Application of pagy ucca6a gene in regulating wood yield of poplar

By applying the PagYUCCA6a gene to regulate poplar timber yield, the problem of low poplar timber yield was solved, and the height and xylem width of poplar trees were increased, thus promoting poplar growth.

CN119842783BActive Publication Date: 2026-02-06INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202411967079.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-30
Publication Date
2026-02-06
Estimated Expiration
2044-12-30

AI Technical Summary

Technical Problem

Existing technologies have not yet effectively solved the problem of how to regulate poplar timber yield through gene regulation, especially how to increase and control timber yield by regulating poplar timber yield and thus solve the problem of poplar timber yield.

Method used

By applying the PagYUCCA6a gene to regulate poplar timber yield, the problem of poplar timber yield was solved.

Benefits of technology

It increased poplar timber production, enhanced poplar height and xylem width, and promoted poplar growth.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005218605360000011
    Figure HDA0005218605360000011
  • Figure HDA0005218605360000012
    Figure HDA0005218605360000012
  • Figure HDA0005218605360000013
    Figure HDA0005218605360000013
Patent Text Reader

Abstract

The application relates to the field of biotechnology, and particularly discloses application of a PagYUCCA6a gene in regulating wood yield of poplar. The application takes a silver gland poplar variety 84K as a material, clones the PagYUCCA6a gene, and constructs the gene into an overexpression vector pMDC32. The gene is located behind a 35S promoter, and under the drive of the 35S promoter, the PagYUCCA6a can be overexpressed in the poplar body, so as to regulate the wood yield of the poplar, and it is indicated that the PagYUCCA6a gene is a key gene for regulating the wood yield of the poplar, and has important application value in the field of high-yield genetic engineering of forest trees.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to application of a PagYUCCA6a gene in regulating wood yield of a poplar. BACKGROUND

[0002] The poplar grows rapidly and is widely distributed, and is one of important tree species for cultivating a man-made forest. In the forestry production, the poplar wood and products thereof have important economic values. The stem of the poplar is a main source of the biomass. The development of the stem of the poplar comprises two stages of primary growth and secondary growth, wherein the secondary growth stage is directly related to the wood yield of the secondary xylem annual accumulation.

[0003] The auxin has been considered as a key plant hormone for regulating wood formation. In the angiosperms and the gymnosperms, there is an auxin concentration gradient in the vascular tissue, which gradually decreases from the cambium region to the xylem and phloem sides. It is reported that applying an exogenous auxin can promote the secondary growth. How to regulate the secondary xylem development and improve the wood yield to provide an excellent strain for high-yield poplar forest cultivation is a problem to be solved by the application. SUMMARY

[0004] The application aims to improve the wood yield of the poplar.

[0005] In order to solve the above technical problem, the application provides application of a PagYUCCA6a gene in regulating wood yield of a poplar, wherein the PagYUCCA6a gene codes a PagYUCCA6a protein, and the PagYUCCA6a protein is a protein of A1, A2 or A3 as follows:

[0006] A1, the amino acid sequence is a protein of SEQ ID No. 2 in the sequence listing;

[0007] A2, a protein with more than 80% identity with the protein of A1 and related to the yield of the poplar, which is obtained by substitution, deletion and / or addition of one or more amino acid residues on the amino acid sequence of SEQ ID No. 2 in the sequence listing;

[0008] A3, a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1 or A2.

[0009] In the above application, SEQ ID No. 2 in the sequence listing is composed of 434 amino acid residues.

[0010] In the above-mentioned applications, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using the homology search site on the Internet, such as the BLAST page of the NCBI homepage. For example, the identity (%) of a pair of amino acid sequences can be calculated by searching in Advanced BLAST 2.1 using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and then obtaining the value of the identity (%).

[0011] In the above-mentioned applications, the identity of more than 80% can be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100%.

[0012] In the above-mentioned applications, the PagYUCCA6a protein can be derived from a poplar.

[0013] In the above-mentioned applications, the PagYUCCA6a gene can specifically be a DNA molecule whose coding sequence (ORF) of the coding strand is SEQ ID No. 1 in the sequence listing.

[0014] In the above-mentioned applications, the regulation can be to increase the yield of the poplar by promoting or increasing the expression of the PagYUCCA6a gene.

[0015] In the above-mentioned applications, the increase in the yield of the poplar can be manifested as the following Y1 and / or Y2:

[0016] Y1, the height of the poplar is increased;

[0017] Y2, the width of the xylem of the poplar is increased.

[0018] To solve the above technical problems, the present application also provides a plant agent for increasing the yield and / or height and / or width of the xylem of the poplar, wherein the active ingredient of the plant agent is a substance for promoting or increasing the expression of the PagYUCCA6a gene and / or increasing the abundance of the PagYUCCA6a protein.

[0019] The active ingredient of the above-mentioned plant agent can also contain other biological components or / and non-biological components, and the other active ingredients of the above-mentioned plant agent can be determined by a person skilled in the art according to the effect of increasing the yield and / or height and / or width of the xylem of the poplar.

[0020] To solve the above technical problems, the application further provides a method for increasing the yield of poplar, comprising the steps of introducing the PagYUCCA6a gene into a recipient poplar to obtain a poplar with increased yield, wherein the yield of the poplar with increased yield is higher than that of the recipient poplar.

[0021] In the above method, the poplar with increased yield can be a transgenic poplar or a poplar obtained through conventional breeding techniques such as hybridization.

[0022] To solve the above technical problems, the application further provides a method for increasing the height of poplar, comprising the steps of introducing the PagYUCCA6a gene into a recipient poplar to obtain a poplar with increased height, wherein the height of the poplar with increased height is higher than that of the recipient poplar.

[0023] In the above method, the poplar with increased height can be a transgenic poplar or a poplar obtained through conventional breeding techniques such as hybridization.

[0024] To solve the above technical problems, the application further provides a method for increasing the width of the xylem of poplar, comprising the steps of introducing the PagYUCCA6a gene into a recipient poplar to obtain a poplar with widened xylem, wherein the width of the xylem of the poplar with widened xylem is wider than that of the recipient poplar.

[0025] In the above method, the poplar with widened xylem can be a transgenic poplar or a poplar obtained through conventional breeding techniques such as hybridization.

[0026] In the above method, the PagYUCCA6a gene can be modified before being introduced into the recipient poplar to achieve better expression effect, for example:

[0027] 1) modifying the gene sequence adjacent to the initial methionine to enable effective translation initiation; for example, using a known effective sequence in plants for modification;

[0028] 2) connecting with various plant-expressed promoters to facilitate its expression in plants; the promoters can include constitutive, inducible, timing-regulated, development-regulated, chemical-regulated, tissue-preferred, and tissue-specific promoters; the selection of promoters will vary with the expression time and space needs, and also depends on the target species; for example, tissue or organ-specific expression promoters, according to the needs of the recipient at what stage of development; although many promoters derived from dicotyledons have been shown to be functional in monocotyledons and vice versa, ideally, dicotyledon promoters are selected for expression in dicotyledons, and monocotyledon promoters are selected for expression in monocotyledons; in one embodiment of the application, the 35S promoter is used to drive the PagYUCCA6a gene.

[0029] 3) The expression efficiency of the gene of the present application can also be improved by connecting with a suitable transcription terminator; for example, tml derived from CaMV, E9 derived from rbcS; any available terminator known to function in plants can be connected with the gene of the present application;

[0030] 4) Introducing enhancer sequences, such as intron sequences (for example, derived from Adhl and bronzel) and viral leader sequences (for example, derived from TMV, MCMV and AMV).

[0031] The PagYUCCA6a gene can be introduced into plant cells by using conventional biotechnological methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

[0032] The present application also provides a protein, which is the PagYUCCA6a protein.

[0033] The present application also provides biological materials related to the DNA molecule, which also belong to the protection scope of the present application.

[0034] The biological materials related to the PagYUCCA6a gene provided by the present application are any one of the following B1 to B6:

[0035] B1, an expression cassette containing the PagYUCCA6a gene;

[0036] B2, a recombinant vector containing the PagYUCCA6a gene, or a recombinant vector containing the expression cassette of B1;

[0037] B3, a recombinant microorganism containing the PagYUCCA6a gene, or a recombinant microorganism containing the expression cassette of B1, or a recombinant microorganism containing the recombinant vector of B2;

[0038] B4, a transgenic plant cell line containing the PagYUCCA6a gene, or a transgenic plant cell line containing the expression cassette of B1;

[0039] B5, a transgenic plant tissue containing the PagYUCCA6a gene, or a transgenic plant tissue containing the expression cassette of B1;

[0040] B6, a transgenic plant containing the PagYUCCA6a gene, or a transgenic plant containing the expression cassette of B1.B6. A transgenic plant organ containing the PagYUCCA6a gene, or a transgenic plant organ containing the expression cassette described in B1.

[0041] In the aforementioned biological materials, the expression cassette (PagYUCCA6a gene expression cassette) containing the PagYUCCA6a gene described in B2) refers to DNA capable of expressing the PagYUCCA6a gene in host cells. This DNA may include not only a promoter to initiate transcription of the PagYUCCA6a gene, but also a terminator to terminate transcription of the PagYUCCA6a gene. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiology 120:979-992); chemically induced promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by jasmonic acid methyl ester); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1)). 0099169.7), seed storage protein-specific promoters (e.g., promoters of beta-conglycin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J.4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator (see, e.g., Odell et al. (I 985Nature 313:810; Rosenberg et al. (1987) Gene, 56: 125; Guerineau et al. (1991) Mol. Gen. Genet, 262: 141; Proudfoot (1991) Cell, 64: 671; Sanfacon et al. Genes Dev., 5: 141; Mogen et al. (1990) Plant Cell, 2: 1261; Munroe et al. (1990) Gene, 91: 151; Ballad et al. (1989) Nucleic Acids Res. 17: 7891; Joshi et al. (1987) Nucleic Acid Res., 15: 9627).

[0042] The recombinant expression vector containing the expression cassette of the PagYUCCA6a gene can be constructed using the existing plant expression vectors. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, etc. Such as pMDC32, pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Corporation), etc. The plant expression vector can also contain the 3' untranslated region of the foreign gene, i.e. containing the polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor, such as the 3' untranslated region of the Agrobacterium crown gall tumor-inducing (Ti) plasmid gene (such as the nopaline synthase gene Nos), the 3' end of the plant gene (such as the soybean storage protein gene) transcription untranslated region has similar functions. When using the gene of the present application to construct a plant expression vector, enhancers, including translation enhancers or transcription enhancers, can also be used. These enhancer regions can be ATG start codon or adjacent regions start codon, but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the start codon is wide, which can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants to produce color-changing enzymes or luminescent compounds (GUS gene, luciferase gene, etc.), marker genes of antibiotics (such as nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to herbicide phosphine, HPT gene conferring resistance to antibiotic hygromycin, hph gene, and dhfr gene conferring resistance to methatrexate, EPSPS gene conferring resistance to glyphosate), or chemical reagent resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. For the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under stress.

[0043] Among the above-mentioned biological materials, the recombinant microorganism can be yeast, bacteria, algae and fungi.

[0044] The application takes Populus alba var. 84K as material, clones PagYUCCA6a gene, constructs to overexpression vector pMDC32, the gene is located behind 35S promoter, under the drive of 35S promoter, PagYUCCA6a can overexpress in poplar body, thereby regulating poplar wood yield, and it is indicated that PagYUCCA6a gene is the key gene for regulating poplar wood yield, and has important application value in the field of high-yield genetic engineering of forest trees. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 It is the structural schematic diagram of plant expression vector pMDC32-PagYUCCA6a of the application.

[0046] Figure 2 It is the real-time quantitative detection diagram of transcription level of non-transgenic poplar 84K (WT) and transgenic poplar (OE6, OE24, OE26) overexpressing PagYUCCA6a of the application.

[0047] Figure 3 It is the growth diagram of non-transgenic poplar 84K (WT) and transgenic poplar (OE6, OE24, OE26) overexpressing PagYUCCA6a of the application.

[0048] Figure 4 It is the stem cross-section diagram of non-transgenic poplar 84K (WT) and transgenic poplar (OE6, OE24, OE26) overexpressing PagYUCCA6a of the application. DETAILED DESCRIPTION

[0049] The application will be further described in detail in combination with specific embodiments, and the examples given are only for illustrating the application, rather than limiting the scope of the application. The examples provided below can be used as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the application.

[0050] In the quantitative test in the following examples, three repeated experiments are set, and the average value is taken.

[0051] In the experimental methods in the following examples, if no special instructions are given, they are all conventional methods. In the following examples, the materials, reagents, etc. used, if no special instructions are given, can be obtained from commercial channels.

[0052] In the following examples, the poplar variety 84K is described in the non-patent literature "KNAT2 / 6b, a class I KNOX gene, impedes xylem differentiation by regulating NAC domain transcription factors in poplar. Zhao et al. (2020) New Phytol. 225: 1531-1544." which is publicly available from the applicant to repeat the experiments of the present invention.

[0053] Example 1 Cloning of PagYUCCA6a gene

[0054] Using the RNeasy Plant Mini kit and RNase-free DNase I kit (Qiagen, Hilden, Germany) to extract total RNA from one-month-old soil culture seedlings of 84K (P. alba X P. glandulosa), 1.0 μg of RNA was taken from each sample, and the first strand of cDNA was synthesized by using the Superscript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Referring to the published P. tomentosa genomic sequence, the primer (amplifon includes the start codon and the stop codon) was designed using Primer 5 software, and the full-length gene amplification was performed (GATEWAY adapter was introduced into the primer);

[0055] Among them, the forward primer of PagYUCCA6a ORF is PagYUCCA6a ORF-F, and the reverse primer is PagYUCCA6a ORF-R, and the primer sequences are as follows:

[0056] PagYUCCA6a ORF-F: 5'-GGGGACAACTTTGTACAAAAAAGTTGGAATGGACTGCTTGAGAGAAAT-3' (as shown in SEQ ID No. 3 in the sequence listing, wherein the first-28th is a GATEWAY adapter, and the 29th-48th is the same as the sequence of the 1st-20th of SEQ ID No. 1);

[0057] PagYUCCA6a ORF-R: 5'-GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTATCACGGTGATGGTGATGATG-3' (as shown in SEQ ID No. 4 in the sequence listing, wherein positions 1-35 are a GATEWAY adaptor, and wherein positions 36-55 are reverse complement to the sequence of SEQ ID No. 1 at positions 1286-1305).

[0058] The high-fidelity PCR reaction system was as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 12.5 μl, forward primer (10 μM) 1 μl, reverse primer (10 μM) 1 μl, template (84K poplar cDNA) 100 ng, sterile ddH2O supplemented to 25 μl.

[0059] The reaction procedure was as follows: pre-denaturation at 95 °C for 5 min; 95 °C for 20 s; 56 °C for 20 s; 68 °C for 60 s, 30 cycles; 68 °C for 10 min.

[0060] The full-length cDNA sequence of the gene was finally obtained as 1305 bp, named as PagYUCCA6a gene, and the sequence is shown in SEQ ID No. 1 in the sequence listing, and the expressed protein sequence encoded thereby is shown in SEQ ID No. 2 in the sequence listing.

[0061] SEQ ID No. 1

[0062] ATGGACTGCTTGAGAGAAATAGAGGGCAAACAAGCTCATGATCCTCTTTTTGACAAAATCATGAATAAATCTTCACGTCG

[0063] TGTTTTTGTCCCTGGTCCAGTTATTGTTGGCGCTGGTCCTTCTGGCCTTGCCGTGGCAGCTTGTCTCAAAGAAAAAGGTT

[0064] TCCCAAGTATGGTACTAGAGAGATCTAGTTGTATAGCATCTTTGTGGCAGTTAAAGACTTATGATCGCCTACGCCTTCAC

[0065] TTACCGAAACAATTCTGTGAGCTTCCTCTCATGGGGTTCCCTAGTGAATTTCCAACTTACCCTACTAAGCAACAATTTAT

[0066] TCATTATTTAGAGACGTATGCACGCAAGTTTGAGATTAGACCACGGTTCAATGAGACTGTGTCACATGCCGAATATGATA

[0067] AAGCTATCGGGTTTTGGCGCGTGAAGACTGTTGGGAAAAAGTTAGAGGAGACTGAGTACATGTGCCGGTGGTTGGTGGCG

[0068] GCGACCGGAGAGAATGCGGAGGCAGTGGTGCCAGAGATTGATGGAATGGGAGAATTTGGAGGGGATATTCGGCATACAAG

[0069] TCATTACAAAAGTGGAGAGGAGTTTAAAAGCAAAAAGGTTTTGGTGGTGGGGTGTGGGAATTCAGGAATGGAAGTTTGTT

[0070] TGGATCTCTGCAATTATAGCGCTAAGCCTTCACTTGTTGTTAGAGATACAGTGCATGTTCTGCCTCGAGAGATGCTAGGC

[0071] AAATCAACTTTCGGGTTGTCCATGTGGTTGCTCAAGTGGCTGCCCATGCGCCTTGTCGACCGGTTCCTGCTGATAGTGTC

[0072] GAGGCTAATGCTCGGTGATACGGCACGATTGGGATTGGACCGGCCGGAATTGGGTCCCCTCGAACTCAAGAACTTGTCCG

[0073] GGAAGACCCCAGTATTAGATGTTGGGACACTGGCCAAGATCAAAAGTGGAGACGTTAAGGTATGTCCAGGAATTAAGAAG

[0074] CTAAAACGTCATACCGTTGAGTTTCTTGATGGGAAGATGGAGAATTTTGATGCTATTATTTTAGCAACAGGCTACAAAAG

[0075] TAATGTGCCATCTTGGCTAAAGGAAGGAGACATGTTCGAGAAAGATGGGTTTCCTAAAAGACCATTTCCAAATGGATGGA

[0076] GAGGAGAGTGTGGGCTATATGCAGTGGGGTTCACTAAACGTGGAATATTAGGAGCTTCAATGGATGCTAAAAGAATAGCT

[0077] GAAGACATTGAACGGTACTGTAGGAATGAAGAAGCGGCACCGTATGATCATCATCATCGGTCAGTACTGTTGTTGAAATC

[0078] ATCATCATCATCACCATCACCGTGA

[0079] SEQ ID No.2

[0080] MDCLREIEGKQAHDPLFDKIMNKSSRRVFVPGPVIVGAGPSGLAVAACLKEKGFPSMVLERSSCIASLWQLKTYDRLRLHLPKQFCELPLMGFPSEFPTYPTKQQFIHYLETYARKFEIRPRFNETVSHAEYDKAIGFWRVKTVGKKLEETEYMCRWLVAATGENAEAVVPEIDGMGEFGGDIRHTSHYKSGEEFKSKKVLVVGCGNSGMEVCLDLCNYSAKPSLVVRDTVHVLPREMLGKSTFGLSMWLLKWLPMRLVDRFLLIVSRLMLGDTARLGLDRPELGPLELKNLSGKTPVLDVGTLAKIKSGDVKVCPGIKKLKRHTVEFLDGKMENFDAIILATGYKSNVPSWLKEGDMFEKDGFPKRPFPNGWRGECGLYAVGFTKRGILGASMDAKRIAEDIERYCRNEEAAPYDHHHRSVLLLKSSSSSPSP

[0081] Example 2 Construction of a plant expression vector for the PagYUCCA6a gene

[0082] The entry vector was PDNOR207, the sequence of which is shown in SEQ ID No. 5 in the Sequence Listing.

[0083] SEQ ID No. 5

[0084]

[0085] The overexpression vector of PagYUCCA6a gene was constructed by cloning technology. The specific PCR primer pair (consisting of PagYUCCA6a ORF-F and PagYUCCA6a ORF-R of Example 1) was used to amplify the ORF of PagYUCCA6a gene (as shown in SEQ ID No. 1 in the sequence listing) from the 84K cDNA template by PCR, and the ORF of PagYUCCA6a gene was constructed into the entry vector PDNOR207.

[0086] The reaction system was 150 ng of fresh PCR product; 75 ng of PDNOR207 vector; 0.8 μl of BP Clonase II enzyme mix; sterile ddH2O was supplemented to 4 μl; and the reaction procedure was 25°C for more than 5 h.

[0087] The positive clones were picked from the screening plate for PCR detection and sequencing verification. The entry vector with the PagYUCCA6a gene was linearized by Mlu I restriction enzyme, and then was constructed into the plant expression vector pMDC32 by the Gateway system.

[0088] The sequence of the plant expression vector pMDC32 is shown in SEQ ID No. 6 in the sequence listing.

[0089] SEQ ID No. 6

[0090]

[0091] The LR reaction is carried out, and the reaction system is: linearized entry clone 75 ng; purified destination vector 150 ng; LR Clonase II enzyme mix 0.8 μl; sterile ddH2O 4 μl; reaction condition: 25°C for more than 5 h; after the LR reaction, the PagYUCCA6a gene is introduced into the plant expression vector pMDC32, a strong expression promoter 35S is assembled at the 5' end of the PagYUCCA6a gene, and the PagYUCCA6a gene can be highly expressed in the poplar in vivo; a strong terminator NOS is assembled at the 3' end of the PagYUCCA6a gene, and the transcription of the PagYUCCA6a gene can be effectively terminated, as shown in the structure of the plant expression vector pMDC32-PagYUCCA6a of the application. Figure 1

[0092] The hygromycin phosphotransferase HPT is assembled on the vector as a selection marker of the transgenic poplar, and the transgenic poplar can be selected by using hygromycin; the LB and RB sequences are assembled on the vector, so that the PagYUCCA6a gene expression frame and the selection marker gene HPT assembled therebetween are integrated into the poplar receptor chromosome, and the overexpression vector is confirmed to be successfully constructed through PCR detection and sequencing verification, and is named as pMDC32-PagYUCCA6a, and the gene is located after the promoter 35S, and the PagYUCCA6a gene can be highly expressed in the poplar in vivo under the driving of the promoter 35S.

[0093] Example 3 Genetic transformation of the PagYUCCA6a gene

[0094] The pMDC32-PagYUCCA6a overexpression vector constructed in Example 2 is transferred into Agrobacterium GV3101 by the electroporation method, and Agrobacterium GV3101-pMDC32-PagYUCCA6a is obtained, and the PagYUCCA6a gene is transferred into the poplar (silver gland poplar, 84K poplar, the same below) by the Agrobacterium mediation, and the specific transformation steps are as follows:

[0095] The hybrid poplar clone 84K tissue culture seedlings for genetic transformation are cultured under the conditions of a culture temperature of 23-25°C, illumination of 16 / 8 h (day / night), and illumination intensity of 50 μM / m 2 / s.

[0096] ​Agrobacterium GV3101-pMDC32-PagYUCCA6a containing the expression vector pMDC32-PagYUCCA6a was observed at OD 600 =0.6-0.8% infection of 84K leaf discs. Infected leaf discs were then cultured on adventitious bud induction medium (SIM, prepared by adding 6-benzylaminopurine (6-BA) and naphthaleneacetic acid (NAA) to MS (Murashige-Skoog) basal medium, with 6-BA concentration of 0.5 mg / L and NAA concentration of 0.05 mg / L) in the SIM medium under dark conditions at 23±2℃ for 3-4 days. After co-culture, the leaf discs were transferred to SIM containing 3 mg / L hygromycin B and 200 mg / L timentin, and cultured at 23-25℃, with a light cycle of 16 / 8 h (day / night) and a light intensity of 50 μM / m². 2 Under conditions of / s, resistant adventitious shoots were induced and screened. After about 20 days of induction culture, the resistant adventitious shoots were transferred to rooting medium (RIM) containing 3 mg / L hygromycin B and 200 mg / L timentin, with indolebutyric acid (IBA) and naphthaleneacetic acid (NAA) added to 1 / 2 MS basal medium to make the IBA concentration 0.05 mg / L and the NAA concentration 0.02 mg / L) until adventitious roots were induced. DNA was extracted from the leaves of the rooted plants and verified by PCR to obtain transgenic poplar trees that overexpressed PagYUCCA6a. Subsequent phenotypic observations and functional studies were carried out using three transgenic poplar lines (OE6, OE24, and OE26) with high PagYUCCA6a expression levels as representatives.

[0097] Example 4: Application of the PagYUCCA6a gene

[0098] The transcriptional levels of transgenic poplar trees overexpressing PagYUCCA6a (OE6, OE24, and OE26 obtained in Example 3) were quantitatively detected in real time, with wild-type 84K as a control:

[0099] Plants OE6, OE24, and OE26 were propagated separately using tissue culture to obtain OE6, OE24, and OE26 lines, respectively. RNA was extracted from tissue culture seedlings of each line after approximately one month of growth and reverse transcribed. Detection was performed using the SYBR Premix ExTaq™ Kit (TaKaRa), with the ACTIN gene as an internal control, and a LightCycler 480 (Roche) real-time quantitative PCR instrument.

[0100] The primers targeting the PagYUCCA6a gene are:

[0101] YUC6a-RT-F: 5'-TGGGACACTGGCCAAGATCAAA-3';

[0102] YUC6a-RT-R: 5'-TAGCCCACACTCTCCTCTCCAT-3'.

[0103] The primers for the internal reference ACTIN gene are:

[0104] ACTIN-F: 5'-AAACTGTAATGGTCCTCCCTCCG-3';

[0105] ACTIN-R: 5'-GCATCATCACAATCACTCTCCGA-3'.

[0106] Each sample is collected from at least 6 poplars, and at least 3 repeats are performed.

[0107] The results are shown in Figure 2 , wherein the column chart shows the expression amount of PagYUCCA6a gene in non-transgenic poplar (84K) and transgenic poplar (OE6, OE24, OE26) (three strains of transgenic poplar overexpressing PagYUCCA6a), compared with the non-transgenic poplar (84K), the expression level of PagYUCCA6a in the transgenic poplar (OE6, OE24, OE26) is obviously improved.

[0108] Figure 3 is a growth phenotype comparison chart of tissue culture seedlings of the non-transgenic poplar (84K) and the PagYUCCA6a transgenic poplar (OE6, OE24, OE26) of the application about 1 month, and a common camera is used for photographing; from Figure 3 It can be seen that, compared with the non-transgenic silver gland poplar (84K), the PagYUCCA6a transgenic poplar (OE6, OE24, OE26) has a higher plant height, indicating that the PagYUCCA6a gene affects the growth and development of poplar.

[0109] Figure 4 is a stem cross-section chart of tissue culture seedlings of the non-transgenic poplar (84K) and the PagYUCCA6a transgenic poplar (OE6, OE24, OE26) of the application about 1 month, it can be seen that the xylem width of the transgenic poplar is significantly increased, indicating that overexpression of PagYUCCA6a promotes xylem development and has the potential to increase the yield of poplar wood.

[0110] The application transplants the PagYUCCA6a gene into 84K poplar, and the transgenic poplar overexpressing the PagYUCCA6a gene has a phenotype of increased xylem width compared with the wild type, which indicates that the PagYUCCA6a gene is a key regulatory gene for regulating the xylem development and wood yield of poplar and has important application value in the field of high-yield genetic engineering of forest trees.

[0111] The application has been described above in detail. For those skilled in the art, the application can be implemented in a wider range under equivalent parameters, concentrations and conditions without departing from the purpose and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In general, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by using conventional techniques known in the art, which are out of the range disclosed in the application. Some basic features can be applied according to the scope of the following attached claims.

Claims

1. PagYUCCA6a The use of genes in regulating wood yield in poplar, characterized in that: The PagYUCCA6a gene encodes a PagYUCCA6a protein that is a protein of A1 or A2 as follows: A1, the amino acid sequence is the protein of SEQ ID No. 2 in the sequence listing; A2, a fusion protein obtained by connecting a protein tag at the N-terminal or / and C-terminal of A1; said modulating is by increasing expression of said PagYUCCA6a the gene increases yield in poplar; said increasing yield in poplar is reflected in Y1 and / or Y2 as follows: Y1, the height of the poplar tree is increased; Y2, the width of the xylem of the poplar tree is increased.

2. Use according to claim 1, characterized in that: The PagYUCCA6a The DNA molecule of SEQ ID No. 1 in the sequence listing is the coding sequence of the coding strand.

3. A method of increasing the height of a poplar tree, characterized by: comprising the step of introducing into a recipient poplar tree the nucleic acid molecule of claim 1 or 2, wherein the height of the poplar tree is increased compared to the height of the recipient poplar tree. PagYUCCA6a comprising the step of introducing into a recipient poplar tree the nucleic acid molecule of claim 1 or 2, wherein the height of the poplar tree is increased compared to the height of the recipient poplar tree.

4. A method of increasing the width of the xylem of a poplar tree, characterized in that: comprising the step of introducing into a recipient poplar tree the nucleic acid molecule of claim 1 or 2 PagYUCCA6a introducing the nucleic acid molecule into a recipient poplar tree, thereby obtaining a poplar tree having wider xylem width; wherein the xylem width of the poplar tree having wider xylem width is wider than the xylem width of the recipient poplar tree.

Citation Information

Patent Citations

  • Seed specificity highly effective promoter and its application

    CN101063139A

  • Seed specific highly effective promoter and its application

    CN101063139B

  • Recombinant DNA: transformed microorganisms, plant cells and plants: a process for introducing an inducible property in plants, and a process for producing a polypeptide or protein by means of plants or plant cells

    US5057422A

  • Plant proteins, promoters, coding sequences and use

    US5187267A

  • Method of utilizing rape BnaA6YUC6 gene to improve rape branching angle

    CN110846329A