Congenital cataract animal model construction method and application
The animal model of CRYBB1 gene point mutation (Y204X) was constructed through CRISPR/Cas9 technology, which solved the problems of low success rate and poor repeatability of existing congenital cataract animal models, and achieved efficient and controllable animal model construction, suitable for disease mechanism research and drug development.
Patent Information
- Application Number
- CN202510059988.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-15
- Publication Date
- 2025-04-18
AI Technical Summary
The existing animal models of congenital cataract have problems such as low success rate, poor repeatability, and complex operation, which are difficult to effectively reflect the cause of the disease.
An animal model of CRYBB1 gene point mutation (Y204X) was constructed using CRISPR/Cas9 gene editing technology. By designing sgRNA and point mutation repair templates, fertilized eggs or somatic cells were introduced to obtain somatic cells or fertilized eggs with specific mutations.
The constructed animal model has high knockout efficiency, good controllability and repeatability, and is suitable for studying the pathogenic mechanisms of congenital cataracts and drug development, making up for the shortcomings of the existing models.
Smart Images
Figure CN119842827A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, and in particular to a method for constructing a congenital cataract animal model and application thereof. Background Art
[0002] Congenital cataract is one of the main causes of treatable blindness worldwide, with an incidence of 1-15 / 10,000, and the incidence in developing countries is higher than in developed countries. There is currently no specific drug for the treatment of congenital cataracts except for surgery, but surgery cannot cure it. A successful animal model of congenital cataract is the key to studying the pathogenesis and treatment of congenital cataracts.
[0003] At present, it has been found that there are about 100 pathogenic genes related to congenital cataracts, which are mainly inherited in an autosomal dominant manner. Mutations in the gene encoding crystallin account for about half of autosomal dominant cataracts. In the lens of the vertebrate eye, crystallin accounts for more than 95% of the water-soluble structural proteins. At present, there are few animal models that can effectively reflect the cause of the disease. There are many problems such as inconsistent evaluation criteria for the success of the model, poor reproducibility, and complex operation. Therefore, the establishment of a genetically modified congenital cataract animal model has broad application prospects. Summary of the invention
[0004] The purpose of the present invention is to provide a method for constructing a CRYBB1 gene point mutation animal model based on CRISPR / Cas9 technology, so as to provide an effective experimental animal model for the mechanism research of congenital cataracts, as well as drug development and efficacy evaluation.
[0005] The first aspect of the present invention provides a method for constructing an animal model of congenital cataract, the method comprising using CRISPR / Cas9 gene editing technology to obtain somatic cells or fertilized eggs with a CRYBB1 gene with a Y204X mutation; the method comprising:
[0006] Design sgRNA sequence and point mutation repair template sequence according to the target site;
[0007] The obtained Cas9 mRNA, the point mutation repair template and the sgRNA are introduced into the fertilized eggs or somatic cells of the animal to obtain somatic cells or fertilized eggs with the CRYBB1 gene having the Y204X mutation.
[0008] In some embodiments, the sgRNA includes sgRNA1 and sgRNA2; wherein:
[0009] The sequence of sgRNA1 is CGCCAGGCTCCAGCAGATACTGG;
[0010] The sequence of sgRNA2 is CCAGCAGATACTGGTAGCCACGG.
[0011] In some embodiments, the point mutation repair template is a single-stranded oligonucleotide, and the sequence of the single-stranded oligonucleotide is shown in SEQ ID NO:3.
[0012] In some embodiments, the mass ratio of Cas9 mRNA, the point mutation repair template and the sgRNA is (1.5-2.5):(1.5-2.5):1.
[0013] In some embodiments, the mass ratio of sgRNA1 to sgRNA2 is 1:(0.5-1.5).
[0014] In some embodiments, the method of introducing comprises injection.
[0015] In some embodiments, the introducing refers to injecting a solution containing Cas9 mRNA, a point mutation repair template, and sgRNA into the fertilized eggs or somatic cells of the animal.
[0016] In some embodiments, the concentrations of the Cas9 mRNA, point mutation repair template, and sgRNA in the solution are 50-150 ng / μL, 50-150 ng / μL, and 25-75 ng / μL, respectively.
[0017] In some embodiments, the animal is a monkey or a rodent.
[0018] In some embodiments, the rodent is a mouse or a rat.
[0019] In some embodiments, the rodent is a mouse.
[0020] In some embodiments, the construction method further comprises transplanting the obtained fertilized egg with the CRYBB1 gene with the Y204X mutation into the oviduct of a recipient animal for breeding, thereby preparing the congenital cataract animal model;
[0021] Alternatively, the construction method further comprises transplanting the nucleus of a somatic cell having a CRYBB1 gene with a Y204X mutation into an enucleated oocyte, and then transplanting the enucleated oocyte after the nuclear transplantation into the fallopian tube of a recipient animal for breeding, thereby preparing the congenital cataract animal model.
[0022] In some embodiments, the construction method further comprises:
[0023] After breeding, positive F0 generation animals were obtained by screening;
[0024] Positive F0 generation animals are mated with wild-type animals to obtain F1 generation heterozygous animals, and F1 generation heterozygous animals are mated with each other to screen and obtain positive F2 generation homozygous animals, which are the congenital cataract animal model.
[0025] In some embodiments, the offspring obtained by breeding is named as F0 generation animal model; the positive F0 generation animal model obtained through genotype identification and screening is mated with the wild type to breed an F1 generation animal model; the F1 generation heterozygous animal model obtained through genotype identification and screening is hybridized to breed an F2 generation animal model, and the positive F2 generation animal model obtained through genotype identification and screening is obtained, that is, the congenital cataract animal model.
[0026] In some embodiments, screening is performed by PCR amplification and sequencing.
[0027] In some embodiments, the primer sequences for PCR amplification are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0028] In some embodiments, the sequencing primer sequence is shown as SEQ ID NO:6.
[0029] The second aspect of the present invention provides somatic cells, tissues or organs of a congenital cataract animal model obtained by the construction method of the first aspect.
[0030] The third aspect of the present invention provides the use of the congenital cataract animal model obtained by the construction method of the first aspect, and the somatic cells, tissues or organs of the second aspect in screening drugs for preventing and / or treating congenital cataracts or studying the pathogenic mechanism of congenital cataracts.
[0031] The fourth aspect of the present invention provides a kit, the kit comprising an sgRNA sequence and a point mutation repair template sequence; the sgRNA comprises sgRNA1 and sgRNA2; wherein:
[0032] The sequence of sgRNA1 is CGCCAGGCTCCAGCAGATACTGG;
[0033] The sequence of sgRNA2 is CCAGCAGATACTGGTAGCCACGG;
[0034] The point mutation repair template is a single-stranded oligonucleotide, and the sequence of the single-stranded oligonucleotide is shown in SEQ ID NO:3.
[0035] The sgRNA sequence and point mutation repair template sequence in the kit can be used for CRISPR / Cas9 gene editing technology to obtain somatic cells or fertilized eggs with the CRYBB1 gene with Y204X mutation.
[0036] In some embodiments, the kit further contains Cas9 mRNA.
[0037] By introducing the sgRNA sequence, point mutation repair template sequence and Cas9 mRNA in the kit into the fertilized eggs or somatic cells of animals, somatic cells or fertilized eggs with the CRYBB1 gene having the Y204X mutation can be obtained.
[0038] In some embodiments, the kit further contains primers for PCR amplification and primers for sequencing.
[0039] The primers for PCR amplification and sequencing are used to screen out offspring with the integration of exogenous genes from the offspring obtained by transplanting fertilized eggs into the oviducts of recipient animals for breeding.
[0040] In some embodiments, the primer sequences for PCR amplification are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0041] In some embodiments, the sequencing primer sequence is shown as SEQ ID NO:6.
[0042] The beneficial effects of the present invention are:
[0043] The present invention is based on the CRYBB1 gene mutation Y204X (TAT>TAA) found in the genomes of children with congenital cataracts and their immediate family members, and provides a kit for specifically targeting CRYBB1 gene point mutations. The kit can be used to construct a CRYBB1 gene point mutation (Y204X) animal model using CRISPR / Cas9 gene editing technology.
[0044] The animal model of CRYBB1 gene point mutation (Y204X) constructed by the present invention based on CRISPR / Cas9 gene editing technology has the advantages of high knockout efficiency, high controllability, good repeatability, and easy breeding and raising, which makes up for the shortcomings of existing animal models, is more stable, and more in line with clinical characteristics, which is helpful for the study of the pathogenic mechanism of congenital cataract disease and the development of cataract disease drugs; it has good medical clinical application prospects and wide utilization value. BRIEF DESCRIPTION OF THE DRAWINGS
[0045] Figure 1 The present invention uses CRISPR / Cas9 to construct a CRYBB1 gene point mutation congenital cataract animal model construction process.
[0046] Figure 2 This is the sequencing result of F0 generation CRYBB1 gene point mutation mice.
[0047] Figure 3This is the sequencing result of F1 and F2 generation rats with CRYBB1 gene point mutation.
[0048] Figure 4 Mice with point mutations in the CRYBB1 gene suffer from congenital cataracts. Wild type (WT); heterozygous (KI / +); homozygous (KI / KI).
[0049] Figure 5 Hematoxylin-eosin staining of lens sections of mice with CRYBB1 gene point mutation. Wild type (WT); homozygous (KI / KI). DETAILED DESCRIPTION
[0050] The present invention is further described in detail below by specific examples. The raw materials, reagents or devices used in the examples can be obtained from conventional commercial sources or by prior art methods unless otherwise specified. Unless otherwise specified, the experiments or test methods are conventional methods in the art.
[0051] Example 1
[0052] In clinical work, the inventors of the present invention conducted a genetic analysis on a family with congenital cataracts. Whole exome sequencing revealed a new point mutation in the CRYBB1 gene, Y204X, which is a point mutation from TAT to TAA in the sixth exon. Based on the above, the inventors used CRISPR / Cas9 technology to construct a CRYBB1 gene point mutation mouse cataract animal model Y204X (TAT>TAA) ( Figure 1 ).
[0053] The specific steps include:
[0054] (1) Cas9 / gRNA target design
[0055] The nucleotide sequence of the mouse CRYBB1 gene (NM_023695.3) was downloaded from the NCBI database, and homology comparison was performed. According to the mutation site Y204X of the child, the mutation site was determined to correspond to the mutation site Y204X (TAT>TAA) of the CRYBB1 gene on the homologous sequence of the mouse. According to this site sequence, sgRNA sequences were designed, including sgRNA1 and sgRNA2, wherein the nucleotide sequence of sgRNA1 is 5'-CGCCAGGCTCCAGCAGATACTGG-3' (SEQ ID NO: 1), and the nucleotide sequence of sgRNA2 is 5'-CCAGCAGATACTGGTAGCCACGG-3' (SEQ ID NO: 2).
[0056] (2) Design of single strand oligonucleotides (ssODN) as template sequences for point mutation repair
[0057] The ssODN carries a mutation site, the sequence is:
[0058] 5'-TAACACCTTTCCTGCTCCCTTTCCAGATGGGTCGGCTACCAGTACCCAGGTTACC GTGGCTAACAGTATCTGCTGGAGCCTGGCGACTTCCGGCACTGGAACGAGTGGGGCGC CTTCCAGCCG-3' (SEQ ID NO: 3).
[0059] (3) sgRNA in vitro transcription: sgRNA was designed according to the target sequence, and an in vitro transcription vector was constructed. The plasmid was extracted after amplification and digested with DraⅠ and then recovered by gel. The recovered product was used as a template, and in vitro transcription was completed with T7 RNA polymerase. The product was purified by gel recovery and finally concentrated to 50 ng / μL by ethanol precipitation. The mass ratio of sgRNA1 and sgRNA2 was 1:1. It was mixed evenly with Cas9 mRNA (100 ng / μL) and ssODN (100 ng / μL) in Nuclease-free deionized water at a concentration ratio of 1:2:2.
[0060] (4) Preparation of fertilized eggs: 3-4 week old C57BL / 6 female mice were selected and injected with pregnant mare serum (PMSG) and human chorionic gonadotropin (hCG) respectively, with an interval of 46-48 hours between the two. After the injection of HCG, the female mice were mated with adult fertile male mice to fertilize them. The next day, the female mice were euthanized, and the fertilized eggs were collected from the fallopian tubes and placed in a 37°C constant temperature 5% CO2 incubator for later use.
[0061] (5) Pronuclear microinjection: prepare a microinjection needle and a fixing needle; add the prepared injection solution to the microinjection needle; select fertilized eggs with normal morphology and place them in an injection dish. Under an inverted microscope with a magnification of 200-400 times, inject the exogenous gene injection solution into the nucleus of the fertilized egg by microinjection; transfer the injected fertilized eggs to M16 culture medium and place them in a constant temperature 37°C 5% CO2 incubator for 0.5-1 hour before transplantation.
[0062] (6) Preparation of surrogate mice and embryo transplantation
[0063] Prepare pseudo-pregnant female mice: select fertile female mice of appropriate age and mate with male mice that have been sterilized after vasectomy to stimulate a series of pregnancy changes in the female mice to obtain pseudo-pregnant female mice, which will serve as surrogate mice after the genetically modified fertilized eggs; transplant the fertilized eggs that have been injected with foreign genes into the fallopian tubes of surrogate female mice on the day of thrombus formation; after the transplantation, place the surrogate female mice in a clean cage and keep them warm until they wake up and then return them to the cage for breeding; after a successful fallopian tube transplantation, the female mice will generally give birth 19-20 days after the operation; one week after the birth of the pups, the pups can be clipped and numbered, and PCR identification can be performed at the same time; three weeks after the birth of the pups, they can be raised independently in separate cages.
[0064] (7) Identification of F0 mice
[0065] Collect tissues (tail or toe tissues) of 1-2 week old young mice; lyse the tissues and extract the genome; use specific primers for the target gene for PCR amplification and electrophoresis detection to screen out offspring with exogenous gene integration; mice with integration are called founder mice, which can be passaged and established, and the protein expression level can be identified if necessary. Among them, the specific primer sequences used for genotype identification of CRYBB1 gene point mutation mice include Mouse CRYBB1-F (5'-GCCTACAGTGGAGGCATTCACTCC-3', SEQ ID NO: 4) and Mouse CRYBB1-R (5'-TGTGACTACGACCAAGAGTCGCAG-3', SEQ ID NO: 5), the sequencing primer is sequence-F (5'-CATGCTCAAAACAGCAGCCC-3', SEQ ID NO: 6), the PCR amplification system is shown in Table 1, and the amplification program is shown in Table 2.
[0066] Filter results such as Figure 2 As shown, after amplification, the wild-type and mutant sequences are both 582 bp, the wild-type sequence is shown in SEQ ID NO: 7, the CRYBB1 mutant sequence is shown in SEQ ID NO: 8, and the positive F0 mouse obtained by screening is numbered #21.
[0067] Table 1 PCR amplification system
[0068] Reaction components Volume (μL) <![CDATA[2X Premix TaqddH2O]]> 10 <![CDATA[ddH2O]]> 8 Primer F (Mouse CRYBB1-F) 0.5 Primer R (Mouse CRYBB1-R) 0.5 DNATemplate 1 Total 20
[0069] Table 2 PCR amplification program
[0070]
[0071]
[0072] SEQ ID NO:7(WT PCR product):582bp
[0073] gcctacagtggaggcattcactccatctgatcccccaagcatgctcaaaacagcagccccatgactgcccattttacagaagagaatactgaggcctatcagaaagaggaaggccatgctacattaaccagggccggaaaggccaagcccgggcaggtgtggagcccctactgggacactcgctgcaggatgggtgttgataaaggtccgagagggaacgctggcaggcggccttaacacctttcctgctccctttccagatgggtcggctaccagtacccaggttaccgtggctaccagTATctgctggagcctggcgacttccggcactggaacgagtggggcgccttccagccgcagatgcaggctgtgcggcgcctgcgggaccgccagtggcaccaagagggctgcttcccggtgctgacagccgagccccccaagtgagacaagctcccggcctcccttctacagcccgccctgcctcacgtcccatcttcccctactaataaagttcttatagccgatactagcttgggtccatgaaccttatgcacccacctgcgactcttggtcgtagtcaca;
[0074] SEQ ID NO:8(Mutant PCR product):582bp
[0075] , where the uppercase letters represent mutation sites (TAT>TAA).
[0076] (8) The positive F0 mice grown to 8 weeks old were mated with wild-type mice of the opposite sex to obtain F1 mice, and the tail blood was collected for PCR amplification and identification (the detailed process is the same as step (3)) to obtain F1 heterozygous mice. The F1 heterozygous mice grown to 8 weeks old were further crossed to obtain F2 mice, and the tail blood was collected for PCR amplification and identification (the same as above) to obtain positive F2 homozygous mice, which are CRYBB1 (Y204X) gene point mutation mice, and the CRYBB1 (Y204X) gene mutation mouse cataract animal model was constructed ( Figure 3 ).
[0077] Effect Example
[0078] 1. Slit lamp verification of cataract phenotype
[0079] The CRYBB1(Y202X) wild-type (WT), heterozygous (KI / +) and homozygous (KI / KI) mice constructed in Example 1 were examined by slit lamp, and the results showed that the mutant mice had congenital cataract phenotype ( Figure 4 ). It was confirmed that CRYBB1 (Y204X) is indeed the pathogenic genetic variation of congenital cataracts.
[0080] 2. Pathological detection of cataract phenotype in the lens of CRYBB1(Y204X) mutant mice
[0081] Due to the lack of corresponding animal models, the pathological conditions of congenital cataracts caused by CRYBB1 gene mutations are still unclear. We observed the lens tissue sections of mutant mice at embryonic day 16.5 by hematoxylin-eosin staining and found that there were many vacuolar structures in the lens of mutant mice, and the lens fiber cells were arranged irregularly ( Figure 5 ). This finding is consistent with the phenotype of lens nuclear opacity shown by slit lamp examination.
[0082] In summary, this model can be used to study the pathogenic mechanism of congenital cataracts caused by CRYBB1 gene mutation and may have great application value in the development of drugs for the treatment of cataracts.
[0083] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.
Claims
1. A method for constructing an animal model of congenital cataract, the method comprising using CRISPR / Cas9 gene editing technology to obtain somatic cells or fertilized eggs with a CRYBB1 gene with a Y204X mutation; the method comprising: Design sgRNA sequence and point mutation repair template sequence according to the target site; The obtained Cas9 mRNA, the point mutation repair template and the sgRNA are introduced into the fertilized eggs or somatic cells of the animal to obtain somatic cells or fertilized eggs with the CRYBB1 gene having the Y204X mutation.
2. The construction method according to claim 1, characterized in that: The sgRNA includes sgRNA1 and sgRNA2; wherein: The sequence of sgRNA1 is CGCCAGGCTCCAGCAGATACTGG; The sequence of sgRNA2 is CCAGCAGATACTGGTAGCCACGG; Preferably, the point mutation repair template is a single-stranded oligonucleotide, and the sequence of the single-stranded oligonucleotide is shown in SEQ ID NO:
3.
3. The construction method according to claim 2, characterized in that: The mass ratio of Cas9 mRNA, the point mutation repair template and the sgRNA is (1.5-2.5):(1.5-2.5):1; preferably, the mass ratio of sgRNA1 and sgRNA2 is 1:(0.5-1.5).
4. The construction method according to claim 1, characterized in that: The animal is a monkey or a rodent; preferably, the rodent is a mouse or a rat.
5. The construction method according to claim 1, characterized in that: The construction method further comprises transplanting the obtained fertilized egg with the CRYBB1 gene with Y204X mutation into the oviduct of a recipient animal for breeding, thereby preparing the congenital cataract animal model; Alternatively, the construction method further comprises transplanting the nucleus of a somatic cell having a CRYBB1 gene with a Y204X mutation into an enucleated oocyte, and then transplanting the enucleated oocyte after the nuclear transplantation into the fallopian tube of a recipient animal for breeding, thereby preparing the congenital cataract animal model.
6. The construction method according to claim 5, characterized in that: The construction method also includes: After breeding, positive F0 generation animals were obtained by screening; Positive F0 generation animals are mated with wild-type animals to obtain F1 generation heterozygous animals, and F1 generation heterozygous animals are mated with each other to screen and obtain positive F2 generation homozygous animals, which are the congenital cataract animal model.
7. The construction method according to claim 6, characterized in that: Screening was performed by PCR amplification and sequencing.
8. Somatic cells, tissues or organs of a congenital cataract animal model obtained by the construction method according to any one of claims 1 to 7.
9. Use of the congenital cataract animal model obtained by the construction method described in any one of claims 1 to 7, and the somatic cells, tissues or organs described in claim 8 in screening drugs for preventing and / or treating congenital cataracts or studying the pathogenic mechanism of congenital cataracts.
10. A kit comprising a sgRNA sequence and a point mutation repair template sequence; the sgRNA comprises sgRNA1 and sgRNA2; wherein: The sequence of sgRNA1 is CGCCAGGCTCCAGCAGATACTGG; The sequence of sgRNA2 is CCAGCAGATACTGGTAGCCACGG; The point mutation repair template is a single-stranded oligonucleotide, and the sequence of the single-stranded oligonucleotide is shown in SEQ ID NO:3.