Method for synthesizing cinnamyl cinnamate by microorganisms

Abstract

The invention discloses a method for synthesizing cinnamyl cinnamate by microorganisms, and belongs to the field of microbial metabolic engineering.The method comprises the following steps that S1, an aroGfbr gene and a pheAfbr gene are recombined to a carrier pBBR1MCS1, and a carrier pDY001 is obtained; s2, a PA2 gene, an osPMT gene and an hcCNL gene are recombined to a carrier pET28a (+), and a carrier pDY002 is obtained; s3, the CAR gene and the Sfp gene are recombined to a vector pET28b-pSC101, and a vector pDY003 is obtained; s4, the vectors pDY001, pDY002 and pDY003 are expressed in microorganisms, and an engineering bacterium GDY1 is obtained; and S5, fermenting the engineering bacterium GDY1 by using monosaccharide and / or glycerol as a substrate to obtain a fermentation product containing cinnamyl cinnamate. The method disclosed by the invention has the beneficial effects that microorganisms expressing aroGfbr, pheAfbr, PA2, hcCNL, osPMT, CAR and Sfp genes are fermented by using monosaccharide and / or glycerol as a substrate to obtain the fermentation product containing cinnamyl cinnamate, so that microbial conversion from monosaccharide or glycerol to cinnamyl cinnamate can be realized; and a feasible way is provided for large-scale biosynthesis of cinnamyl cinnamate.

Description

Technical Field

[0001] The invention relates to the field of microbial metabolic engineering, and in particular to a method for synthesizing cinnamic cinnamate with microorganisms. Background Art

[0002] Cinnamyl cinnamate is a key flavoring and bioactive compound found in a variety of plants. It is used in a variety of products, including perfumes, shampoos, soaps, household cleaners and detergents, etc. The production of cinnamyl cinnamate via plant extraction and chemical synthesis is inefficient and environmentally unfriendly. Therefore, an attractive alternative is to use microbial cell factories to produce cinnamyl cinnamate from renewable carbon sources.

[0003] Currently, commercialized cinnamate is synthesized by chemical methods or extracted from plants. The chemical synthesis of cinnamate requires the use of toxic catalysts, which will pollute the environment. The plant growth cycle is long, and the content of cinnamate in plants is low, resulting in high costs for obtaining cinnamate by plant extraction. Through biotechnology, the synthesis of cinnamate by microbial fermentation of monosaccharides or glycerol can effectively reduce costs. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a method for synthesizing cinnamic cinnamate by microorganisms, and the present invention is achieved through the following technical solutions.

[0005] A method for synthesizing cinnamate by microorganisms comprises the following steps:

[0006] S1, construction vector pDY001;

[0007] The feedback inhibition of aroG from artificial synthesis fbr pheA fbr The gene was recombined into the vector pBBR1MCS1 to obtain the vector pDY001;

[0008] The aroG fbr is 3-deoxy-2-arabinoheptulose-7-phosphate synthase; the pheA fbr is a bifunctional chorismate mutase / prephenate dehydratase;

[0009] S2, construction vector pDY002;

[0010] The PA2 gene from Arabidopsis thaliana, the osPMT gene from rice, and the hcCNL gene from Hypericum were recombined into the vector pET28a(+) to obtain the vector pDY002;

[0011] The PA2 is phenylalanine ammonia lyase; the osPMT is coumarin monolignol transferase; the hcCNL is cinnamoyl-CoA ligase;

[0012] S3, construction vector pDY003;

[0013] The CAR gene from Mycobacterium marinum and the Sfp gene from Bacillus subtilis were recombined into the vector pET28b-pSC101 to obtain the vector pDY003;

[0014] The CAR is carboxylic acid reductase; the Sfp is phosphopantethein transferase;

[0015] S4, construction of engineered bacteria GDY1;

[0016] The vectors pDY001, pDY002 and pDY003 were expressed in microorganisms to obtain the engineered bacteria GDY1;

[0017] The microorganism is one of bacteria, fungi, actinomycetes or yeast;

[0018] S5, synthetic cinnamate;

[0019] The engineered bacteria GDY1 ferments monosaccharides and / or glycerol as substrates to obtain a fermentation product containing cinnamic cinnamate, wherein the monosaccharides are one or more of glucose, galactose, fructose or xylose.

[0020] Preferably, the microorganism is Escherichia coli BL21 (DE3).

[0021] Preferably, it comprises the sequences SEQ ID NO: 1 to SEQ ID NO: 14, wherein:

[0022] aroG fbr The gene has the nucleotide sequence described in SEQ ID NO: 1, or aroG fbr The gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 2;

[0023] pheA fbr The gene has the nucleotide sequence of SEQ ID NO: 3, or pheA fbr The gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 4;

[0024] The PA2 gene has the nucleotide sequence of SEQ ID NO: 5, or the PA2 gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 6;

[0025] The osPMT gene has the nucleotide sequence of SEQ ID NO: 7, or the osPMT gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 8;

[0026] The hcCNL gene has the nucleotide sequence of SEQ ID NO: 9, or the hcCNL gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10;

[0027] The CAR gene has the nucleotide sequence of SEQ ID NO: 11, or the CAR gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 12;

[0028] The Sfp gene has the nucleotide sequence described in SEQ ID NO:13, or the Sfp gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO:14.

[0029] Preferably, the step S1 includes the following sub-steps:

[0030] S11, synthesized aroG fbr gene as template and primer aroG fbr -XbaI and aroG fbr -SpeI-BamHI, aroG was amplified by PCR fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY01;

[0031] Primer aroG fbr -XbaI gene sequence is:

[0032] GTATCTAGAAAGAGGAGATATAATGAATTATCAGAACGACGATTTACGC;

[0033] Primer aroG fbr -The gene sequence of SpeI-BamHI is:

[0034] TATGGATCCACTAGTTTACCCGCGACGCGCTTTTA;

[0035] S12, with synthetic pheA fbr gene as a template, using primer pheA fbr -XbaI and pheA fbr -SpeI-BamHI, PCR amplification of pheA fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY02;

[0036] Primer pheA fbr -XbaI gene sequence is:

[0037] GTATCTAGAAAGAGGAGATATAATGACATCGGAAAACCCGTTACTG;

[0038] Primer pheA fbr -The gene sequence of SpeI-BamHI is:

[0039] ATATGTCGACACTAGTTCACAACGTGGTTTTCGCCGGA;

[0040] S13, double digest pDY02 with XbaI and SalI to obtain pheA fbr The expression cassette was inserted into the vector pDY01 double-digested with SpeI and SalI to obtain the vector pDY03;

[0041] S14, double digest pDY03 with XbaI and SalI to obtain aroG fbr and pheA fbr The expression cassette was inserted into the vector pBBR1MCS1 double-digested with XbaI and SalI to obtain the vector pDY001.

[0042] Preferably, the step S2 includes the following sub-steps:

[0043] S21, using the PA2 gene as a template, using primers PA2-XbaI and PA2-SpeI-BamHI, the PA2 gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY04;

[0044] The primer PA2-XbaI gene sequence is:

[0045] GACTCTAGAAAGAAGGAGATATAATGGATCAAATCGAAGCAATGTTGTG;

[0046] The gene sequence of primer PA2-SpeI-BamHI is:

[0047] CTTGAGTCGACACTAGTTTAGCAAATCGGAATCGGAGCTCC;

[0048] S22, using the synthesized hcCNL gene as a template, using primers hcCNL-XbaI and hcCNL-SpeI-BamHI, the hcCNL gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY05;

[0049] The gene sequence of primer hcCNL-XbaI is:

[0050] GACTCTAGAAAGAGGAGATATAATGGATAAACTGCCGAAATGCGGCG;

[0051] The gene sequence of primer hcCNL-SpeI-BamHI is:

[0052] TCAGGATCCACTAGTTTACAGGCGGCTCATCGCCAGCA;

[0053] S24, using the synthetic osPMT gene as a template, using primers osPMT-XbaI and osPMT-SpeI-BamHI, the osPMT gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY06;

[0054] The gene sequence of primer osPMT-XbaI is:

[0055] ATCTCTAGATTTAAGAAGGAGATATAATGGGCTTTGCGGTGGTGCGTACCAAC;

[0056] The gene sequence of primer osPMT-SpeI-BamHI is:

[0057] TCAGGATCCACTAGTTTATTTATCAAACGCTTTAATTTCTTC;

[0058] S25, double digest pDY05 with XbaI and XhoI to obtain the hcCNL expression cassette, which was inserted into the vector pDY04 double digested with SpeI and XhoI to obtain the vector pDY07;

[0059] S26, pDY06 was double-digested with XbaI and XhoI to obtain the osPMTL expression cassette, which was inserted into the vector pDY07 double-digested with SpeI and XhoI to obtain the vector pDY002.

[0060] Preferably, the step S3 includes the following sub-steps:

[0061] S31, using the synthetic CAR gene as a template, using primers CAR-XbaI and CAR-SpeI-BamHI, the CAR gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY08;

[0062] The primer CAR-XbaI gene sequence is:

[0063] ATCTCTAGAAAGAAGGAGATATAATGAGTCCGATCACACGCGAG;

[0064] The gene sequence of primer CAR-SpeI-BamHI is:

[0065] AGAGGATCCACTAGTTTACAGCAGGCCTAACAGGCG;

[0066] S32, using the synthetic Sfp gene as a template, using primers Sfp-XbaI and Sfp-SpeI-BamHI, the Sfp gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY09;

[0067] The primer Sfp-XbaI gene sequence is:

[0068] GTCTCTAGAAAGAAGGAGATATAATGAAGATTTACGGAATTTATATGGACCG;

[0069] The gene sequence of primer Sfp-SpeI-BamHI is:

[0070] TGAGGATCCACTAGTTTATAAAAGCTCTTCGTACGAGACCATTGT;

[0071] S33, double digest pDY09 with XbaI and XhoI to obtain the Sfp expression cassette, which was inserted into the vector pDY08 double digested with SpeI and XhoI to obtain the vector pDY10;

[0072] S34, pDY10 was double-digested with XbaI and XhoI to obtain the CAR and Sfp expression cassettes, which were inserted into the vector pET28b-pSC101 double-digested with XbaI and XhoI to obtain the vector pDY003.

[0073] Preferably, the step S5 includes the following sub-steps:

[0074] S41, inoculate the engineered bacteria GDY1 into LB liquid medium and place it on a shaker for overnight culture; then take 0.5 ml of the overnight cultured seed liquid and inoculate it into 50 ml of M9 fermentation medium, add substrate to the M9 fermentation medium, and place it on a shaker for fermentation; wait until the bacterial OD 600 When the pH was 0.7, 0.2 mM IPTG was added to induce the expression of the target gene;

[0075] S42, after 36 hours of fermentation, 5 ml of the fermentation broth was taken, glass beads were added to break up the cells, and finally the product was extracted with an equal volume of ethyl acetate;

[0076] S43, centrifuging the extracted product, and transferring the upper ethyl acetate extract to a GC sample bottle;

[0077] S44, using GC-MS to detect samples, GC-MS is gas chromatography-mass spectrometry.

[0078] Preferably, the temperature of the shaking table is set to 37 degrees and the rotation speed is 180 rpm / min.

[0079] The beneficial effect of the present invention is that the expression of aroG fbr pheA fbr Microorganisms expressing the PA2, hcCNL, osPMT, CAR and Sfp genes can ferment monosaccharides and / or glycerol as substrates to obtain fermentation products containing cinnamic cinnamate, which can realize the microbial conversion of monosaccharides or glycerol to cinnamic cinnamate, and provide a feasible path for large-scale biosynthesis of cinnamic cinnamate. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] In order to more clearly illustrate the technical solution of the present invention, the drawings required for use in the description of the specific implementation methods will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0081] Figure 1 : Biosynthetic pathway of cinnamate;

[0082] Figure 2 : GC-MS test results of fermentation products of blank control strain;

[0083] Figure 3 : GC-MS test results of the fermentation products of the engineered bacteria GDY1;

[0084] Figure 4 : Figure 3 Comparison of the ion fragments of peak 1 with those of cinnamyl alcohol in the standard library;

[0085] Figure 5 : Figure 3 Comparison of the ion fragments of peak 2 with those of phenylethyl propionate in the standard library;

[0086] Figure 6 : Figure 3 Comparison of the ion fragments of peak 4 with those of cinnamyl acetate in the standard library;

[0087] Figure 7 : Figure 3 Comparison of the ion fragments of peak 4 with those of cinnamyl laurate in the standard library. DETAILED DESCRIPTION

[0088] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0089] A method for synthesizing cinnamate by microorganisms comprises the following steps:

[0090] S1, construction of vector pDY001.

[0091] The feedback inhibition of aroG from artificial synthesis fbr pheA fbr The gene was recombined into vector pBBR1MCS1 to obtain vector pDY001.

[0092] aroG fbr 3-deoxy-2-arabinoheptulose-7-phosphate synthase; pheA fbr It is a bifunctional chorismate mutase / prephenate dehydratase.

[0093] Comprising sequences SEQ ID NO: 1 to SEQ ID NO: 4, wherein:

[0094] aroG fbr The gene has the nucleotide sequence of SEQ ID NO: 1, or aroG fbr The gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2;

[0095] pheA fbr The gene has the nucleotide sequence of SEQ ID NO: 3, or pheA fbr The gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:4.

[0096] It includes the following sub-steps:

[0097] S11, synthesized aroG fbr gene as template and primer aroG fbr -XbaI and aroG fbr -SpeI-BamHI, aroG was amplified by PCR fbrgene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY01;

[0098] Primer aroG fbr -XbaI gene sequence is:

[0099] GTATCTAGAAAGAGGAGATATAATGAATTATCAGAACGACGATTTACGC;

[0100] Primer aroG fbr -The gene sequence of SpeI-BamHI is:

[0101] TATGGATCCACTAGTTTACCCGCGACGCGCTTTTA;

[0102] S12, with synthetic pheA fbr gene as template and primer pheA fbr -XbaI and pheA fbr -SpeI-BamHI, PCR amplification of pheA fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY02;

[0103] Primer pheA fbr -XbaI gene sequence is:

[0104] GTATCTAGAAAGAGGAGATATAATGACATCGGAAAACCCGTTACTG;

[0105] Primer pheA fbr -The gene sequence of SpeI-BamHI is:

[0106] ATATGTCGACACTAGTTCACAACGTGGTTTTCGCCGGA;

[0107] S13, double digest pDY02 with XbaI and SalI to obtain pheA fbr The expression cassette was inserted into the vector pDY01 double-digested with SpeI and SalI to obtain the vector pDY03;

[0108] S14, double digest pDY03 with XbaI and SalI to obtain aroG fbr and pheA fbr The expression cassette was inserted into the vector pBBR1MCS1 double-digested with XbaI and SalI to obtain the vector pDY001.

[0109] S2, construction of vector pDY002.

[0110] The PA2 gene from Arabidopsis thaliana, the osPMT gene from rice, and the hcCNL gene from Hypericum were recombined into the vector pET28a(+) to obtain the vector pDY002.

[0111] PA2 is phenylalanine ammonia lyase; osPMT is coumarin monolignol transferase; and hcCNL is cinnamoyl-CoA ligase.

[0112] Comprising sequences SEQ ID NO: 5 to SEQ ID NO: 10, wherein:

[0113] The PA2 gene has a nucleotide sequence of SEQ ID NO: 5, or the PA2 gene has a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 6;

[0114] The osPMT gene has a nucleotide sequence of SEQ ID NO: 7, or the osPMT gene has a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 8;

[0115] The hcCNL gene has the nucleotide sequence of SEQ ID NO:9, or the hcCNL gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:10.

[0116] It includes the following sub-steps:

[0117] S21, using the PA2 gene as a template, using primers PA2-XbaI and PA2-SpeI-BamHI, the PA2 gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY04;

[0118] The primer PA2-XbaI gene sequence is:

[0119] GACTCTAGAAAGAAGGAGATATAATGGATCAAATCGAAGCAATGTTGTG;

[0120] The gene sequence of primer PA2-SpeI-BamHI is:

[0121] CTTGAGTCGACACTAGTTTAGCAAATCGGAATCGGAGCTCC;

[0122] S22, using the synthesized hcCNL gene as a template, using primers hcCNL-XbaI and hcCNL-SpeI-BamHI, the hcCNL gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY05;

[0123] The gene sequence of primer hcCNL-XbaI is:

[0124] GACTCTAGAAAGAGGAGATATAATGGATAAACTGCCGAAATGCGGCG;

[0125] The gene sequence of primer hcCNL-SpeI-BamHI is:

[0126] TCAGGATCCACTAGTTTACAGGCGGCTCATCGCCAGCA;

[0127] S24, using the synthetic osPMT gene as a template, using primers osPMT-XbaI and osPMT-SpeI-BamHI, the osPMT gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY06;

[0128] The gene sequence of primer osPMT-XbaI is:

[0129] ATCTCTAGATTTAAGAAGGAGATATAATGGGCTTTGCGGTGGTGCGTACCAAC;

[0130] The gene sequence of primer osPMT-SpeI-BamHI is:

[0131] TCAGGATCCACTAGTTTATTTATCAAACGCTTTAATTTCTTC;

[0132] S25, double digest pDY05 with XbaI and XhoI to obtain the hcCNL expression cassette, which was inserted into the vector pDY04 double digested with SpeI and XhoI to obtain the vector pDY07;

[0133] S26, pDY06 was double-digested with XbaI and XhoI to obtain the osPMTL expression cassette, which was inserted into the vector pDY07 double-digested with SpeI and XhoI to obtain the vector pDY002.

[0134] S3, construction of vector pDY003.

[0135] The CAR gene from Mycobacterium marinum and the Sfp gene from Bacillus subtilis were recombined into the vector pET28b-pSC101 to obtain the vector pDY003.

[0136] CAR is carboxylate reductase; Sfp is phosphopantethein transferase.

[0137] Comprising sequences SEQ ID NO: 11 to SEQ ID NO: 14, wherein:

[0138] The CAR gene has a nucleotide sequence of SEQ ID NO: 11, or the CAR gene has a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 12;

[0139] The Sfp gene has a nucleotide sequence of SEQ ID NO:13, or the Sfp gene has a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:14.

[0140] It includes the following sub-steps:

[0141] S31, using the synthetic CAR gene as a template, using primers CAR-XbaI and CAR-SpeI-BamHI, the CAR gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY08;

[0142] The primer CAR-XbaI gene sequence is:

[0143] ATCTCTAGAAAGAAGGAGATATAATGAGTCCGATCACACGCGAG;

[0144] The gene sequence of primer CAR-SpeI-BamHI is:

[0145] AGAGGATCCACTAGTTTACAGCAGGCCTAACAGGCG;

[0146] S32, using the synthetic Sfp gene as a template, using primers Sfp-XbaI and Sfp-SpeI-BamHI, the Sfp gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY09;

[0147] The primer Sfp-XbaI gene sequence is:

[0148] GTCTCTAGAAAGAAGGAGATATAATGAAGATTTACGGAATTTATATGGACCG;

[0149] The gene sequence of primer Sfp-SpeI-BamHI is:

[0150] TGAGGATCCACTAGTTTATAAAAGCTCTTCGTACGAGACCATTGT;

[0151] S33, double digest pDY09 with XbaI and XhoI to obtain the Sfp expression cassette, which was inserted into the vector pDY08 double digested with SpeI and XhoI to obtain the vector pDY10;

[0152] S34, pDY10 was double-digested with XbaI and XhoI to obtain the CAR and Sfp expression cassettes, which were inserted into the vector pET28b-pSC101 double-digested with XbaI and XhoI to obtain the vector pDY003.

[0153] S4, construction of engineered bacteria GDY1.

[0154] The vectors pDY001, pDY002 and pDY003 were expressed in microorganisms to obtain the engineered bacteria GDY1.

[0155] aroG fbr pheA fbr , PA2, hcCNL, osPMT, CAR and Sfp genes were highly expressed in Escherichia coli, and the aroGfbr gene and pheAfbr gene that relieve feedback inhibition were expressed to enhance the synthesis of phenylalanine in Escherichia coli. PA2 was expressed to convert phenylalanine into cinnamic acid. hcCNL was expressed to convert cinnamic acid into cinnamoyl-CoA. CAR was expressed to catalyze the conversion of cinnamic acid into cinnamaldehyde. Sfp was expressed to activate the CAR enzyme. Cinnamaldehyde can spontaneously generate cinnamyl alcohol under the catalysis of the aldehyde reductase in the microorganism. osPMT was expressed to catalyze the reaction of cinnamoyl-CoA and cinnamyl alcohol to synthesize cinnamate. The GDY1 engineered bacteria constructed above can effectively convert monosaccharides or glycerol into cinnamyl cinnamate.

[0156] S5, synthesis of cinnamate.

[0157] The engineered bacteria GDY1 ferments monosaccharides and / or glycerol as substrates to obtain a fermentation product containing cinnamic cinnamate, wherein the monosaccharides are one or more of glucose, galactose, fructose or xylose.

[0158] Figure 1 The synthetic pathway of cinnamate using glucose as substrate is shown.

[0159] It includes the following sub-steps:

[0160] S41, inoculate the engineered bacteria GDY1 into LB liquid medium and place it on a shaker for overnight culture; then take 0.5 ml of the overnight cultured seed liquid and inoculate it into 50 ml of M9 fermentation medium, add substrate to the M9 fermentation medium, use 2% glucose as substrate, and place it on a shaker for fermentation; wait until the bacterial OD 600 When the pH was 0.7, 0.2 mM IPTG was added to induce the expression of the target gene;

[0161] S42, after 36 hours of fermentation, 5 ml of the fermentation broth was taken, glass beads were added to break up the cells, and finally the product was extracted with an equal volume of ethyl acetate;

[0162] S43, centrifuging the extracted product, and transferring the upper ethyl acetate extract to a GC sample bottle;

[0163] S44, using GC-MS to detect samples, GC-MS is gas chromatography-mass spectrometry.

[0164] The shaker temperature was set at 37°C and the rotation speed was set at 180 rpm / min.

[0165] The test results are as follows Figure 2-7 As shown, Figure 2 and Figure 3 Peak 2 in the sample is phenylethyl propionate (internal standard). Figure 3 Peak No. 1 in the middle is cinnamyl alcohol. Figure 3 Peak No. 3 in the middle is phenylpropanol acetate; Figure 3 The peak No. 4 in the middle is cinnamyl acetate; Figure 3 Peak No. 5 in the middle is cinnamate.

[0166] The preferred embodiments of the present invention disclosed above are only used to help explain the present invention. The preferred embodiments do not describe all the details in detail, nor do they limit the invention to only specific implementation methods. Obviously, many modifications and changes can be made according to the content of this specification. This specification selects and specifically describes these embodiments in order to better explain the principles and practical applications of the present invention, so that those skilled in the art can understand and use the present invention well. The present invention is limited only by the claims and their full scope and equivalents.

Claims

1. A method for synthesizing cinnamate by microorganisms, characterized in that: The following steps are involved: S1, construction vector pDY001; The feedback inhibition of aroG from artificial synthesis fbr pheA fbr The gene was recombined into the vector pBBR1MCS1 to obtain the vector pDY001; The aroG fbr is 3-deoxy-2-arabinoheptulose-7-phosphate synthase; the pheA fbr is a bifunctional chorismate mutase / prephenate dehydratase; S2, construction vector pDY002; The PA2 gene from Arabidopsis thaliana, the osPMT gene from rice, and the hcCNL gene from Hypericum were recombined into the vector pET28a(+) to obtain the vector pDY002; The PA2 is phenylalanine ammonia lyase; the osPMT is coumarin monolignol transferase; the hcCNL is cinnamoyl-CoA ligase; S3, construction vector pDY003; The CAR gene from Mycobacterium marinum and the Sfp gene from Bacillus subtilis were recombined into the vector pET28b-pSC101 to obtain the vector pDY003; The CAR is carboxylic acid reductase; the Sfp is phosphopantethein transferase; S4, construction of engineered bacteria GDY1; The vectors pDY001, pDY002 and pDY003 were expressed in microorganisms to obtain the engineered bacteria GDY1; The microorganism is one of bacteria, fungi, actinomycetes or yeast; S5, synthetic cinnamate; The engineered bacteria GDY1 ferments monosaccharides and / or glycerol as substrates to obtain a fermentation product containing cinnamic cinnamate, wherein the monosaccharides are one or more of glucose, galactose, fructose or xylose.

2. The method for synthesizing cinnamate by microorganisms according to claim 1, characterized in that: The microorganism is Escherichia coli BL21 (DE3).

3. The method for synthesizing cinnamate by microorganisms according to claim 2, characterized in that: Comprising sequences SEQ ID NO: 1 to SEQ ID NO: 14, wherein: aroG fbr The gene has the nucleotide sequence described in SEQ ID NO: 1, or aroG fbr The gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 2; pheA fbr The gene has the nucleotide sequence of SEQ ID NO: 3, or pheA fbr The gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 4; The PA2 gene has the nucleotide sequence of SEQ ID NO: 5, or the PA2 gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 6; The osPMT gene has the nucleotide sequence of SEQ ID NO: 7, or the osPMT gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 8; The hcCNL gene has the nucleotide sequence of SEQ ID NO: 9, or the hcCNL gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10; The CAR gene has the nucleotide sequence of SEQ ID NO: 11, or the CAR gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 12; The Sfp gene has the nucleotide sequence described in SEQ ID NO:13, or the Sfp gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO:

14.

4. The method for synthesizing cinnamate by microorganisms according to claim 3, characterized in that: The step S1 includes the following sub-steps: S11, synthesized aroG fbr gene as template and primer aroG fbr -XbaI and aroG fbr -SpeI-BamHI, aroG was amplified by PCR fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY01; Primer aroG fbr -XbaI gene sequence is: GTATCTAGAAAGAGGAGATATAATGAATTATCAGAACGACGATTTACGC; Primer aroG fbr -The gene sequence of SpeI-BamHI is: TATGGATCCACTAGTTTACCCGCGACGCGCTTTTA; S12, with synthetic pheA fbr gene as a template, using primer pheA fbr -XbaI and pheA fbr -SpeI-BamHI, PCR amplification of pheA fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY02; Primer pheA fbr -XbaI gene sequence is: GTATCTAGAAAGAGGAGATATAATGACATCGGAAAACCCGTTACTG; Primer pheA fbr -The gene sequence of SpeI-BamHI is: ATATGTCGACACTAGTTCACAACGTGGTTTTCGCCGGA; S13, double digest pDY02 with XbaI and SalI to obtain pheA fbr The expression cassette was inserted into the vector pDY01 double-digested with SpeI and SalI to obtain the vector pDY03; S14, double digest pDY03 with XbaI and SalI to obtain aroG fbr and pheA fbr The expression cassette was inserted into the vector pBBR1MCS1 double-digested with XbaI and SalI to obtain the vector pDY001.

5. The method for synthesizing cinnamate by microorganisms according to claim 4, characterized in that: The step S2 includes the following sub-steps: S21, using the PA2 gene as a template, using primers PA2-XbaI and PA2-SpeI-BamHI, the PA2 gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY04; The primer PA2-XbaI gene sequence is: GACTCTAGAAAGAAGGAGATATAATGGATCAAATCGAAGCAATGTTGTG; The gene sequence of primer PA2-SpeI-BamHI is: CTTGAGTCGACACTAGTTTAGCAAATCGGAATCGGAGCTCC; S22, using the synthesized hcCNL gene as a template, using primers hcCNL-XbaI and hcCNL-SpeI-BamHI, the hcCNL gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY05; The gene sequence of primer hcCNL-XbaI is: GACTCTAGAAAGAGGAGATATAATGGATAAACTGCCGAAATGCGGCG; The gene sequence of primer hcCNL-SpeI-BamHI is: TCAGGATCCACTAGTTTACAGGCGGCTCATCGCCAGCA; S24, using the synthetic osPMT gene as a template, using primers osPMT-XbaI and osPMT-SpeI-BamHI, the osPMT gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY06; The gene sequence of primer osPMT-XbaI is: ATCTCTAGATTTAAGAAGGAGATATAATGGGCTTTGCGGTGGTGCGTACCAAC; The gene sequence of primer osPMT-SpeI-BamHI is: TCAGGATCCACTAGTTTATTTATCAAACGCTTTAATTTCTTC; S25, double digest pDY05 with XbaI and XhoI to obtain the hcCNL expression cassette, which was inserted into the vector pDY04 double digested with SpeI and XhoI to obtain the vector pDY07; S26, pDY06 was double-digested with XbaI and XhoI to obtain the osPMTL expression cassette, which was inserted into the vector pDY07 double-digested with SpeI and XhoI to obtain the vector pDY002.

6. The method for synthesizing cinnamate by microorganisms according to claim 5, characterized in that: The step S3 includes the following sub-steps: S31, using the synthetic CAR gene as a template, using primers CAR-XbaI and CAR-SpeI-BamHI, the CAR gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY08; The primer CAR-XbaI gene sequence is: ATCTCTAGAAAGAAGGAGATATAATGAGTCCGATCACACGCGAG; The gene sequence of primer CAR-SpeI-BamHI is: AGAGGATCCACTAGTTTACAGCAGGCCTAACAGGCG; S32, using the synthetic Sfp gene as a template, using primers Sfp-XbaI and Sfp-SpeI-BamHI, the Sfp gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY09; The primer Sfp-XbaI gene sequence is: GTCTCTAGAAAGAAGGAGATATAATGAAGATTTACGGAATTTATATGGACCG; The gene sequence of primer Sfp-SpeI-BamHI is: TGAGGATCCACTAGTTTATAAAAGCTCTTCGTACGAGACCATTGT; S33, double digest pDY09 with XbaI and XhoI to obtain the Sfp expression cassette, which was inserted into the vector pDY08 double digested with SpeI and XhoI to obtain the vector pDY10; S34, pDY10 was double-digested with XbaI and XhoI to obtain the CAR and Sfp expression cassettes, which were inserted into the vector pET28b-pSC101 double-digested with XbaI and XhoI to obtain the vector pDY003.

7. The method for synthesizing cinnamate by microorganisms according to claim 6, characterized in that: The step S5 includes the following sub-steps: S41, inoculate the engineered bacteria GDY1 into LB liquid medium and place it on a shaker for overnight culture; then take 0.5 ml of the overnight cultured seed liquid and inoculate it into 50 ml of M9 fermentation medium, add substrate to the M9 fermentation medium, and place it on a shaker for fermentation; wait until the bacterial OD 600 When the pH was 0.7, 0.2 mM IPTG was added to induce the expression of the target gene; S42, after 36 hours of fermentation, 5 ml of the fermentation broth was taken, glass beads were added to break up the cells, and finally the product was extracted with an equal volume of ethyl acetate; S43, centrifuging the extracted product, and transferring the upper ethyl acetate extract to a GC sample bottle; S44, using GC-MS to detect samples, GC-MS is gas chromatography-mass spectrometry.

8. The method for synthesizing cinnamate by microorganisms according to claim 7, characterized in that: The temperature of the shaker was set at 37 degrees and the rotation speed was set at 180 rpm / min.

Images