A method for synthesizing cinnamyl cinnamate by microorganisms

Abstract

The present invention discloses a method for synthesizing cinnamyl cinnamate from microorganisms, which belongs to the field of microbial metabolic engineering and comprises the following steps: S1, converting aroG fbr gene and pheA fbr The gene is recombined into the vector pBBR1MCS1 to obtain the vector pDY001; S2, the PA2 gene, the osPMT gene and the hcCNL gene are recombined into the vector pET28a(+) to obtain the vector pDY002; S3, the CAR gene and the Sfp gene are recombined into the vector pET28b-pSC101 to obtain the vector pDY003; S4, the vectors pDY001, pDY002 and pDY003 are expressed in microorganisms to obtain the engineered bacteria GDY1; S5, the engineered bacteria GDY1 is fermented with monosaccharides and / or glycerol as substrates to obtain a fermentation product containing cinnamyl cinnamate. The beneficial effect of the present invention is that the expression of aroG fbr pheA fbr Microorganisms expressing the PA2, hcCNL, osPMT, CAR and Sfp genes ferment monosaccharides and / or glycerol as substrates to obtain fermentation products containing cinnamic cinnamate, which can realize the microbial conversion of monosaccharides or glycerol to cinnamic cinnamate, providing a feasible path for large-scale biosynthesis of cinnamic cinnamate.

Description

Technical Field

[0001] The present invention relates to the field of microbial metabolic engineering, and in particular to a method for synthesizing cinnamic cinnamate with microorganisms. Background Art

[0002] Cinnamyl cinnamate is a key flavoring and bioactive compound found in a variety of plants. It is used in a wide range of products, including perfumes, shampoos, soaps, household cleaners, and detergents. However, the production of cinnamyl cinnamate via plant extraction and chemical synthesis is inefficient and environmentally unfriendly. Therefore, an attractive alternative is to use microbial cell factories to produce cinnamyl cinnamate from renewable carbon sources.

[0003] Currently commercialized cinnamate is synthesized chemically or extracted from plants. Chemical synthesis requires toxic catalysts, which pollute the environment. Plants have long growth cycles and low levels of cinnamate in plants, making plant extraction expensive. Biotechnology can effectively reduce costs by synthesizing cinnamate from monosaccharides or glycerol through microbial fermentation. Summary of the Invention

[0004] To solve the above problems, the present invention provides a method for synthesizing cinnamic cinnamate by microorganisms, which is achieved through the following technical solutions.

[0005] A method for synthesizing cinnamate by microorganisms comprises the following steps:

[0006] S1, construction vector pDY001;

[0007] The feedback inhibition of aroG fbr gene and pheA fbr The gene was recombined into the vector pBBR1MCS1 to obtain vector pDY001;

[0008] The aroG fbr is 3-deoxy-2-arabinoheptulose-7-phosphate synthase; the pheA fbr It is a bifunctional chorismate mutase / prephenate dehydratase;

[0009] S2, construction vector pDY002;

[0010] The PA2 gene from Arabidopsis thaliana, the osPMT gene from rice, and the hcCNL gene from Hypericum were recombined into the vector pET28a(+) to obtain the vector pDY002;

[0011] The PA2 is phenylalanine ammonia lyase; the hcCNL is cinnamoyl-CoA ligase;

[0012] S3, construction vector pDY003;

[0013] The CAR gene from Mycobacterium marinum and the Sfp gene from Bacillus subtilis were recombined into the vector pET28b-pSC101 to obtain the vector pDY003;

[0014] The CAR is carboxylic acid reductase; the Sfp is phosphopantethein transferase;

[0015] S4, construction of engineered bacteria GDY1;

[0016] The vectors pDY001, pDY002 and pDY003 were expressed in microorganisms to obtain the engineered bacterium GDY1;

[0017] The microorganism is one of bacteria, fungi, actinomycetes or yeast;

[0018] S5, synthetic cinnamate;

[0019] The engineered bacteria GDY1 ferments monosaccharides and / or glycerol as substrates to obtain a fermentation product containing cinnamic cinnamate, wherein the monosaccharides are one or more of glucose, galactose, fructose or xylose.

[0020] Preferably, the microorganism is Escherichia coli BL21 (DE3).

[0021] Preferably, wherein:

[0022] aroG fbr The gene is the nucleic acid described in SEQ ID NO: 1, or aroG fbr The gene is a nucleic acid encoding the amino acid described in SEQ ID NO: 2;

[0023] pheA fbr The gene is the nucleic acid described in SEQ ID NO: 3, or pheA fbr The gene is a nucleic acid encoding the amino acid described in SEQ ID NO: 4;

[0024] The PA2 gene is the nucleic acid described in SEQ ID NO: 5, or the PA2 gene is the nucleic acid encoding the amino acid described in SEQ ID NO: 6;

[0025] The hcCNL gene is the nucleic acid described in SEQ ID NO: 7, or the hcCNL gene is the nucleic acid encoding the amino acid described in SEQ ID NO: 8;

[0026] The osPMT gene is the nucleic acid described in SEQ ID NO: 9, or the osPMT gene is the nucleic acid encoding the amino acid described in SEQ ID NO: 10;

[0027] The CAR gene is the nucleic acid of SEQ ID NO: 11, or the CAR gene is the nucleic acid encoding the amino acid of SEQ ID NO: 12;

[0028] The Sfp gene is the nucleic acid described in SEQ ID NO: 13, or the Sfp gene is the nucleic acid encoding the amino acid described in SEQ ID NO: 14.

[0029] Preferably, the step S1 includes the following sub-steps:

[0030] S11, synthesized aroG fbr gene as a template, using primer aroG fbr -XbaI and aroG fbr -SpeI-BamHI, aroG was amplified using PCR technology fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY01;

[0031] Primer aroG fbr -XbaI gene sequence is:

[0032] GTATCTAGAAAGAGGAGATATAATGAATTATCAGAACGACGATTTACGC;

[0033] Primer aroG fbr -The gene sequence of SpeI-BamHI is:

[0034] TATGGATCCACTAGTTTACCCGCGACGCGCTTTTA;

[0035] S12, with synthetic pheA fbr gene as a template, using primer pheA fbr -XbaI and pheA fbr -SpeI-BamHI, pheA amplified by PCR fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY02;

[0036] Primer pheA fbr -XbaI gene sequence is:

[0037] GTATCTAGAAAGAGGAGATATAATGACATCGGAAAACCCGTTACTG;

[0038] Primer pheA fbr-The gene sequence of SpeI-BamHI is:

[0039] ATATGTCGACACTAGTTCACAACGTGGTTTTCGCCGGA;

[0040] S13, double-digest pDY02 with XbaI and SalI to obtain pheA fbr The expression cassette was inserted into the vector pDY01 double-digested with SpeI and SalI to obtain vector pDY03;

[0041] S14, pDY03 was double-digested with XbaI and SalI to obtain aroG fbr and pheA fbr The expression cassette was inserted into the vector pBBR1MCS1 double-digested with XbaI and SalI to obtain the vector pDY001.

[0042] Preferably, the step S2 includes the following sub-steps:

[0043] S21, using the PA2 gene as a template, the PA2 gene was amplified by PCR using primers PA2-XbaI and PA2-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY04;

[0044] The gene sequence of primer PA2-XbaI is:

[0045] GACTCTAGAAAGAAGGAGATATAATGGATCAAATCGAAGCAATGTTGTG;

[0046] The gene sequence of primer PA2-SpeI-BamHI is:

[0047] CTTGAGTCGACACTAGTTTAGCAAATCGGAATCGGAGCTCC;

[0048] S22, using the synthesized hcCNL gene as a template, the hcCNL gene was amplified by PCR using primers hcCNL-XbaI and hcCNL-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY05;

[0049] The gene sequence of primer hcCNL-XbaI is:

[0050] GACTCTAGAAAGAGGAGATATAATGGATAAACTGCCGAAATGCGGCG;

[0051] The gene sequence of primer hcCNL-SpeI-BamHI is:

[0052] TCAGGATCCACTAGTTTACAGGCGGCTCATCGCCAGCA;

[0053] S24, using the synthesized osPMT gene as a template, the primers osPMT-XbaI and osPMT-SpeI-BamHI were used to amplify the osPMT gene by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY06;

[0054] The gene sequence of primer osPMT-XbaI is:

[0055] ATCTCTAGATTTAAGAAGGAGATATAATGGGCTTTGCGGTGGTGCGTACCAAC;

[0056] The gene sequence of the primer osPMT-SpeI-BamHI is:

[0057] TCAGGATCCACTAGTTTATTTATCAAACGCTTTAATTTCTTC;

[0058] S25, pDY05 was double-digested with XbaI and XhoI to obtain the hcCNL expression cassette, which was then inserted into the vector pDY04 double-digested with SpeI and XhoI to obtain vector pDY07;

[0059] S26, pDY06 was double-digested with XbaI and XhoI to obtain the osPMTL expression cassette, which was inserted into the vector pDY07 double-digested with SpeI and XhoI to obtain the vector pDY002.

[0060] Preferably, the step S3 includes the following sub-steps:

[0061] S31, using the synthesized CAR gene as a template, the CAR gene was amplified by PCR using primers CAR-XbaI and CAR-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY08;

[0062] The gene sequence of primer CAR-XbaI is:

[0063] ATCTCTAGAAAGAAGGAGATATAATGAGTCCGATCACACGCGAG;

[0064] The gene sequence of primer CAR-SpeI-BamHI is:

[0065] AGAGGATCCACTAGTTTACAGCAGGCCTAACAGGCG;

[0066] S32, using the synthesized Sfp gene as a template, the Sfp gene was amplified by PCR using primers Sfp-XbaI and Sfp-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY09;

[0067] The primer Sfp-XbaI gene sequence is:

[0068] GTCTCTAGAAAGAAGGAGATATAATGAAGATTTACGGAATTTATATGGACCG;

[0069] The gene sequence of primers Sfp-SpeI-BamHI is:

[0070] TGAGGATCCACTAGTTTATAAAAGCTCTTCGTACGAGACCATTGT;

[0071] S33, double-digest pDY09 with XbaI and XhoI to obtain the Sfp expression cassette, which was inserted into vector pDY08 double-digested with SpeI and XhoI to obtain vector pDY10;

[0072] S34, pDY10 was double-digested with XbaI and XhoI to obtain the CAR and Sfp expression cassettes, which were inserted into the vector pET28b-pSC101 double-digested with XbaI and XhoI to obtain vector pDY003.

[0073] Preferably, the step S5 includes the following sub-steps:

[0074] S41, the engineered bacteria GDY1 was inoculated into LB liquid medium and placed on a shaker for overnight culture; then 0.5 ml of the overnight cultured seed liquid was inoculated into 50 ml of M9 fermentation medium, substrate was added to the M9 fermentation medium, and fermentation was carried out on a shaker; and the bacterial OD 600 When the pH was 0.7, 0.2 mM IPTG was added to induce the expression of the target gene;

[0075] S42, after 36 hours of fermentation, 5 ml of the fermentation broth was collected, glass beads were added to disrupt the cells, and the product was extracted with an equal volume of ethyl acetate;

[0076] S43, centrifuging the extracted product and transferring the upper ethyl acetate extract to a GC sample bottle;

[0077] S44, using GC-MS to detect samples, GC-MS is gas chromatography-mass spectrometry.

[0078] Preferably, the temperature of the shaking table is set to 37 degrees and the rotation speed is 180 rpm / min.

[0079] The beneficial effect of the present invention is that the expression of aroG fbr pheA fbr Microorganisms expressing the PA2, hcCNL, osPMT, CAR and Sfp genes ferment monosaccharides and / or glycerol as substrates to obtain fermentation products containing cinnamic cinnamate, which can realize the microbial conversion of monosaccharides or glycerol to cinnamic cinnamate, providing a feasible path for large-scale biosynthesis of cinnamic cinnamate. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] In order to more clearly illustrate the technical solution of the present invention, the following is a brief introduction to the drawings required for use in the description of the specific implementation methods. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0081] Figure 1 : Biosynthetic pathway of cinnamate;

[0082] Figure 2 : GC-MS test results of fermentation products of blank control strain;

[0083] Figure 3 : GC-MS test results of the fermentation products of the engineered bacteria GDY1;

[0084] Figure 4 : Figure 3 Comparison of the ion fragments of peak 1 with those of cinnamyl alcohol in the standard library;

[0085] Figure 5 : Figure 3 Comparison of the ion fragments of peak 2 with those of phenylethyl propionate in the standard library;

[0086] Figure 6 : Figure 3 Comparison of the ion fragments of peak 4 with those of cinnamyl acetate in the standard library;

[0087] Figure 7 : Figure 3 Comparison of the ion fragments of peak 4 with those of cinnamyl cinnamate in the standard library. DETAILED DESCRIPTION

[0088] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0089] A method for synthesizing cinnamate by microorganisms comprises the following steps:

[0090] S1, construction of vector pDY001.

[0091] The feedback inhibition of aroG fbr gene and pheA fbr The gene was recombined into the vector pBBR1MCS1 to obtain the vector pDY001.

[0092] aroG fbr 3-deoxy-2-arabinoheptulose-7-phosphate synthase; pheA fbr It is a bifunctional chorismate mutase / prephenate dehydratase.

[0093] in:

[0094] aroG fbr The gene is the nucleic acid of SEQ ID NO: 1, or aroG fbr The gene is a nucleic acid encoding the amino acid of SEQ ID NO: 2;

[0095] pheA fbr The gene is the nucleic acid of SEQ ID NO: 3, or pheA fbr The gene is a nucleic acid encoding the amino acid of SEQ ID NO:4.

[0096] The following sub-steps are included:

[0097] S11, synthesized aroG fbr gene as a template, using primer aroG fbr -XbaI and aroG fbr -SpeI-BamHI, aroG was amplified using PCR technology fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY01;

[0098] Primer aroG fbr -XbaI gene sequence is:

[0099] GTATCTAGAAAGAGGAGATATAATGAATTATCAGAACGACGATTTACGC;

[0100] Primer aroG fbr -The gene sequence of SpeI-BamHI is:

[0101] TATGGATCCACTAGTTTACCCGCGACGCGCTTTTA;

[0102] S12, with synthetic pheA fbr gene as a template, using primer pheA fbr -XbaI and pheA fbr -SpeI-BamHI, pheA amplified by PCR fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY02;

[0103] Primer pheA fbr -XbaI gene sequence is:

[0104] GTATCTAGAAAGAGGAGATATAATGACATCGGAAAACCCGTTACTG;

[0105] Primer pheA fbr -The gene sequence of SpeI-BamHI is:

[0106] ATATGTCGACACTAGTTCACAACGTGGTTTTCGCCGGA;

[0107] S13, double-digest pDY02 with XbaI and SalI to obtain pheA fbr The expression cassette was inserted into the vector pDY01 double-digested with SpeI and SalI to obtain vector pDY03;

[0108] S14, pDY03 was double-digested with XbaI and SalI to obtain aroG fbr and pheA fbr The expression cassette was inserted into the vector pBBR1MCS1 double-digested with XbaI and SalI to obtain the vector pDY001.

[0109] S2, construction of vector pDY002.

[0110] The PA2 gene from Arabidopsis thaliana, the osPMT gene from rice, and the hcCNL gene from Hypericum were recombined into the vector pET28a(+) to obtain the vector pDY002.

[0111] PA2 is phenylalanine ammonia lyase; hcCNL is cinnamoyl-CoA ligase.

[0112] in:

[0113] The PA2 gene has the nucleotide sequence of SEQ ID NO: 5, or the PA2 gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 6;

[0114] The hcCNL gene is the nucleic acid of SEQ ID NO: 7, or the hcCNL gene is the nucleic acid encoding the amino acid of SEQ ID NO: 8;

[0115] The osPMT gene is the nucleic acid of SEQ ID NO: 9, or the osPMT gene is the nucleic acid encoding the amino acid of SEQ ID NO: 10.

[0116] The following sub-steps are included:

[0117] S21, using the PA2 gene as a template, the PA2 gene was amplified by PCR using primers PA2-XbaI and PA2-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY04;

[0118] The gene sequence of primer PA2-XbaI is:

[0119] GACTCTAGAAAGAAGGAGATATAATGGATCAAATCGAAGCAATGTTGTG;

[0120] The gene sequence of primer PA2-SpeI-BamHI is:

[0121] CTTGAGTCGACACTAGTTTAGCAAATCGGAATCGGAGCTCC;

[0122] S22, using the synthesized hcCNL gene as a template, the hcCNL gene was amplified by PCR using primers hcCNL-XbaI and hcCNL-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY05;

[0123] The gene sequence of primer hcCNL-XbaI is:

[0124] GACTCTAGAAAGAGGAGATATAATGGATAAACTGCCGAAATGCGGCG;

[0125] The gene sequence of primer hcCNL-SpeI-BamHI is:

[0126] TCAGGATCCACTAGTTTACAGGCGGCTCATCGCCAGCA;

[0127] S24, using the synthesized osPMT gene as a template, the primers osPMT-XbaI and osPMT-SpeI-BamHI were used to amplify the osPMT gene by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY06;

[0128] The gene sequence of primer osPMT-XbaI is:

[0129] ATCTCTAGATTTAAGAAGGAGATATAATGGGCTTTGCGGTGGTGCGTACCAAC;

[0130] The gene sequence of the primer osPMT-SpeI-BamHI is:

[0131] TCAGGATCCACTAGTTTATTTATCAAACGCTTTAATTTCTTC;

[0132] S25, pDY05 was double-digested with XbaI and XhoI to obtain the hcCNL expression cassette, which was then inserted into the vector pDY04 double-digested with SpeI and XhoI to obtain vector pDY07;

[0133] S26, pDY06 was double-digested with XbaI and XhoI to obtain the osPMTL expression cassette, which was inserted into the vector pDY07 double-digested with SpeI and XhoI to obtain the vector pDY002.

[0134] S3, construction of vector pDY003.

[0135] The CAR gene from Mycobacterium marinum and the Sfp gene from Bacillus subtilis were recombined into the vector pET28b-pSC101 to obtain the vector pDY003.

[0136] CAR is carboxylate reductase; Sfp is phosphopantethein transferase.

[0137] in:

[0138] The CAR gene is the nucleic acid of SEQ ID NO: 11, or the CAR gene is the nucleic acid encoding the amino acid of SEQ ID NO: 12;

[0139] The Sfp gene is the nucleic acid of SEQ ID NO: 13, or the Sfp gene is the nucleic acid encoding the amino acid of SEQ ID NO: 14.

[0140] The following sub-steps are included:

[0141] S31, using the synthesized CAR gene as a template, the CAR gene was amplified by PCR using primers CAR-XbaI and CAR-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY08;

[0142] The gene sequence of primer CAR-XbaI is:

[0143] ATCTCTAGAAAGAAGGAGATATAATGAGTCCGATCACACGCGAG;

[0144] The gene sequence of primer CAR-SpeI-BamHI is:

[0145] AGAGGATCCACTAGTTTACAGCAGGCCTAACAGGCG;

[0146] S32, using the synthesized Sfp gene as a template, the Sfp gene was amplified by PCR using primers Sfp-XbaI and Sfp-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY09;

[0147] The gene sequence of primer Sfp-XbaI is:

[0148] GTCTCTAGAAAGAAGGAGATATAATGAAGATTTACGGAATTTATATGGACCG;

[0149] The gene sequence of primers Sfp-SpeI-BamHI is:

[0150] TGAGGATCCACTAGTTTATAAAAGCTCTTCGTACGAGACCATTGT;

[0151] S33, pDY09 was double-digested with XbaI and XhoI to obtain the Sfp expression cassette, which was inserted into the vector pDY08 double-digested with SpeI and XhoI to obtain vector pDY10;

[0152] S34, pDY10 was double-digested with XbaI and XhoI to obtain the CAR and Sfp expression cassettes, which were inserted into the vector pET28b-pSC101 double-digested with XbaI and XhoI to obtain vector pDY003.

[0153] S4, construction of engineered bacteria GDY1.

[0154] The vectors pDY001, pDY002 and pDY003 were expressed in microorganisms to obtain the engineered bacterium GDY1.

[0155] aroG fbr pheA fbr High expression of the PA2, hcCNL, osPMT, CAR, and Sfp genes in Escherichia coli was achieved. Expression of the aroGfbr and pheAfbr genes, which relieve feedback inhibition, enhanced intracellular phenylalanine synthesis in E. coli. PA2 was expressed to convert phenylalanine to cinnamic acid. hcCNL was expressed to convert cinnamic acid to cinnamoyl-CoA. CAR was expressed to catalyze the conversion of cinnamic acid to cinnamaldehyde. Sfp was expressed to activate the CAR enzyme. Cinnamaldehyde can spontaneously generate cinnamyl alcohol under the catalysis of the microorganism's endogenous aldehyde reductase. osPMT was expressed to catalyze the reaction of cinnamoyl-CoA and cinnamyl alcohol to synthesize cinnamate. The engineered GDY1 bacteria constructed above can effectively convert monosaccharides or glycerol into cinnamyl cinnamate.

[0156] S5, synthesis of cinnamate.

[0157] The engineered bacteria GDY1 ferments monosaccharides and / or glycerol as substrates to obtain a fermentation product containing cinnamic cinnamate, wherein the monosaccharides are one or more of glucose, galactose, fructose or xylose.

[0158] Figure 1 The synthetic pathway of cinnamate using glucose as substrate is shown.

[0159] The following sub-steps are included:

[0160] S41, the engineered bacteria GDY1 was inoculated into LB liquid medium and placed on a shaker for overnight culture; then 0.5 ml of the overnight cultured seed liquid was inoculated into 50 ml of M9 fermentation medium, and the substrate was added to the M9 fermentation medium, using 2% glucose as the substrate, and the culture was placed on a shaker for fermentation; when the bacterial OD 600 When the pH was 0.7, 0.2 mM IPTG was added to induce the expression of the target gene;

[0161] S42, after 36 hours of fermentation, 5 ml of the fermentation broth was collected, glass beads were added to disrupt the cells, and the product was extracted with an equal volume of ethyl acetate;

[0162] S43, centrifuging the extracted product and transferring the upper ethyl acetate extract to a GC sample bottle;

[0163] S44, using GC-MS to detect samples, GC-MS is gas chromatography-mass spectrometry.

[0164] The shaker temperature was set at 37°C and the rotation speed was set at 180 rpm / min.

[0165] The test results are as follows Figure 2-7 As shown, Figure 2 and Figure 3 Peak 2 in the sample is phenylethyl propionate (internal standard). Figure 3 Peak No. 1 in the middle is cinnamyl alcohol, Figure 3 Peak No. 3 in the middle is phenylpropanol acetate; Figure 3 Peak No. 4 in the middle is cinnamyl acetate; Figure 3 Peak No. 5 in the middle is cinnamate.

[0166] The preferred embodiments of the present invention disclosed above are intended only to help illustrate the present invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the present invention to specific embodiments. Obviously, many modifications and variations are possible based on the contents of this specification. These embodiments are selected and described in detail in this specification to better explain the principles and practical applications of the present invention, thereby enabling those skilled in the art to better understand and utilize the present invention. The present invention is limited only by the claims and their full scope and equivalents.

Claims

1. A method for synthesizing cinnamate by microorganisms, characterized in that: The following steps are involved: S1, construction vector pDY001; The feedback inhibition of aroG fbr gene and pheA fbr The gene was recombined into the vector pBBR1MCS1 to obtain vector pDY001; The aroG fbr is 3-deoxy-2-arabinoheptulose-7-phosphate synthase; the pheA fbr It is a bifunctional chorismate mutase / prephenate dehydratase; S2, construction vector pDY002; The PA2 gene from Arabidopsis thaliana, the osPMT gene from rice, and the hcCNL gene from Hypericum were recombined into the vector pET28a(+) to obtain the vector pDY002; The PA2 is phenylalanine ammonia lyase; the hcCNL is cinnamoyl-CoA ligase; S3, construction vector pDY003; The CAR gene from Mycobacterium marinum and the Sfp gene from Bacillus subtilis were recombined into the vector pET28b-pSC101 to obtain the vector pDY003; The CAR is carboxylic acid reductase; the Sfp is phosphopantethein transferase; S4, construction of engineered bacteria GDY1; The vectors pDY001, pDY002 and pDY003 were expressed in microorganisms to obtain the engineered bacterium GDY1; The microorganism is Escherichia coli BL21 (DE3); S5, synthetic cinnamate; The engineered bacteria GDY1 ferments glucose as a substrate to obtain a fermentation product containing cinnamic cinnamate.

2. The method for synthesizing cinnamate by microorganisms according to claim 1, wherein in: aroG fbr The gene is a nucleic acid encoding the amino acid described in SEQ ID NO: 2; pheA fbr The gene is a nucleic acid encoding the amino acid described in SEQ ID NO: 4; The PA2 gene is a nucleic acid encoding the amino acid described in SEQ ID NO: 6; The hcCNL gene is a nucleic acid encoding the amino acid described in SEQ ID NO: 8; The osPMT gene is a nucleic acid encoding the amino acid described in SEQ ID NO: 10; The CAR gene is a nucleic acid encoding the amino acid described in SEQ ID NO: 12; The Sfp gene is a nucleic acid encoding the amino acid described in SEQ ID NO:

14.

3. The method for synthesizing cinnamate by microorganisms according to claim 2, wherein: The step S1 includes the following sub-steps: S11, synthesized aroG fbr gene as a template, using primer aroG fbr -XbaI and aroG fbr -SpeI-BamHI, aroG was amplified using PCR technology fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY01; Primer aroG fbr -XbaI gene sequence is: GTATCTAGAAAGAGGAGATATAATGAATTATCAGAACGACGATTTACGC; Primer aroG fbr -The gene sequence of SpeI-BamHI is: TATGGATCCACTAGTTTACCCGCGACGCGCTTTTA; S12, with synthetic pheA fbr gene as a template, using primer pheA fbr -XbaI and pheA fbr -SpeI-BamHI, pheA amplified by PCR fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY02; Primer pheA fbr -XbaI gene sequence is: GTATCTAGAAAGAGGAGATATAATGACATCGGAAAACCCGTTACTG; Primer pheA fbr -The gene sequence of SpeI-BamHI is: ATATGTCGACACTAGTTCACAACGTGGTTTTCGCCGGA; S13, double-digest pDY02 with XbaI and SalI to obtain pheA fbr The expression cassette was inserted into the vector pDY01 double-digested with SpeI and SalI to obtain vector pDY03; S14, pDY03 was double-digested with XbaI and SalI to obtain aroG fbr and pheA fbr The expression cassette was inserted into the vector pBBR1MCS1 double-digested with XbaI and SalI to obtain the vector pDY001.

4. The method for synthesizing cinnamate by microorganisms according to claim 3, wherein: The step S2 includes the following sub-steps: S21, using the PA2 gene as a template, the PA2 gene was amplified by PCR using primers PA2-XbaI and PA2-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY04; The gene sequence of primer PA2-XbaI is: GACTCTAGAAAGAAGGAGATATAATGGATCAAATCGAAGCAATGTTGTG; The gene sequence of primer PA2-SpeI-BamHI is: CTTGAGTCGACACTAGTTTAGCAAATCGGAATCGGAGCTCC; S22, using the synthesized hcCNL gene as a template, the hcCNL gene was amplified by PCR using primers hcCNL-XbaI and hcCNL-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY05; The gene sequence of primer hcCNL-XbaI is: GACTCTAGAAAGAGGAGATATAATGGATAAACTGCCGAAATGCGGCG; The gene sequence of primer hcCNL-SpeI-BamHI is: TCAGGATCCACTAGTTTACAGGCGGCTCATCGCCAGCA; S24, using the synthesized osPMT gene as a template, the primers osPMT-XbaI and osPMT-SpeI-BamHI were used to amplify the osPMT gene by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY06; The gene sequence of primer osPMT-XbaI is: ATCTCTAGATTTAAGAAGGAGATATAATGGGCTTTGCGGTGGTGCGTACCAAC; The gene sequence of the primer osPMT-SpeI-BamHI is: TCAGGATCCACTAGTTTATTTATCAAACGCTTTAATTTCTTC; S25, pDY05 was double-digested with XbaI and XhoI to obtain the hcCNL expression cassette, which was then inserted into the vector pDY04 double-digested with SpeI and XhoI to obtain vector pDY07; S26, pDY06 was double-digested with XbaI and XhoI to obtain the osPMTL expression cassette, which was inserted into the vector pDY07 double-digested with SpeI and XhoI to obtain the vector pDY002.

5. The method for synthesizing cinnamate by microorganisms according to claim 4, wherein: The step S3 includes the following sub-steps: S31, using the synthesized CAR gene as a template, the CAR gene was amplified by PCR using primers CAR-XbaI and CAR-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY08; The gene sequence of primer CAR-XbaI is: ATCTCTAGAAAGAAGGAGATATAATGAGTCCGATCACACGCGAG; The gene sequence of primer CAR-SpeI-BamHI is: AGAGGATCCACTAGTTTACAGCAGGCCTAACAGGCG; S32, using the synthesized Sfp gene as a template, the Sfp gene was amplified by PCR using primers Sfp-XbaI and Sfp-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY09; The gene sequence of primer Sfp-XbaI is: GTCTCTAGAAAGAAGGAGATATAATGAAGATTTACGGAATTTATATGGACCG; The gene sequence of primers Sfp-SpeI-BamHI is: TGAGGATCCACTAGTTTATAAAAGCTCTTCGTACGAGACCATTGT; S33, pDY09 was double-digested with XbaI and XhoI to obtain the Sfp expression cassette, which was inserted into the vector pDY08 double-digested with SpeI and XhoI to obtain vector pDY10; S34, pDY10 was double-digested with XbaI and XhoI to obtain the CAR and Sfp expression cassettes, which were inserted into the vector pET28b-pSC101 double-digested with XbaI and XhoI to obtain vector pDY003.

6. The method for synthesizing cinnamate by microorganisms according to claim 5, wherein: The step S5 includes the following sub-steps: S41, the engineered bacteria GDY1 was inoculated into LB liquid medium and placed on a shaker for overnight culture; then 0.5 ml of the overnight cultured seed liquid was inoculated into 50 ml of M9 fermentation medium, substrate was added to the M9 fermentation medium, and fermentation was carried out on a shaker; and the bacterial OD 600 When the pH was 0.7, 0.2 mM IPTG was added to induce the expression of the target gene; S42, after 36 hours of fermentation, 5 ml of the fermentation broth was collected, glass beads were added to disrupt the cells, and the product was extracted with an equal volume of ethyl acetate; S43, centrifuging the extracted product and transferring the upper ethyl acetate extract to a GC sample bottle; S44, using GC-MS to detect samples, GC-MS is gas chromatography-mass spectrometry.

7. The method for synthesizing cinnamate by microorganisms according to claim 6, wherein: The temperature of the shaker was set at 37 degrees and the rotation speed was set at 180 rpm / min.

Images