Method for synthesizing N-acetyl-L-leucine through microorganisms
By constructing the biosynthesis path of N-acetyl-L-leucine in microorganisms and using vectors pDY001 and pDY002 to express specific genes, the problem of lack of biological methods for synthesis of N-acetyl-L-leucine in the prior art was solved, and the microbial conversion from monosaccharide or glycerol to this drug was achieved, paving the way for large-scale biosynthesis.
Patent Information
- Application Number
- CN202510006795.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-03
- Publication Date
- 2025-04-18
AI Technical Summary
There are currently no reports of biological synthesis of N-acetyl-L-leucine, and there is a lack of methods to achieve large-scale biological production of this drug.
By constructing the artificial biosynthesis pathway of N-acetyl-L-leucine in microorganisms, using vectors pDY001 and pDY002 to express specific genes in microorganisms, fermentation of N-acetyl-L-leucine with monosaccharides or glycerol as substrates is achieved.
The microbial conversion from monosaccharides or glycerol to N-acetyl-L-leucine is achieved, providing a feasible path for large-scale biosynthesis of N-acetyl-L-leucine.
Smart Images
Figure CN119842834A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of microbial metabolic engineering, and in particular to a method for synthesizing N-acetyl-L-leucine by microorganisms. Background Art
[0002] As a compound with important medicinal value, N-acetyl-L-leucine is widely used to treat vertigo and related symptoms, and has shown good beneficial effects in the treatment of diseases such as traumatic brain injuries (TBI), Niemann-Pick disease type C (NPC), and GM2 gangliosidoses.
[0003] There are currently no reports on the biosynthesis of N-acetyl-L-leucine. By constructing an artificial biosynthetic pathway for N-acetyl-L-leucine in microorganisms, it is expected that microorganisms can ferment monosaccharides or glycerol to synthesize N-acetyl-L-leucine, paving the way for large-scale bioproduction of this drug. Summary of the invention
[0004] To solve the above problems, the present invention provides a method for synthesizing N-acetyl-L-leucine by microorganisms, which is achieved through the following technical solutions.
[0005] A method for synthesizing N-acetyl-L-leucine by microorganisms comprises the following steps:
[0006] S1, construction vector pDY001;
[0007] The genes alsS, ilvC, and ilvD were recombined into the vector pBBR1MCS1 to obtain the vector pDY001;
[0008] The alsS is an acetolactate synthase gene; the ilvC is a ketol-acid reductoisomerase gene; and the ilvD is a dihydroxyacid dehydratase gene;
[0009] S2, construction vector pDY002;
[0010] leuA fbr , leuB, leuC, leuD and cdNAT were recombined into the vector pET28a(+) to obtain the vector pDY002;
[0011] The leuA fbris a 2-isopropylmalate synthase gene; the leuB is an isopropylmalate dehydrogenase gene; the leuC is an isopropylmalate isomerase large subunit; the leuD is an isopropylmalate isomerase small subunit; the cdNAT is an N-acetyltransferase gene;
[0012] S3, construction of engineered bacteria GDY1;
[0013] The vectors pDY001 and pDY002 were expressed in microorganisms to obtain the engineered bacteria GDY1;
[0014] The microorganism is bacteria, fungi, actinomycetes or yeast;
[0015] S4, synthesis of N-acetyl-L-leucine;
[0016] The engineered bacteria GDY1 ferments monosaccharides and / or glycerol as substrates to obtain a fermentation product containing N-acetyl-L-leucine.
[0017] Preferably, the microorganism is Escherichia coli BL21 (DE3).
[0018] Preferably, it comprises the sequences SEQ ID NO: 1 to SEQ ID NO: 16, wherein:
[0019] The alsS gene has the nucleotide sequence of SEQ ID NO: 1, or the alsS gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2;
[0020] The ilvC gene has the nucleotide sequence of SEQ ID NO: 3, or the ilvC gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 4;
[0021] The ilvD gene has the nucleotide sequence of SEQ ID NO: 5, or the ilvD gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 6;
[0022] leu fbr The gene has the nucleotide sequence of SEQ ID NO: 7, or leuA fbr The gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 8;
[0023] The leuB gene has the nucleotide sequence of SEQ ID NO: 9, or the leuB gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10;
[0024] The leuC gene has the nucleotide sequence of SEQ ID NO: 11, or the leuC gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 12;
[0025] The leuD gene has the nucleotide sequence of SEQ ID NO: 13, or the leuD gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 14;
[0026] The cdNAT gene has the nucleotide sequence described in SEQ ID NO:15, or the cdNAT gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO:16.
[0027] Preferably, the step S1 includes the following sub-steps:
[0028] S11, using the alsS synthetic gene as a template, using primers alsS-XbaI and alsS-SpeI-BamHI, the alsS gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY01;
[0029] The primer alsS-XbaI gene sequence is:
[0030] GTATCTAGAAAGAGGAGATATAATGACAAAGGCCACCAAGGAGC;
[0031] The gene sequence of primers alsS-SpeI-BamHI is:
[0032] ACTGGATCCACTAGTTTATTACAGTGCTTTTGGTCTTCATCAGCTC;
[0033] S12, using the genome of Escherichia coli BL21 (DE3) as a template, the ilvC gene was amplified by PCR using primers ilvC-XbaI and ilvC-SpeI-BamHI, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain vector pDY02;
[0034] The primer ilvC-XbaI gene sequence is:
[0035] GTATCTAGAAAGAGGAGATATAATGGCTAACTACTTCAATACACTGAATCTG;
[0036] The gene sequence of primer ilvC-SpeI-BamHI is:
[0037] ACTGGATCCACTAGTTTAACCCGCAACAGCAATACGTT;
[0038] S13, using the genome of Escherichia coli BL21 (DE3) as a template, the ilvD gene was amplified by PCR using primers ilvD-XbaI and ilvD-SpeI-BamHI, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain vector pDY03;
[0039] The primer ilvD-XbaI gene sequence is:
[0040] GTATCTAGAAAGAGGAGATATAATGCCTAAGTACCGTTCCGCCA;
[0041] The gene sequence of primers ilvD-SpeI-BamHI is:
[0042] ACTGGATCCACTAGTTTAACCCCCCAGTTTCGATTTATCG;
[0043] S14, double-digest pDY02 with XbaI and SalI to obtain the ilvC expression cassette, and insert it into the vector pDY03 double-digested with SpeI and SalI to obtain the vector pDY04;
[0044] S15, pDY04 was double-digested with XbaI and SalI to obtain the ilvC and ilvD expression cassettes, which were inserted into the vector pDY01 double-digested with SpeI and SalI to obtain the vector pDY05;
[0045] S16, pDY05 was double-digested with XbaI and SalI to obtain the alsS, ilvC and ilvD expression cassettes, which were inserted into the vector pBBRMCS1 double-digested with SpeI and SalI to obtain the vector pDY001.
[0046] Preferably, the step S2 includes the following sub-steps:
[0047] S21, leuA fbr The synthetic gene was used as a template and primer leuA was used fbr -XbaI and leuA fbr -SpeI-BamHI, PCR amplification of leuA fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY06;
[0048] Primer leuA fbr-XbaI gene sequence is:
[0049] ATCTCTAGATTTAAGAAGGAGATATAATGAGCCAGCAAGTCATTATTTTCG;
[0050] Primer leuA fbr -The gene sequence of SpeI-BamHI is:
[0051] TCAGGATCCACTAGTTCACACGGTTTCCTTGTTGTTTTC;
[0052] S22, using the cdNAT synthetic gene as a template, using primers cdNAT-XbaI and cdNAT-SpeI-BamHI, the cdNAT gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY07;
[0053] The gene sequence of primer cdNAT-XbaI is:
[0054] ATCTCTAGATTTAAGAAGGAGATATAATGGCGCAGAACATTACCCTG;
[0055] The gene sequence of primer cdNAT-SpeI-BamHI is:
[0056] CAGGATCCACTAGTTTACAGTTTCAGTTCCATATAGCGC;
[0057] S23, double digest pDY07 with XbaI and XhoI to obtain the cdNAT expression cassette, which was inserted into the vector pDY06 double digested with SpeI and XhoI to obtain the vector pDY08;
[0058] S24, using the genome of Escherichia coli BL21 (DE3) as a template, using primers leuB-XbaI and leuB-SpeI-BamHI, PCR technology was used to amplify the leuB gene, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain vector pDY09;
[0059] The primer leuB-XbaI gene sequence is:
[0060] ATCTCTAGATTTAAGAAGGAGATATAATGTCGAAGAATTACCATATTGCCG;
[0061] The gene sequence of primers leuB-SpeI-BamHI is:
[0062] TCAGGATCCACTAGTTTACACCCCTTCTGCTACATAGCG;
[0063] S25, using the genome of Escherichia coli BL21 (DE3) as a template, the leuC gene was amplified by PCR using primers leuC-XbaI and leuC-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY10;
[0064] The primer leuC-XbaI gene sequence is:
[0065] ATCTCTAGATTTAAGAAGGAGATATAATGGCTAAGACGTTATACGAAAAATTG;
[0066] The gene sequence of primers leuC-SpeI-BamHI is:
[0067] TCAGGATCCACTAGTTTATTTAATGTTGCGAATGTCGGC;
[0068] S26, using the genome of Escherichia coli BL21 (DE3) as a template, the leuD gene was amplified by PCR using primers leuD-XbaI and leuD-SpeI-BamHI, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain the vector pDY11;
[0069] The primer leuD-XbaI gene sequence is:
[0070] ATCTCTAGATTTAAGAAGGAGATATAATGGCAGAGAAATTTATCAAACACAC;
[0071] The gene sequence of primers leuD-SpeI-BamHI is:
[0072] ATCAGTCGACACTAGTTTAATTCATAAACGCAGGTTGTTTTG;
[0073] S27, double digest pDY010 with XbaI and XhoI to obtain the LeuC expression cassette, which was inserted into the vector pDY11 double digested with SpeI and XhoI to obtain the vector pDY12;
[0074] S28, pDY12 was double-digested with XbaI and XhoI to obtain LeuC and expression cassette LeuD, which were inserted into vector pDY09 double-digested with SpeI and XhoI to obtain vector pDY13;
[0075] S29, double-digest pDY13 with XbaI and XhoI to obtain the leuB, LeuC and LeuD expression cassettes, which were inserted into the vector pDY08 double-digested with SpeI and XhoI to obtain the vector pDY002.
[0076] Preferably, the step S4 includes the following sub-steps:
[0077] S41, inoculate the engineered bacteria GDY1 into LB liquid medium and place it on a shaker for overnight culture; then take 0.5 ml of the overnight cultured seed liquid and inoculate it into 50 ml of M9 fermentation medium, add substrate to the M9 fermentation medium, and place it on a shaker for fermentation; wait until the bacterial OD 600 When the pH was 0.7, 0.2 mM IPTG was added to induce the expression of the target gene;
[0078] S42, after 36 hours of fermentation, 5 ml of the fermentation broth was taken, the pH value of the fermentation broth was adjusted to 3 with hydrochloric acid, glass beads were then added to break up the cells, and finally the product was extracted with an equal volume of ethyl acetate;
[0079] S43, centrifuging the extracted product, and transferring the upper ethyl acetate extract to a GC sample bottle;
[0080] S44, using GC-MS to detect samples, GC-MS is gas chromatography-mass spectrometry.
[0081] Preferably, the temperature of the shaking table is set to 37 degrees and the rotation speed is 180 rpm / min.
[0082] The beneficial effect of the present invention is that the expression of alsS, ilvC, ilvD, leuA fbr Microorganisms expressing leuA, leuB, leuC, leuD and cdNAT genes ferment monosaccharides and / or glycerol as substrates to obtain fermentation products containing N-acetyl-L-leucine, which can realize the microbial conversion of monosaccharides or glycerol to N-acetyl-L-leucine and provide a feasible path for large-scale biosynthesis of N-acetyl-L-leucine. BRIEF DESCRIPTION OF THE DRAWINGS
[0083] In order to more clearly illustrate the technical solution of the present invention, the drawings required for use in the description of the specific implementation methods will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0084] Figure 1 :N-acetyl-L-leucine biosynthesis pathway diagram;
[0085] Figure 2 : GC-MS test results of fermentation products of blank control strain;
[0086] Figure 3 : GC-MS test results of the fermentation products of the engineered bacteria GDY1;
[0087] Figure 4 : Figure 3 Comparison of the ion fragments of peak 1 in the middle with the ion fragments of 2-hydroxy-4-methylvaleric acid in the standard library;
[0088] Figure 5 : Figure 3 Comparison of the ion fragments of peak 2 with those of the standard library benzoic acid ion fragments;
[0089] Figure 6 : Figure 3 Alignment of the ion fragments of peak 3 with those of N-acetyl-L-leucine in the standard library. DETAILED DESCRIPTION
[0090] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0091] A method for synthesizing N-acetyl-L-leucine by microorganisms, wherein the microorganisms used in the present invention are bacteria, fungi, actinomycetes or yeasts, and in specific implementation, Escherichia coli BL21 (DE3) is used, comprising the following steps:
[0092] S1, construction of vector pDY001.
[0093] The genes alsS, ilvC and ilvD were recombined into the vector pBBR1MCS1 to obtain the vector pDY001.
[0094] alsS is the acetolactate synthase gene; ilvC is the ketol-acid reductoisomerase gene; ilvD is the dihydroxyacid dehydratase gene.
[0095] Comprising sequences SEQ ID NO: 1 to SEQ ID NO: 6, wherein:
[0096] The alsS gene has a nucleotide sequence of SEQ ID NO: 1, or the alsS gene has a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 2;
[0097] The ilvC gene has the nucleotide sequence of SEQ ID NO: 3, or the ilvC gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 4;
[0098] The ilvD gene has the nucleotide sequence of SEQ ID NO:5, or the ilvD gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:6.
[0099] It includes the following sub-steps:
[0100] S11, using the alsS synthetic gene as a template, using primers alsS-XbaI and alsS-SpeI-BamHI, the alsS gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY01;
[0101] The primer alsS-XbaI gene sequence is:
[0102] GTATCTAGAAAGAGGAGATATAATGACAAAGGCCACCAAGGAGC;
[0103] The gene sequence of primers alsS-SpeI-BamHI is:
[0104] ACTGGATCCACTAGTTTATTACAGTGCTTTTGGTCTTCATCAGCTC;
[0105] S12, using the genome of Escherichia coli BL21 (DE3) as a template, the ilvC gene was amplified by PCR using primers ilvC-XbaI and ilvC-SpeI-BamHI, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain vector pDY02;
[0106] The primer ilvC-XbaI gene sequence is:
[0107] GTATCTAGAAAGAGGAGATATAATGGCTAACTACTTCAATACACTGAATCTG;
[0108] The gene sequence of primer ilvC-SpeI-BamHI is:
[0109] ACTGGATCCACTAGTTTAACCCGCAACAGCAATACGTT;
[0110] S13, using the genome of Escherichia coli BL21 (DE3) as a template, the ilvD gene was amplified by PCR using primers ilvD-XbaI and ilvD-SpeI-BamHI, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain vector pDY03;
[0111] The primer ilvD-XbaI gene sequence is:
[0112] GTATCTAGAAAGAGGAGATATAATGCCTAAGTACCGTTCCGCCA;
[0113] The gene sequence of primers ilvD-SpeI-BamHI is:
[0114] ACTGGATCCACTAGTTTAACCCCCCAGTTTCGATTTATCG;
[0115] S14, double-digest pDY02 with XbaI and SalI to obtain the ilvC expression cassette, and insert it into the vector pDY03 double-digested with SpeI and SalI to obtain the vector pDY04;
[0116] S15, pDY04 was double-digested with XbaI and SalI to obtain the ilvC and ilvD expression cassettes, which were inserted into the vector pDY01 double-digested with SpeI and SalI to obtain the vector pDY05;
[0117] S16, pDY05 was double-digested with XbaI and SalI to obtain the alsS, ilvC and ilvD expression cassettes, which were inserted into the vector pBBRMCS1 double-digested with SpeI and SalI to obtain the vector pDY001.
[0118] S2, construction of vector pDY002.
[0119] leuA fbr , leuB, leuC, leuD and cdNAT were recombined into the vector pET28a(+) to obtain the vector pDY002.
[0120] leu fbris the 2-isopropylmalate synthase gene; leuB is the isopropylmalate dehydrogenase gene; leuC is the isopropylmalate isomerase large subunit; leuD is the isopropylmalate isomerase small subunit; cdNAT is the N-acetyltransferase gene.
[0121] Comprising sequences SEQ ID NO: 7 to SEQ ID NO: 16, wherein:
[0122] leu fbr The gene has the nucleotide sequence of SEQ ID NO: 7, or leuA fbr The gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 8;
[0123] The leuB gene has the nucleotide sequence of SEQ ID NO: 9, or the leuB gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10;
[0124] The leuC gene has the nucleotide sequence of SEQ ID NO: 11, or the leuC gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 12;
[0125] The leuD gene has the nucleotide sequence of SEQ ID NO: 13, or the leuD gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 14;
[0126] The cdNAT gene has a nucleotide sequence of SEQ ID NO:15, or the cdNAT gene has a nucleotide sequence encoding an amino acid sequence of SEQ ID NO:16.
[0127] It includes the following sub-steps:
[0128] S21, leuA fbr The synthetic gene was used as a template and primer leuA was used fbr -XbaI and leuA fbr -SpeI-BamHI, PCR amplification of leuA fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY06;
[0129] Primer leuA fbr -XbaI gene sequence is:
[0130] ATCTCTAGATTTAAGAAGGAGATATAATGAGCCAGCAAGTCATTATTTTCG;
[0131] Primer leuAfbr -The gene sequence of SpeI-BamHI is:
[0132] TCAGGATCCACTAGTTCACACGGTTTCCTTGTTGTTTTC;
[0133] S22, using the cdNAT synthetic gene as a template, using primers cdNAT-XbaI and cdNAT-SpeI-BamHI, the cdNAT gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY07;
[0134] The gene sequence of primer cdNAT-XbaI is:
[0135] ATCTCTAGATTTAAGAAGGAGATATAATGGCGCAGAACATTACCCTG;
[0136] The gene sequence of primer cdNAT-SpeI-BamHI is:
[0137] CAGGATCCACTAGTTTACAGTTTCAGTTCCATATAGCGC;
[0138] S23, double digest pDY07 with XbaI and XhoI to obtain the cdNAT expression cassette, which was inserted into the vector pDY06 double digested with SpeI and XhoI to obtain the vector pDY08;
[0139] S24, using the genome of Escherichia coli BL21 (DE3) as a template, using primers leuB-XbaI and leuB-SpeI-BamHI, PCR technology was used to amplify the leuB gene, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain vector pDY09;
[0140] The primer leuB-XbaI gene sequence is:
[0141] ATCTCTAGATTTAAGAAGGAGATATAATGTCGAAGAATTACCATATTGCCG;
[0142] The gene sequence of primers leuB-SpeI-BamHI is:
[0143] TCAGGATCCACTAGTTTACACCCCTTCTGCTACATAGCG;
[0144] S25, using the genome of Escherichia coli BL21 (DE3) as a template, the leuC gene was amplified by PCR using primers leuC-XbaI and leuC-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY10;
[0145] The primer leuC-XbaI gene sequence is:
[0146] ATCTCTAGATTTAAGAAGGAGATATAATGGCTAAGACGTTATACGAAAAATTG;
[0147] The gene sequence of primers leuC-SpeI-BamHI is:
[0148] TCAGGATCCACTAGTTTATTTAATGTTGCGAATGTCGGC;
[0149] S26, using the genome of Escherichia coli BL21 (DE3) as a template, the leuD gene was amplified by PCR using primers leuD-XbaI and leuD-SpeI-BamHI, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain the vector pDY11;
[0150] The primer leuD-XbaI gene sequence is:
[0151] ATCTCTAGATTTAAGAAGGAGATATAATGGCAGAGAAATTTATCAAACACAC;
[0152] The gene sequence of primers leuD-SpeI-BamHI is:
[0153] ATCAGTCGACACTAGTTTAATTCATAAACGCAGGTTGTTTTG;
[0154] S27, double digest pDY010 with XbaI and XhoI to obtain the LeuC expression cassette, which was inserted into the vector pDY11 double digested with SpeI and XhoI to obtain the vector pDY12;
[0155] S28, pDY12 was double-digested with XbaI and XhoI to obtain LeuC and expression cassette LeuD, which were inserted into vector pDY09 double-digested with SpeI and XhoI to obtain vector pDY13;
[0156] S29, double-digest pDY13 with XbaI and XhoI to obtain the leuB, LeuC and LeuD expression cassettes, which were inserted into the vector pDY08 double-digested with SpeI and XhoI to obtain the vector pDY002.
[0157] S3, construction of engineered bacteria GDY1.
[0158] The vectors pDY001 and pDY002 were expressed in microorganisms to obtain the engineered bacteria GDY1.
[0159] The alsS, ilvC, and ilvD genes are used to enhance the synthesis of 2-ketoisovalerate in Escherichia coli cells;
[0160] Expression of leuA fbr For converting 2-ketoisovalerate into 2-isopropylmalate;
[0161] Expression of leuB, leuC and leuD for conversion of 2-isopropylmalate to 2-ketoisocaproate;
[0162] 2-Ketoisocaproic acid spontaneously generates L-leucine in Escherichia coli under the action of transaminase ilvE;
[0163] cdNAT is expressed to catalyze the reaction of L-leucine and acetyl-CoA to synthesize N-acetyl-L-leucine;
[0164] The GDY1 engineered bacteria constructed above can effectively convert monosaccharides or glycerol into N-acetyl-L-leucine.
[0165] S4, synthesis of N-acetyl-L-leucine.
[0166] The engineered bacteria GDY1 ferments monosaccharides and / or glycerol as substrates to obtain a fermentation product containing N-acetyl-L-leucine.
[0167] Figure 1 The synthetic pathway of N-acetyl-L-leucine using glucose as substrate is shown.
[0168] It includes the following sub-steps:
[0169] S41, inoculate the engineered bacteria GDY1 into LB liquid culture medium and place it on a shaker for overnight culture; then take 0.5 ml of the overnight cultured seed liquid and inoculate it into 50 ml of M9 fermentation medium, add substrate to the M9 fermentation medium, specifically, use 2% glucose as the substrate, and place it on a shaker for fermentation; when the OD600 of the bacteria is 0.7, add 0.2 mM IPTG to induce expression of the target gene.
[0170] The shaker temperature was set at 37°C and the rotation speed was set at 180 rpm / min.
[0171] S42, after 36 hours of fermentation, 5 ml of the fermentation broth was taken, the pH value of the fermentation broth was adjusted to 3 with hydrochloric acid, glass beads were then added to break up the cells, and finally the product was extracted with an equal volume of ethyl acetate;
[0172] S43, centrifuging the extracted product, and transferring the upper ethyl acetate extract to a GC sample bottle;
[0173] S44, using GC-MS to detect samples, GC-MS is gas chromatography-mass spectrometry.
[0174] like Figure 2-6 As shown, Figure 2 and Figure 3 Peak 2 in is benzoic acid (internal standard). Figure 3 Peak No. 1 is 2-hydroxy-4-methylvaleric acid. Figure 3 Peak No. 3 in the middle is N-acetyl-L-leucine.
[0175] The preferred embodiments of the present invention disclosed above are only used to help explain the present invention. The preferred embodiments do not describe all the details in detail, nor do they limit the invention to only specific implementation methods. Obviously, many modifications and changes can be made according to the content of this specification. This specification selects and specifically describes these embodiments in order to better explain the principles and practical applications of the present invention, so that those skilled in the art can understand and use the present invention well. The present invention is limited only by the claims and their full scope and equivalents.
Claims
1. A method for synthesizing N-acetyl-L-leucine by microorganisms, characterized in that: The following steps are involved: S1, construction vector pDY001; The genes alsS, ilvC, and ilvD were recombined into the vector pBBR1MCS1 to obtain the vector pDY001; The alsS is an acetolactate synthase gene; the ilvC is a ketol-acid reductoisomerase gene; and the ilvD is a dihydroxy acid dehydratase gene; S2, construction vector pDY002; leuA fbr , leuB, leuC, leuD and cdNAT were recombined into the vector pET28a(+) to obtain the vector pDY002; The leuA fbr is a 2-isopropylmalate synthase gene; the leuB is an isopropylmalate dehydrogenase gene; the leuC is an isopropylmalate isomerase large subunit; the leuD is an isopropylmalate isomerase small subunit; the cdNAT is an N-acetyltransferase gene; S3, construction of engineered bacteria GDY1; The vectors pDY001 and pDY002 were expressed in microorganisms to obtain the engineered bacteria GDY1; The microorganism is bacteria, fungi, actinomycetes or yeast; S4, synthesis of N-acetyl-L-leucine; The engineered bacteria GDY1 ferments monosaccharides and / or glycerol as substrates to obtain a fermentation product containing N-acetyl-L-leucine.
2. The method for synthesizing N-acetyl-L-leucine by microorganisms according to claim 1, characterized in that: The microorganism is Escherichia coli BL21 (DE3).
3. The method for synthesizing N-acetyl-L-leucine by microorganisms according to claim 2, characterized in that: Comprising sequences SEQ ID NO: 1 to SEQ ID NO: 16, wherein: The alsS gene has the nucleotide sequence of SEQ ID NO: 1, or the alsS gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2; The ilvC gene has the nucleotide sequence of SEQ ID NO: 3, or the ilvC gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 4; The ilvD gene has the nucleotide sequence of SEQ ID NO: 5, or the ilvD gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 6; leu fbr The gene has the nucleotide sequence of SEQ ID NO: 7, or leuA fbr The gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO: 8; The leuB gene has the nucleotide sequence of SEQ ID NO: 9, or the leuB gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10; The leuC gene has the nucleotide sequence of SEQ ID NO: 11, or the leuC gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 12; The leuD gene has the nucleotide sequence of SEQ ID NO: 13, or the leuD gene has the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 14; The cdNAT gene has the nucleotide sequence described in SEQ ID NO:15, or the cdNAT gene has a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO:
16.
4. The method for synthesizing N-acetyl-L-leucine by microorganisms according to claim 3, characterized in that: The step S1 includes the following sub-steps: S11, using the alsS synthetic gene as a template, using primers alsS-XbaI and alsS-SpeI-BamHI, the alsS gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY01; The primer alsS-XbaI gene sequence is: GTATCTAGAAAGAGGAGATATAATGACAAAGGCCACCAAGGAGC; The gene sequence of primers alsS-SpeI-BamHI is: ACTGGATCCACTAGTTTATTACAGTGCTTTTGGTCTTCATCAGCTC; S12, using the genome of Escherichia coli BL21 (DE3) as a template, the ilvC gene was amplified by PCR using primers ilvC-XbaI and ilvC-SpeI-BamHI, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain vector pDY02; The primer ilvC-XbaI gene sequence is: GTATCTAGAAAGAGGAGATATAATGGCTAACTACTTCAATACACTGAATCTG; The gene sequence of primer ilvC-SpeI-BamHI is: ACTGGATCCACTAGTTTAACCCGCAACAGCAATACGTT; S13, using the genome of Escherichia coli BL21 (DE3) as a template, the ilvD gene was amplified by PCR using primers ilvD-XbaI and ilvD-SpeI-BamHI, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain vector pDY03; The primer ilvD-XbaI gene sequence is: GTATCTAGAAAGAGGAGATATAATGCCTAAGTACCGTTCCGCCA; The gene sequence of primers ilvD-SpeI-BamHI is: ACTGGATCCACTAGTTTAACCCCCCAGTTTCGATTTATCG; S14, double-digest pDY02 with XbaI and SalI to obtain the ilvC expression cassette, and insert it into the vector pDY03 double-digested with SpeI and SalI to obtain the vector pDY04; S15, pDY04 was double-digested with XbaI and SalI to obtain the ilvC and ilvD expression cassettes, which were inserted into the vector pDY01 double-digested with SpeI and SalI to obtain the vector pDY05; S16, pDY05 was double-digested with XbaI and SalI to obtain the alsS, ilvC and ilvD expression cassettes, which were inserted into the vector pBBRMCS1 double-digested with SpeI and SalI to obtain the vector pDY001.
5. The method for synthesizing N-acetyl-L-leucine by microorganisms according to claim 4, characterized in that: The step S2 includes the following sub-steps: S21, leuA fbr The synthetic gene was used as a template and primer leuA was used fbr -XbaI and leuA fbr -SpeI-BamHI, PCR amplification of leuA fbr gene, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain vector pDY06; Primer leuA fbr -XbaI gene sequence is: ATCTCTAGATTTAAGAAGGAGATATAATGAGCCAGCAAGTCATTATTTTCG; Primer leuA fbr -The gene sequence of SpeI-BamHI is: TCAGGATCCACTAGTTCACACGGTTTCCTTGTTGTTTTC; S22, using the cdNAT synthetic gene as a template, using primers cdNAT-XbaI and cdNAT-SpeI-BamHI, the cdNAT gene was amplified by PCR technology, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY07; The gene sequence of primer cdNAT-XbaI is: ATCTCTAGATTTAAGAAGGAGATATAATGGCGCAGAACATTACCCTG; The gene sequence of primer cdNAT-SpeI-BamHI is: CAGGATCCACTAGTTTACAGTTTCAGTTCCATATAGCGC; S23, double digest pDY07 with XbaI and XhoI to obtain the cdNAT expression cassette, which was inserted into the vector pDY06 double digested with SpeI and XhoI to obtain the vector pDY08; S24, using the genome of Escherichia coli BL21 (DE3) as a template, using primers leuB-XbaI and leuB-SpeI-BamHI, PCR technology was used to amplify the leuB gene, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain vector pDY09; The primer leuB-XbaI gene sequence is: ATCTCTAGATTTAAGAAGGAGATATAATGTCGAAGAATTACCATATTGCCG; The gene sequence of primers leuB-SpeI-BamHI is: TCAGGATCCACTAGTTTACACCCCTTCTGCTACATAGCG; S25, using the genome of Escherichia coli BL21 (DE3) as a template, the leuC gene was amplified by PCR using primers leuC-XbaI and leuC-SpeI-BamHI, and then the amplified fragment was inserted into pET28a(+) with XbaI and BamHI to obtain the vector pDY10; The primer leuC-XbaI gene sequence is: ATCTCTAGATTTAAGAAGGAGATATAATGGCTAAGACGTTATACGAAAAATTG; The gene sequence of primers leuC-SpeI-BamHI is: TCAGGATCCACTAGTTTATTTAATGTTGCGAATGTCGGC; S26, using the genome of Escherichia coli BL21 (DE3) as a template, the leuD gene was amplified by PCR using primers leuD-XbaI and leuD-SpeI-BamHI, and then the amplified fragment was inserted into pET28a (+) with XbaI and BamHI to obtain the vector pDY11; The primer leuD-XbaI gene sequence is: ATCTCTAGATTTAAGAAGGAGATATAATGGCAGAGAAATTTATCAAACACAC; The gene sequence of primers leuD-SpeI-BamHI is: ATCAGTCGACACTAGTTTAATTCATAAACGCAGGTTGTTTTG; S27, double digest pDY010 with XbaI and XhoI to obtain the LeuC expression cassette, which was inserted into the vector pDY11 double digested with SpeI and XhoI to obtain the vector pDY12; S28, pDY12 was double-digested with XbaI and XhoI to obtain LeuC and expression cassette LeuD, which were inserted into vector pDY09 double-digested with SpeI and XhoI to obtain vector pDY13; S29, double-digest pDY13 with XbaI and XhoI to obtain the leuB, LeuC and LeuD expression cassettes, which were inserted into the vector pDY08 double-digested with SpeI and XhoI to obtain the vector pDY002.
6. The method for synthesizing N-acetyl-L-leucine by microorganisms according to claim 5, characterized in that: The step S4 includes the following sub-steps: S41, inoculate the engineered bacteria GDY1 into LB liquid medium and place it on a shaker for overnight culture; then take 0.5 ml of the overnight cultured seed liquid and inoculate it into 50 ml of M9 fermentation medium, add substrate to the M9 fermentation medium, and place it on a shaker for fermentation; wait until the bacterial OD 600 When the pH was 0.7, 0.2 mM IPTG was added to induce the expression of the target gene; S42, after 36 hours of fermentation, 5 ml of the fermentation broth was taken, the pH value of the fermentation broth was adjusted to 3 with hydrochloric acid, glass beads were then added to break up the cells, and finally the product was extracted with an equal volume of ethyl acetate; S43, centrifuging the extracted product, and transferring the upper ethyl acetate extract to a GC sample bottle; S44, using GC-MS to detect samples, GC-MS is gas chromatography-mass spectrometry.
7. The method for synthesizing N-acetyl-L-leucine by microorganisms according to claim 6, characterized in that: The temperature of the shaker was set at 37 degrees and the rotation speed was set at 180 rpm / min.