Application of SLC35E2B in construction of Hacat cell model

Abstract

The invention discloses an application of SLC35E2B in the construction of a Hacat cell model. The invention aims to construct a Hacat cell in-vitro culture model for silencing and overexpressing the SLC35E2B gene, on one hand, a research material is provided for researching the function of the SLC35E2B gene, and on the other hand, the influence of the SLC35E2B gene on keratinocyte proliferation, apoptosis, differentiation and inflammatory factor secretion is further researched on the molecular and protein level. On the basis, as a main cell experiment material, the SLC35E2B gene can be used for exploring the pathogenesis of psoriasis and possibly participated molecular pathways of the SLC35E2B gene by influencing keratinocytes.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of SLC35E2B in construction of Hacat cell models. Background Art

[0002] Psoriasis is a chronic inflammatory skin disease characterized by erythema, plaques, and scales. In the process of genetic research on psoriasis, many studies have suggested that psoriasis and other diseases (such as diabetes, Crohn's disease, rheumatoid arthritis, etc.) have a common genetic basis. Studies have found that some susceptibility genes for psoriasis, such as CDKAL1, PSORS2, PSORS3, PSORS4, IL12B, IL23A, and IL23R, are also found to be associated with type 2 diabetes.

[0003] Solute carrier 35 (SLC35) is the 35th member of the SLC family, divided into 7 subtypes (AG), and is a hydrophobic protein composed of 300 to 400 amino acids. Most members of SLC35 are located on the Golgi complex membrane, and a small part is located on the cell membrane. It mainly transports the corresponding monosaccharide nucleotides in the cell and ensures the smooth progress of the glycosylation process. SLC35 is considered to be a key regulator in the glycosylation pathway.

[0004] At present, there are few studies on SLC35E2B, and its function is still unclear. According to the results of previous studies, in order to further explore the effects and possible mechanisms of SLC35E2B on plaque psoriasis, our research group established an in vitro cultured Hacat cell model by silencing or overexpressing the SLC35E2B gene, and explored the effects of the SLC35E2B gene on keratinocyte proliferation, apoptosis, differentiation, and secretion of inflammatory factors. This study is of great significance for exploring the role of SLC35E2B in keratinocytes, related mechanisms, and possible molecular pathways involved. At the same time, it provides a new theoretical basis for guiding the treatment of psoriasis, and has certain economic and social benefits. Summary of the invention

[0005] The main purpose of the present invention is to overcome the shortcomings and limitations of the prior art and provide a method for constructing a Hacat cell model that silences or overexpresses the SLC35E2B gene.

[0006] In order to solve the above technical problems and achieve the above objectives, the present invention is implemented through the following technical solutions:

[0007] Our research group previously conducted relevant statistics on 753 patients with psoriasis and found that the incidence of diabetes was significantly increased. In order to explore more shared susceptibility genes between psoriasis and diabetes, we performed differential gene detection on the whole blood of 47 patients with psoriasis and 14 healthy controls by whole exome gene sequencing. The results showed that SLC35E2B gene locus mutations were found in multiple related genes. We further found through immunohistochemistry that SLC35E2B expression is localized in epidermal keratinocytes and is lowly expressed in patients with plaque psoriasis.

[0008] A method for constructing a Hacat cell model for silencing or overexpressing the SLC35E2B gene, which is based on SiRNA-induced gene silencing and lentivirus-mediated gene overexpression technology, respectively.

[0009] The method for constructing a Hacat cell model for silencing the SLC35E2B gene comprises the following steps:

[0010] 1. Design siRNA primer sequences: According to the information of SLC35E2B gene and experimental requirements, according to the principles of primer design, use Primer&Oligo software to select primer sequences, and then synthesize primers.

[0011] 2. Select the optimal SiRNA primer sequence: Select the optimal primer for the formal experiment based on the preliminary experimental results and the amplification melting curve.

[0012] 3. Design primer sequences: Search the primer sequences of the SLC35E2B gene on the Genbank platform, verify them through Primer Blast of PubMED, select the appropriate sequences, and synthesize the required primers.

[0013] 4. Transfection: Hacat cells with SLC35E2B gene silencing were obtained by transfecting Hacat cells.

[0014] The method for constructing a Hacat cell model overexpressing the SLC35E2B gene comprises the following steps:

[0015] 1. Construction of lentiviral expression vector: Determine the species and select the lentiviral expression vector of the target gene sequence. According to the information of the SLC35E2B gene and the experimental requirements, query the SLC35E2B gene sequence on the Genbank platform. The gene name (Ensembl): ENSMUSG00000019731, the knockout gene GenBank code: NM_177766.3; verify and synthesize the target gene, and then construct the lentiviral expression vector.

[0016] 2. Preliminary experiment: Find the optimal multiplicity of infection (MOI) and determine the number of viruses added to each cell.

[0017] 3. Infection of Hacat cells: Overexpression of SLC35E2B gene in Hacat cells mediated by adenovirus.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention mainly establishes an in vitro culture model of Hacat cells silencing or overexpressing the SLC35E2B gene based on SiRNA-induced gene silencing technology and lentivirus-mediated gene overexpression technology. After the model is successfully constructed, the expression level of the SLC35E2B gene is detected and compared by RT-PCR method. On this basis, the effect of the SLC35E2B gene on keratinocyte proliferation, apoptosis, differentiation and inflammatory factor secretion can be further explored. At the same time, it provides the main cell experimental materials for studying the pathogenesis of psoriasis and the molecular pathways that may be involved in the SLC35E2B gene by affecting keratinocytes. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Flow chart of the experimental design for constructing a Hacat cell model for silencing / overexpressing the SLC35E2B gene of the present invention and conducting subsequent studies;

[0021] Figure 2 This is the result of SiRNA-induced SLC35E2B gene silencing in Hacat cells;

[0022] Figure 3 The results of secretion, differentiation, proliferation and apoptosis detection of Hacat cell model cultured in vitro for silencing SLC35E2B gene;

[0023] Figure 4 This is the result of transcriptomic analysis of the silencer group of SLC35E2B gene;

[0024] Figure 5 The flowchart of transcriptomics technology for SLC35E2B overexpression;

[0025] Figure 6 This is the result of lentivirus-mediated SLC35E2B gene overexpression in Hacat cells;

[0026] Figure 7 The results of secretion, differentiation, proliferation and apoptosis detection of Hacat cell model overexpressing SLC35E2B gene in vitro;

[0027] Figure 8This is the expression diagram of inflammatory factors in the SLC group with SLC35E2B overexpression after TPA and LPS stimulation;

[0028] Fig. 9 The figure shows the transcriptomic analysis results of the overexpression group of SLC35E2B gene;

[0029] Fig.10 This is a diagram showing the changes in the MAPK pathway after SLC35E2B gene silencing / overexpression. DETAILED DESCRIPTION

[0030] In order to allow those skilled in the art to understand the present invention more clearly and intuitively, the present invention will be further described below in conjunction with the accompanying drawings.

[0031] The present invention will establish an in vitro culture model of Hacat cells for silencing and overexpressing the SLC35E2B gene. The methods involved are based on SiRNA-induced gene silencing and lentivirus-mediated gene overexpression technology. The main design ideas and specific implementation methods are as follows:

[0032] 1. Construction of Hacat cell model with silencing of SLC35E2B gene

[0033] 1. Design of siRNA sequences

[0034] The siRNA sequence was designed and synthesized by Ruibo Biotechnology Co., Ltd. The sequence with the best transfection efficiency was selected for the experiment, and the targeting sequence was finally selected.

[0035] Table 1SiRNA primer sequences:

[0036] SiRNA 1 GGCTCAGCGTAATCGTTTT(SEQ ID NO.1) SiRNA 2 GGGTCCTGCTCTACAACAA(SEQ ID NO.2)

[0037] 2. Flow chart of the steps of siRNA-induced gene silencing in Hacat cells, see Figure 1 .

[0038] 3. The main experimental technical methods in the design and implementation process are as follows:

[0039] 1) RNA reverse transcription reaction conditions

[0040]

[0041] 2) Real-time fluorescence quantitative PCR reaction conditions:

[0042]

[0043] 3) Transcription primer sequence:

[0044] Primer-SLC35E2B-F: CCTCACGCTGTGGTTCTTCT (SEQ ID NO.3)

[0045] Primer-SLC35E2B-R:TCACACACCGATAACCGTG(SEQ ID NO.4)

[0046] Primer-GAPDH-F: GGAGCCAAAAGGGTCATCATCTC (SEQ ID NO.5)

[0047] Primer-GAPDH-R: GAGGGGCCATCCACAGTCTTCT (SEQ ID NO.6)

[0048] 4) Transfection efficiency analysis: Reverse transcription and real-time fluorescence quantitative PCR were used to compare whether the expression of SLC35E2B at the mRNA level in the siRNA group was lower than that in the blank control group and the negative control group. If the decrease was statistically significant (P

[0049] <0.05), and silencing efficiency>60%, the transfection was successful.

[0050] 4. Results of siRNA-induced SLC35E2B gene silencing in Hacat cells Figure 2 shown.

[0051] 2. Application of Hacat cell model with silencing of SLC35E2B gene

[0052] After the Hacat cells were successfully silenced by siRNA to induce SLC35E2B gene, the secretion of related inflammatory factors was detected after stimulation with TPA and LPS. The expression of Hacat cell differentiation markers was also detected by real-time fluorescence quantitative PCR, cell proliferation was detected by CCK8, and cell apoptosis was detected by Western-Blot and flow cytometry. The results are shown in Figure 3 q-PCR results are as follows Figure 3 As shown in a, there was no significant difference in the expression of cell differentiation-related marker molecules CK-1, CK-10, and Involucrin between the SLC35E2B silencing group (Si group) and the control group; the CCK8 detection results were as shown in Figure 3 As shown in b, the cell proliferation in the Si group increased compared with the negative control group. In addition, the Western-Blot results are shown in Figure 3 As shown in c, there was no significant difference in the expression of apoptosis-related proteins between the Si group and the control group; Figure 3 As shown in (d), flow cytometry results indicated that there was no significant difference in cell apoptosis in the Si group compared with the control group.

[0053] The gene expression profile after silencing the SLC35E2B gene was differentially analyzed by transcriptomics technology, GO analysis, and KEGG enrichment analysis to further confirm the main pathways involved in these differentially expressed genes and further explore the possible mechanism of the effect of the SLC35E2B gene on the function of HaCat cells. The results are shown in Figure 4 . Figure 4 The results of gene differential analysis of a showed that compared with the control group, after silencing the SLC35E2B gene, 3198 genes were relatively upregulated and 3246 genes were relatively downregulated. After knocking down the SLC35E2B gene, GO enrichment was performed on the biological functions of the differentially expressed genes. Figure 4 The results of b suggest that the up-regulated differentially expressed genes are enriched in material transport, DNA replication, protein synthesis, MAPK signaling pathway, cell apoptosis, gene transcription regulation, etc.; the down-regulated genes are enriched in biological enzyme activity, cell signaling pathway, inflammatory factor activation, etc. Figure 4 KEGG analysis of c showed that compared with the control group, the differentially expressed genes in the silencing group were enriched in cell cycle, protein synthesis, apoptosis, p53 signaling pathway, MAPK signaling pathway, NF-κB signaling pathway, TGF-β signaling pathway, etc. Among the differentially expressed genes related to the MAPK pathway, the expression of MAPK1, RAF, BRAF, MAP2K7, etc. was significantly upregulated; the expression of IL-1A, MAP3K, MAP2K1, etc. was significantly downregulated.

[0054] 3. Construction of Hacat cell model with overexpression of SLC35E2B

[0055] 1. Construction of lentiviral expression vector: Determine the species and select the lentiviral expression vector of the target gene sequence, query, verify and synthesize the SLC35E2B gene, and construct the target gene into the lentiviral expression vector.

[0056] 2. Adenovirus-mediated overexpression of SLC35E2B gene in Hacat cells, see Figure 1 .

[0057] 3. The main experimental technical methods in the design and implementation process are as follows:

[0058] 1) The experimental techniques involved in real-time fluorescence quantitative PCR, Western-Blot, CCK8 cell proliferation assay, etc. are the same as above.

[0059] 2) Verification of overexpression effect:

[0060] The total RNA of each group of cells was extracted by TRIZOL method, and the expression of SLC35E2B gene mRNA level was detected by qRT-PCR by reverse transcription and real-time fluorescence quantitative PCR. The expression of SLC35E2B at the mRNA level in the overexpression group was significantly increased compared with that in the control group, and the difference was statistically significant (P < 0.05).

[0061] 3) Transcriptomics technology diagram Figure 5 shown.

[0062] 4. Results of lentivirus-mediated overexpression of SLC35E2B gene in Hacat cells Figure 6 shown.

[0063] IV. Application of Hacat cell model overexpressing SLC35E2B gene

[0064] After the Hacat cells were successfully mediated by lentivirus to overexpress the SLC35E2B gene, the secretion of related inflammatory factors was detected after stimulation with TPA and LPS. The differentiation, proliferation and apoptosis of Hacat cells were detected by real-time fluorescence quantitative PCR, CCK8, Western-Blot and flow cytometry. The results are shown in the attached Figure 7 q-PCR results are as follows Figure 7 As shown in a, there was no significant difference in the expression of cell differentiation-related marker molecules CK-1, CK-10, and Involucrin between the overexpression group and the control group; the CCK8 detection results were as shown in Figure 7 As shown in b, the cell proliferation in the SLC group was reduced compared with that in the control group. In addition, the Western-Blot results were as follows Figure 7 As shown in c, the expression of apoptosis-related proteins in the SLC group was increased compared with the control group, and the difference was statistically significant (P < 0.05); Figure 7 As shown in (d), the results of flow cytometry indicated that compared with the control group, the apoptotic cells in the SLC group were significantly increased, and the difference was statistically significant (P < 0.05).

[0065] The expression of inflammatory factors in the SLC group after TPA and LPS stimulation Figure 8 As shown in the figure, the experimental results suggested that after adding TPA and LPS stimulation, the qRT-PCR method detected that the secretion of several inflammatory factors such as TNF-α, IL-1α, IL-1β, IL-6, IL-17, and IL-23 in the overexpression group was reduced compared with the control group, and the difference was statistically significant (P < 0.05).

[0066] The gene expression profiles were differentially analyzed by transcriptomics technology, GO analysis, and KEGG enrichment analysis to further confirm the main pathways involved in these differentially expressed genes and to further explore the possible mechanism of the effect of SLC35E2B gene on HaCat cell function. Fig. 9 . Fig. 9 The results of gene differential analysis of a showed that compared with the control group, 4799 genes were relatively upregulated and 4269 genes were relatively downregulated in the overexpression group. After overexpression of the SLC35E2B gene, GO enrichment of the biological functions of the differentially expressed genes was performed. Fig. 9 b The results suggested that the up-regulated differentially expressed genes were enriched in processes such as ion transmembrane transport, MAPK cascade positive regulation, and synaptic transmitter transmission; the down-regulated genes were enriched in processes related to cell cycle, DNA repair, cell separation, protein transport, DNA replication, and mitosis. Fig. 9 KEGG analysis of c showed that the down-regulated differential genes in the overexpression group were enriched in proteolysis, cell cycle, amino acid degradation and nucleotide excision repair process; while the up-regulated differential genes were enriched in MAPK signaling pathway, Rap1 signaling pathway, Ras signaling pathway and PI3K-Akt signaling pathway, etc. Among the differentially expressed genes related to the MAPK pathway, MAP2K2, MAP2K2 and MAPK3 were found to be significantly up-regulated.

[0067] In addition, the changes in the MAPK pathway after silencing / overexpression were further studied, and the experimental results were as follows Fig.10 As shown, after knocking down / overexpressing the SLC35E2B gene, it was detected by qRT-PCR and WB methods that after knocking down the gene, the expression of p-p38 in the MAPK pathway was increased and the expression of erk was decreased; after overexpressing the gene, the expression of p-p38 was decreased and the expression of erk was increased.

[0068] The present invention mainly establishes an in vitro culture model of Hacat cells silencing and overexpressing the SLC35E2B gene based on SiRNA-induced gene silencing technology and lentivirus-mediated gene overexpression technology. After the model is successfully constructed, the expression level of the SLC35E2B gene is detected and compared by the RT-PCR method. On this basis, the effect of the SLC35E2B gene on keratinocyte proliferation, apoptosis, differentiation and inflammatory factor secretion can be further explored. At the same time, it provides the main cell experimental materials for studying the pathogenesis of psoriasis and the molecular pathways that may be involved in the SLC35E2B gene by affecting keratinocytes.

[0069] The above description of the embodiments is to facilitate the understanding and application of the present invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the embodiments herein, and improvements and modifications made to the present invention by those skilled in the art based on the disclosure of the present invention should be within the scope of protection of the present invention.

Claims

1. Application of SLC35E2B in the construction of Hacat cell model for psoriasis research.

2. A method for constructing a Hacat cell model for silencing SLC35E2B, characterized in that: The steps include: (1) Designing siRNA primer sequences: According to the information of the SLC35E2B gene and experimental requirements, and based on the principles of primer design, the primer sequences were selected using Primer&Oligo software, and then the primers were synthesized; (2) Selecting the optimal siRNA primer sequence: Select the optimal primer for formal experiments based on the preliminary experimental results and the amplification melting curve; (3) Design of transcription primer sequences: The primer sequences of the SLC35E2B gene were searched on the Genbank platform, and after verification by Primer Blast of PubMED, appropriate sequences were selected and the required primers were synthesized; (4) Transfection: Hacat cells were transfected to obtain Hacat cells with SLC35E2B gene silenced. Transfection was successful when the silencing efficiency was greater than 60%.

3. The method according to claim 2, characterized in that The siRNA primer sequences are as follows:

4. The method according to claim 2, characterized in that: Transcription primer sequences: Primer-SLC35E2B-F: CCTCACGCTGTGGTTCTTCT (SEQ ID NO.3); Primer-SLC35E2B-R:TCACACACCGATAACCGTG(SEQ ID NO.4); Primer-GAPDH-F: GGAGCCAAAAGGGTCATCATCTC (SEQ ID NO.5); Primer-GAPDH-R: GAGGGGCCATCCACAGTCTTCT (SEQ ID NO. 6).

5. A method for constructing a Hacat cell model with overexpression of SLC35E2B, characterized in that: The steps include: (1) Construction of lentiviral expression vector: Determine the species and select the lentiviral expression vector of the target gene sequence, query, verify and synthesize the SLC35E2B gene, and construct the target gene into the lentiviral expression vector; (2) Adenovirus-mediated overexpression of SLC35E2B gene in Hacat cells.

6. SiRNA for silencing SLC35E2B gene, characterized in that The siRNA primer sequences are as follows:

Images