparation method according to claim 1, characterized in that: The gene related to CPC production is a deacetyloxycephalosporin C synthetase / hydroxylase gene (NCBI: P11935.1), and the gene related to deacetylcephalosporanic acid synthesis introduced is a gene encoding acetyloxycephalosporin C synthetase.

3. The preparation method according to claim 2, characterized in that: The amino acid sequence of the deacetoxycephalosporin C synthetase is shown in SEQ ID No. 6 to 12; the protein encoded by the mutant corresponds to the wild-type deacetoxycephalosporin C synthetase, and has one or more of the following substitution mutations: I285M, K279P, D279V, M180K, H244K, K239A, C281A, N2689, C226G, A249V, D290K, G235N or G300V.

4. The preparation method according to claim 2, characterized in that: The gene encoding the deacetyloxycephalosporin C synthetase is introduced into Cephalosporium acremonium in the form of an expression vector of an expression cassette, including a promoter and a terminator.

5. The preparation method according to claim 4, characterized in that: The promoter is the endogenous gpdA promoter of Cephalosporium acremonium; preferably, the promoter sequence is SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or SEQ ID NO: 5 or a mutant thereof.

6. The preparation method according to claim 5, characterized in that: The vector backbone of the expression vector is plasmid pAN.

7. The preparation method according to any one of claims 1 to 6, characterized in that: The genes related to the deacetylcephalosporin acid synthesis pathway are obtained by gene editing or homologous recombination.

8. A 7-aminocephalosporanic acid producing strain obtained by the preparation method according to any one of claims 1 to 8.

9. Use of the deacetylcephalosporanic acid producing strain as claimed in claim 8 in the preparation of deacetylcephalosporanic acid.

10. A method for preparing deacetylcephalosporanic acid, comprising the following steps: fermenting the deacetylcephalosporanic acid producing strain according to claim 8 to obtain deacetylcephalosporanic acid; optionally, further comprising the step of collecting the deacetylcephalosporanic acid.

Images