Joint detection kit for 29 parasites

Abstract

The invention relates to a joint detection kit for 29 parasites. The joint detection kit comprises a detection primer and probe combination of 29 parasites. By using the kit disclosed by the invention, whether a clinical sample to be detected belongs to one of 29 parasites or not can be detected by only one test; the detection sensitivity of the kit disclosed by the invention is not lower than 1000 copies / ml; the detection coincidence rate and precision of the kit provided by the invention are 100%; 4) no cross reaction exists among detection items of the kit; a small amount of blood, purulent secretions, low-concentration antibiotics, antiviral drugs and other potential interferents have no obvious influence on the detection result.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection, and in particular to the technical field of a 29-item combined detection kit for parasites. Background Art

[0002] Parasites are often found in samples such as blood, feces and reproductive system secretions. However, due to the variety of parasites, common parasites include: Hymenolepidium microtyphus, Clonorchis sinensis, Balantidium intestinalis, Angiostrongylus cantonensis, Schistosoma japonicum, Fasciola hepatica, Cryptosporidium microtyphus, Giardia lamblia, Necator americanus, Ancylostoma duodenale, Taenia asiatica, Taenia saginata, Taenia solium, Entamoeba histolytica, Toxoplasma gondii, Blastocystis hominis, Trichomonas vaginalis, Strongyloides stercoralis, Wuchereria bancrofti, Trichinella spiralis, Ascaris lumbricoides, Spirometra mansoni, Echinococcus granulosus, Echinococcus multilocularis, Paragonimus, Leishmania donovani, Pinworm, Fasciola busuli and Whipworm.

[0003] At present, parasites need to be tested and screened one by one, which is time-consuming and labor-intensive and cannot meet the needs of rapid and accurate detection. Therefore, a 29-item combined detection kit for parasites is urgently needed to meet the needs of rapid and accurate detection of multiple types of parasites. Summary of the invention

[0004] In order to solve the above problems and defects, the present invention provides a 29-item combined detection kit for parasites.

[0005] The present invention is implemented by the following technical solution.

[0006] A 29-item combined detection kit for parasites, the kit comprising a gene chip, the gene chip comprising probe combinations for Hymenolepidium microti, Clonorchis sinensis, Balantidium coli, Angiostrongylus cantonensis, Schistosoma japonicum, Fasciola hepatica, Cryptosporidium microti, Giardia lamblia, Necator americanus, Ancylostoma duodenale, Taenia asiatica, Taenia saginata, Taenia solium, Entamoeba histolytica, Toxoplasma gondii, Blastocystis hominis, Trichomonas vaginalis, Strongyloides stercoralis, Wuchereria bancrofti, Trichinella spiralis, Ascaris lumbricoides, Spirometra mansoni, Echinococcus granulosus, Echinococcus multilocularis, Paragonimus, Leishmania donovani, Pinworm, Fasciola brasiliensis and Whipworm; wherein the primers and probes for detecting Hymenolepidium microti: the primer sequences are as shown in SEQ.01, SE. Q.02, the probe sequence is shown in SEQ.03; the primers and probes for detecting Clonorchis sinensis: the primer sequences are shown in SEQ.04 and SEQ.05, and the probe sequence is shown in SEQ.06; the primers and probes for detecting Balantidium coli: the primer sequences are shown in SEQ.07 and SEQ.08, and the probe sequence is shown in SEQ.09; the primers and probes for detecting Angiostrongylus cantonensis: the primer sequences are shown in SEQ.10 and SEQ.11, and the probe sequence is shown in SEQ.12; the primers and probes for detecting Schistosoma japonicum: the primer sequences are shown in SEQ.13 and SEQ.14, and the probe sequence is shown in SEQ.15; the primers and probes for detecting Fasciola hepatica: the primer sequences are shown in SEQ.16 and SEQ.17. .17, and the probe sequence is shown in SEQ.18; primers and probes for detecting Cryptosporidium parvum: primer sequences are shown in SEQ.19 and SEQ.20, and the probe sequence is shown in SEQ.21; primers and probes for detecting Giardia lamblia: primer sequences are shown in SEQ.22 and SEQ.23, and the probe sequence is shown in SEQ.24; primers and probes for detecting Necator americanus: primer sequences are shown in SEQ.25 and SEQ.26, and the probe sequence is shown in SEQ.27; primers and probes for detecting Ancylostoma duodenale: primer sequences are shown in SEQ.28 and SEQ.29, and the probe sequence is shown in SEQ.30; primers and probes for detecting Taenia asiatica: primer sequences are shown in SEQ.31, S SEQ.32, the probe sequence is shown in SEQ.33; the primers and probes for detecting Taenia saginata: the primer sequences are shown in SEQ.34 and SEQ.35, and the probe sequence is shown in SEQ.36; the primers and probes for detecting Taenia solium: the primer sequences are shown in SEQ.37 and SEQ.38, and the probe sequence is shown in SEQ.39; the primers and probes for detecting Entamoeba histolytica: the primer sequences are shown in SEQ.40 and SEQ.41, and the probe sequence is shown in SEQ.42; the primers and probes for detecting Toxoplasma gondii: the primer sequences are shown in SEQ.43 and SEQ.44, and the probe sequence is shown in SEQ.45; the primers and probes for detecting Blastocystis hominis: the primer sequences are shown in SEQ.46 and SEQ.47, and the probe sequence is shown in SEQ.48; the primers and probes for detecting Trichomonas vaginalis: the primer sequences are shown in SEQ.49 and SEQ.50, and the probe sequence is shown in SEQ.51; the primers and probes for detecting Strongyloides stercoralis: the primer sequences are shown in SEQ.52 and SEQ.53, and the probe sequence is shown in SEQ.54; the primers and probes for detecting Wuchereria bancrofti: the primer sequences are shown in SEQ.55 and SEQ.56, and the probe sequence is shown in SEQ.57; the primers and probes for detecting Trichinella spiralis: the primer sequences are shown in SEQ.58 and SEQ.59, and the probe sequence is shown in SEQ.60; the primers and probes for detecting Ascaris lumbricoides are shown in SEQ.61 and SEQ.62, and the probe sequence is shown in SEQ.63; the primers and probes for detecting Spirometra mansoni: the primer sequences are shown in SEQ.64 and SEQ.65, and the probe sequence is shown in SEQ.66; the primers and probes for detecting Echinococcus granulosus: the primers The sequences are shown in SEQ.67 and SEQ.68, and the probe sequence is shown in SEQ.69; the primers and probes for detecting Echinococcus multilocularis: the primer sequences are shown in SEQ.70 and SEQ.71, and the probe sequence is shown in SEQ.72; the primers and probes for detecting Paragonimus: the primer sequences are shown in SEQ.73 and SEQ.74, and the probe sequence is shown in SEQ.75; the primers and probes for detecting Leishmania donovani: the primer sequences are shown in SEQ.76 and SEQ.77, and the probe sequence is shown in SEQ.78; the primers and probes for detecting Pinworm: the primer sequences are shown in SEQ.79 and SEQ.80, and the probe sequence is shown in SEQ.81; the primers and probes for detecting Fasciola bradyphila: the primer sequences are shown in SEQ.82 and SEQ.83, and the probe sequence is shown in SEQ.84; the primers and probes for detecting Whipworm: the primer sequences are shown in SEQ.85 and SEQ.86, and the probe sequence is shown in SEQ.87.

[0007] Furthermore: the gene chip also includes a control probe IC and a control probe HC.

[0008] Furthermore: the probe sequence of the control probe IC is shown in SEQ.88.

[0009] Furthermore: the probe sequence of the control probe HC is shown in SEQ.89.

[0010] Furthermore: the kit includes an operating instruction, and the steps of preparing genomic nucleic acid from the sample to be tested in the operating instruction include sample preparation, reagent plate preparation, reagent plate loading, machine extraction, installation of magnetic rod sleeve, and nucleic acid transfer.

[0011] Furthermore: the kit includes an operating instruction, which records the PCR reaction system: 5 μl of sample; 12.5 μl of PCR amplification reagent mixture; 7.5 μl of PCR amplification primer mixture; and a total volume of 25.0 μl.

[0012] Furthermore: the PCR amplification reagent mixture includes Hot start Taq enzyme, dNTP, and a buffer system.

[0013] Further: the kit includes an operating instruction manual, which records the PCR reaction parameters: 94°C for 5 minutes, 1 cycle; 94°C for 30 seconds, 54°C for 40 seconds, 72°C for 1 minute, 36 cycles; 72°C for 5 minutes for 1 cycle; maintain at 12°C.

[0014] Furthermore: the operating instructions also include chip hybridization, and the steps of chip hybridization are: the constant temperature hot plate is heated to a constant temperature of 42°C, and the chip is fixed with a hybridization module preheated at 42°C; the PCR product is taken out of the amplifier and placed in an ice bath; after the PCR product is added to the hybridization solution according to the hybridization system, it is blown and mixed, and the mixture is dripped into the corresponding microarray reaction chamber from the sample addition hole, and hybridized at 42°C for 30 minutes.

[0015] Furthermore: the hybridization system includes PCR products and 10% hybridization solution; the volume ratio of the PCR products to 10% hybridization solution is 1:4.

[0016] This kit uses DNA polymerase chain reaction (PCR) Reaction) technology is used to amplify and fluorescently label the sample to be tested, and the amplified labeled product is hybridized with the specific probe on the gene chip. The hybridization data is obtained by a fluorescent scanning device, and the detection data is analyzed to determine whether the sample to be tested contains specific nucleic acids of Hymenolepidium microti, Clonorchis sinensis, Balantidium coli, Angiostrongylus cantonensis, Schistosoma japonicum, Fasciola hepatica, Cryptosporidium microti, Giardia lamblia, Necator americanus, Ancylostoma duodenale, Taenia asiatica, Taenia saginata, Taenia solium, Entamoeba histolytica, Toxoplasma gondii, Blastocystis hominis, Trichomonas vaginalis, Strongyloides stercoralis, Wuchereria bancrofti, Trichinella spiralis, Ascaris lumbricoides, Spirometra mansoni, Echinococcus granulosus, Echinococcus multilocularis, Paragonimus, Leishmania donovani, Pinworm, Fasciola brachyurus and Whipworm, so as to perform qualitative analysis. Specific primer or probe names and sequences are shown in the table below:

[0017]

[0018]

[0019]

[0020] The beneficial effects of the present invention are:

[0021] 1) Using the kit of the present invention, only one test is required to determine whether the clinical sample to be tested belongs to one of the 29 parasites; 2) The detection sensitivity of the kit of the present invention is not less than 1000 copies / ml; 3) The compliance rate and precision detection of the kit of the present invention are both 100%; 4) There is no cross-reaction between the detection items of the kit; potential interferences such as a small amount of blood, purulent secretions, low-concentration antibiotics, antiviral drugs, etc. have no obvious effect on the detection results. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a schematic diagram of the chip probe layout of the present invention.

[0023] Figure 2 Schematic diagram of the location of the microarray area on the chip of the present invention.

[0024] Figure 3 This is a diagram of the positive quality control test results in an embodiment of the present invention.

[0025] Figure 4 This is a negative quality control test result diagram in an embodiment of the present invention.

[0026] Figure 5 This is a graph showing the clinical negative sample test results of sample 1 in Example 3 of the present invention.

[0027] Figure 6 This is a graph showing the clinical positive sample detection results of sample 2 in Example 3 of the present invention.

[0028] Figure 7 This is a graph showing the clinical positive sample detection results of sample 3 in Example 3 of the present invention.

[0029] Figure 8 This is a graph showing the clinical negative sample test results of sample 4 in Example 3 of the present invention.

[0030] Fig. 9 This is a graph showing the clinical positive sample detection results of sample 5 in Example 5 of the present invention.

[0031] Fig.10 This is a graph showing the clinical positive sample detection results of sample 6 in Example 5 of the present invention.

[0032] Fig.11 This is a graph showing the clinical positive sample detection results of sample 7 in Example 5 of the present invention.

[0033] Fig.12 This is a graph showing the clinical positive sample detection results of sample 8 in Example 5 of the present invention.

[0034] Fig.13This is a graph showing the clinical positive sample detection results of sample 9 in Example 5 of the present invention.

[0035] Fig.14 This is a graph showing the clinical negative sample test results of sample 10 in Example 5 of the present invention. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0037] Example 1

[0038] Probes were designed for 29 infectious parasites, including Hymenolepidium microtyphoid, Clonorchis sinensis, Balantidium coli, Angiostrongylus cantonensis, Schistosoma japonicum, Fasciola hepatica, Cryptosporidium microtyphoid, Giardia lamblia, Necator americanus, Ancylostoma duodenale, Taenia asiatica, Taenia saginata, Taenia solium, Entamoeba histolytica, Toxoplasma gondii, Blastocystis hominis, Trichomonas vaginalis, Strongyloides stercoralis, Wuchereria bancrofti, Trichinella spiralis, Ascaris lumbricoides, Spirometra mansoni, Echinococcus granulosus, Echinococcus multilocularis, Paragonimus, Leishmania donovani, Pinworm, Fasciola brasiliensis and Whipworm. The specific steps are as follows: Construction of a gene database for 29 infectious parasites: The reference genome sequences contained in the database are used to construct specific probes for the 29 infectious parasites. The NCBI NT database (ftp: / / ftp.ncbi.nlm.nih.gov / blast / db / FASTA / nt.gz), RefSeq and Ge n The genome sequences of 29 infectious parasites were obtained from multiple authoritative databases in this field, such as the National Natural Science Foundation of China (NTF-1) and the Parasite Reference Sequence Database (https: / / eupathdb.org / eupathdb). Redundant and less reliable genome sequences were further removed. The removal principle was as follows: an upper limit of 50 strains was set for each parasite. If the number of strains exceeded 50, 50 reference genomes were randomly retained to ensure the simplicity, completeness, accuracy and comprehensiveness of the microbial sequences, and to improve the coverage, sensitivity and quality of the probe sequences.

[0039] After the above steps, the final database contains comprehensive and complete genome sequences of 29 parasites. Specifically, the number of strains with complete reference genomes contained in each parasite species is: 3 strains of Hymenolepidium microtypingii, 5 strains of Clonorchis sinensis, 4 strains of Balantidium coli, 6 strains of Angiostrongylus cantonensis, 4 strains of Schistosoma japonicum, 8 strains of Fasciola hepatica, 4 strains of Cryptosporidium microtypingi, 2 strains of Giardia lamblia, 2 strains of Ancylostoma americanum, and 2 strains of Uncinaria duodenalis. 4 strains of Orthostoma stolonifer, 4 strains of Asian tapeworm, 5 strains of Taenia saginata, 6 strains of Taenia solium, 2 strains of Entamoeba histolytica, 3 strains of Toxoplasma gondii, 2 strains of Blastocystis hominis, 3 strains of Trichomonas vaginalis, 2 strains of Strongyloides stercoralis, 2 strains of Wuchereria bancrofti, 2 strains of Trichinella spiralis, 8 strains of Ascaris lumbricoides, 4 strains of Spirochete mansoni, 3 strains of Echinococcus granulosus, 2 strains of Echinococcus multilocularis, 2 strains of Paragonimus, 3 strains of Leishmania donovani, 5 strains of Pinworm, 3 strains of Fasciola busuli, and 4 strains of Whipworm.

[0040] Specific probe design: Input the reference genome sequences of 29 parasites and the human reference genome sequence (hg19) in the reference genome database constructed above. GSMer v1.0 software was used to predict species-specific initial probe sets: the reference genome sequence sets of 29 parasites were broken into 50nt k-mer sets using meryl (kmer software module), and then the k-mer sets were first aligned to hg19 using blastn v2.2.26, and k-mers with identities greater than or equal to 85 were filtered; then, each parasite was used as a unit, and the k-mer sets between units were paired using mapMers (kmer software module), and k-mers with consecutive aligned base numbers greater than 20nt were filtered. Finally, the initial specific probe sets (50ntkmer) of each parasite were screened out, and the abundance of probe sequences was counted; the reference genome sequence sets of 29 parasites were generated into 18nt k-mer sets with each parasite as a unit, and blastn was used to perform sequence alignment on the 18nt k-mer set and the initial specific probe sequence set obtained in the previous step. For example, in the sequence alignment results of different species, the identity was greater than or equal to 85. Then the probe sequence is removed, and finally the initial specific probe set for each parasite is obtained.

[0041] Further filtering of the species-specific initial probe set: Use blastn to align the above probes with the RefSeq nucleic acid database of bacteria, viruses, fungi and other parasites. If the alignment length is greater than 20nt, the nucleic acid free energy (free energy, unit kcal / mol) between the probe sequence and the target sequence is calculated. If the nucleic acid free energy is less than -30, the probe sequence is removed; if the probe has 5 consecutive identical bases, the probe sequence is removed to obtain a probe sequence set with good specificity. Finally, the probe sequence with the highest abundance is retained from the remaining probe sequences as the probe sequence for each parasite to obtain a probe sequence set with good conservation. The specific nucleotide sequence (30-50nt) is shown in Table 1.

[0042] Table 1 Probe information table

[0043]

[0044] Furthermore, the above probe combinations can be used to prepare a kit for detecting one or more of the 29 infectious parasites.

[0045] Example 2

[0046] Gene chip and its preparation

[0047] The probe gene chip designed in Example 1 includes, in addition to the above-mentioned probes for the 29 infectious parasites, control probes IC and HC. The designs of the control probes HC and IC are as follows:

[0048] Design of control probe IC: The control probe IC is an amplification quality control probe. Computer simulation was used to generate 10,000 artificial sequences of 50 nt. The sequence set was aligned to the NCBI NT library (ftp: / / ftp.ncbi.nlm.nih.gov / blast / db / FASTA / nt.gz) using blastn. The sequence set with a continuous alignment base number of less than 18 nt and an identity of less than 85 was retained, and a total of 424 sequences were obtained. One sequence was randomly selected as the control probe IC. In this embodiment, the selected control probe IC sequence is as follows: Probe (SEQ ID No. 88): GCCGAGGACTTTGATTGCACATTGTTGTTT; Design of control probe HC: The control probe HC is a hybridization quality control probe. The method is the same as the design of the control probe IC. The control probe HC sequence is as follows: Probe (SEQ ID No. 89): AGATGCGTTGTTACAGGA. Preparation of gene chips: A CGH (whole genome hybridization) chip from the Agilent (https: / / www.agilent.com / ) platform is used. The chip includes a solid phase carrier, on which the probes are fixed during preparation. Usually, the probes are fixed on the solid phase carrier in the form of a microarray according to certain spatial distribution characteristics. A 6-row × 12-column microarray is designed, and each microarray can detect one sample. The distribution characteristics of various probes are shown in Figure 1 .

[0049] Spotting position control probe (provided with Agilent CGH chip): 34 sites in total, 4 of which are distributed at the four corners of the microarray, and the remaining 31 sites are distributed according to Figure 1 Distributed in the microarray. Control probe IC: a total of 1 probe sequence, repeated 1 time, forming 1 monitoring site, according to Figure 1 Distributed in the microarray. According to the above design rules, positive quality control and pathogen samples detected by IC should show positive results. Control probe HC: A total of 1 probe sequence, repeated 4 times to form 4 monitoring sites, located at the four corners of the microarray. In order to standardize the fluorescent signal of the infectious parasite probe, this probe was commissioned to Shanghai Sangon Biotechnology for oligonucleotide synthesis, and Cyanine 3 fluorescent dye was used for fluorescent labeling to obtain a customized reagent (as a control sample). Infectious parasite probe: Each probe is repeated once to form a detection site, according to Figure 1 Distributed in a microarray. For example, for two infectious parasites, one probe for each, repeated once, two detection sites can be obtained. Another example: for five infectious parasites, one probe for each, repeated once, five detection sites can be obtained. Further, the above gene chip is prepared into a kit for the detection of one or more of the 29 infectious parasites.

[0050] Example 3

[0051] Using gene chips to detect samples

[0052] In this example, the gene chip containing 34 probes for 29 infectious parasites prepared in Example 2 was used to detect the sample to be tested. In this example, one specimen (samples 1-4) was collected from each of the female urogenital system, male urogenital system, human digestive system, and human serum / whole blood. The sample information is shown in Table 2.

[0053] Table 2 Sample information table

[0054] Sample name Sampling Type Sample 1 Female urogenital system Sample 2 Male urogenital system Sample 3 Human digestive system Sample 4 Human serum / whole blood

[0055] The detection specifically includes the following steps:

[0056] 1. Main ingredients

[0057] Table 3 Main ingredients

[0058] Component name Main Ingredients Specification quantity PCR Amplification Reagent Mix Hot start Taq enzyme, dNTP, buffer system 715μL / tube 1 tube PCR primer mix Primers 420μL / tube 1 tube Hybridization buffer Tris-HCl, TritonX-100, NaCl 4.2mL / bottle 1 bottle Negative quality control Purified water, negative control point template 125μL / tube 1 tube Sodium citrate buffer (20×SSC) Sodium chloride, trisodium citrate, etc. 45mL / bottle 2 bottles Sodium dodecyl sulfate solution (10% SDS) Sodium dodecyl sulfate (SDS), water 40mL / bottle 1 bottle chip Gene chip 10 tests / piece, 5 pieces / box 1 box

[0059] 2. Applicable instruments

[0060] Table 4 Instrument table

[0061] Instrument Name model Manufacturer Gene Amplifier Real-time fluorescence quantitative PCR instrument DA7600 Sun Yat-sen University Daan Gene Co., Ltd. Microarray Scanner Microarray chip scanner LuxScan10K-B Biobio Biotech Co., Ltd.

[0062] 3. Preparation of genomic nucleic acid from samples to be tested

[0063] Use the magnetic bead nucleic acid extraction kit and 96-well plate automatic nucleic acid extraction instrument (model: HJ-IMAG-96) produced by Kunming Huanji Biochip Industry Co., Ltd. to extract nucleic acid from the samples to be tested:

[0064] a) Sample preparation

[0065] Dry swab sample: add 500μL injection water or nuclease-free sterile water to the EP tube with the swab head, mix at high speed for 1min, centrifuge, and take 200μL of liquid to the well of reagent plate 1; wet swab sample (stored in cell preservation solution): oscillate the cryotube with the swab head for 1min, take 200μL of liquid and add it to the well of reagent plate 1. Blood: take 200μl of blood sample and add it to the well of reagent plate 1. Reagent plate preparation: remove the reagent plate from the kit, confirm that all components are complete and the reagent plate is sealed; turn the reagent plate 3 containing magnetic beads upside down several times, resuspend and mix the magnetic beads, centrifuge it in a plate centrifuge at 800rpm / min for 3min, and set aside; turn the proteinase K tube upside down to mix, centrifuge it instantly, and set aside. Add sample to reagent plate 1; carefully tear off the aluminum foil sealing film of plate 1 to avoid vibration of the well plate and prevent liquid from splashing. Dispense 20 μL of proteinase K into each well of plate 1; add 200 μL of sample to each well. Extraction on the machine: install reagent plate 1 to plate 1 position of the extractor; tear off the sealing film of reagent plate 2 to prevent the well plate from vibrating and liquid from splashing, and install it to the corresponding plate position in sequence;

[0066] b) Install the magnetic rod sleeve

[0067] Run the extraction procedure as shown in Table 5 below.

[0068] Table 5 Program table

[0069]

[0070] c) Transfer nucleic acid

[0071] After the program is finished, take out the plate 5, transfer the nucleic acid liquid or save it for later use. The used reagent plate is treated as biological waste. The total amount of nucleic acid and fluorescent labeling specific activity information of each sample in this embodiment are shown in Table 6.

[0072] Table 6 Information on total nucleic acid amount and fluorescent labeling specific activity

[0073] Sample name DNA concentration (ng / μl) A260 / A280 Sample 1 38.4 1.77 Sample 2 45.7 1.80 Sample 3 44.5 1.84 Sample 4 34.3 1.79

[0074] 4. Nucleic acid amplification and fluorescent labeling

[0075] The gDNA was amplified and fluorescently labeled using the LDT parasite infection gene detection kit from Kunming Huanji Biochip Industry Co., Ltd. The extracted nucleic acid was used to prepare the PCR reaction system according to Table 7, and amplified and labeled in a 0.2 mL PCR thin-walled tube according to its cycle parameters.

[0076] Table 7 PCR reaction system

[0077]

[0078] 5. Chip hybridization

[0079] The hybridization solution produced by Kunming Huanji Biochip Industry Co., Ltd. was used for chip hybridization, including the following steps: the constant temperature hot plate was heated to a constant temperature of 42°C, and the chip was fixed with a hybridization module preheated at 42°C; the PCR product was taken out of the amplifier and immediately placed in an ice bath; after the PCR product was added to the hybridization solution according to the hybridization system in Table 8, it was mixed by blowing, and the mixture was dripped into the corresponding microarray reaction chamber from the sample addition hole (the microarray area was forbidden to be touched during the operation to avoid the mixed solution from dripping onto the surface of the hybridization module), 42°C, hybridization for 30 minutes, and the DNA microarray chip was arranged as shown in the figure. Figure 2 The hybridization system is shown in Table 6.

[0080] Table 8 Hybridization system table

[0081] materials volume PCR products 25μL 10% hybridization solution 100μL Total volume 125μL

[0082] 6. Chip elution

[0083] The chip was eluted using the elution solution, elution instrument and elution program produced by Kunming Huanji Biochip Industry Co., Ltd., including the following steps: after hybridization, open the elution instrument; remove the adhesive strip on the hybridization module, turn the hybridization module over and use a little force to shake off the liquid in the reaction pool, open the hybridization module, take out the chip and immediately put it into the elution instrument with the front side facing outwards; elution: use the set elution process to elute and spin dry before scanning.

[0084] 7. Scanning and result determination

[0085] The chip was scanned using a chip laser scanner (Axon GenePix 4000A / B, Jingxin LuxScan 10K), including the following steps: placing the dried chip in the laser scanner, setting the scanning parameter matrix to 6 rows and 12 columns, and the chip microarray area position as shown in Figure 2 , use 532nm wavelength laser scanning to obtain scanning spectra and data; analyze the test data according to the requirements of the instructions and generate a test report (to simplify the operation, data interpretation can be performed using data-assisted analysis software).

[0086] 8. Result interpretation steps

[0087] Judging the control probe HC: if both the two repeated sites meet the "positive" condition, the reading will continue, otherwise the reading result will be "failed"; judging the control probe IC: if both the two repeated sites meet the "positive" condition, the control probe IC will be judged as "positive", otherwise the control probe IC will be judged as "negative"; judging the parasite detection probe: for example, the pinworm detection probe Enterobius vermicμlari: if both the two repeated sites of the Enterobius vermicμlari probe meet the "positive" condition, the pinworm detection result will be judged as "positive"; otherwise the detection probe will be judged as "negative"; repeat the operation of judging the parasite detection probe, and judge the scanning data of other parasite probes; organize the judgment results and generate a test report.

[0088] 9. Interpretation of test results

[0089] The judgment of "failure" caused by the hybridization control point HC not meeting the requirements is due to problems in the hybridization system; the control probe IC is judged as "positive", and the specimen contains parasite genomic DNA; the probe is judged as "negative", indicating that insufficient parasites may have been collected when the specimen was collected or problems occurred in the nucleic acid extraction and PCR amplification systems, and it is recommended to re-sample and test; in the negative reference test reaction, the control probe HC should be judged as positive, and the remaining parasite probes should be negative, otherwise it indicates that the amplification system is contaminated; using the above method, the test results of the samples to be tested are shown in Table 9.

[0090] Table 9 Detection results of 29 infectious parasites

[0091]

[0092] Table 9 Description: + indicates detected, - indicates not detected

[0093] After analyzing the results, the positive quality control and negative quality control results were normal. Samples 1 and 2 were infected with Trichomonas vaginalis, while sample 3 was infected with Hymenolepis minor and Ascaris lumbricoides.

[0094] Example 4

[0095] Timeliness of gene chip detection of parasites

[0096] In order to test the operation time of the method for detecting parasites using gene chips in Example 3 of the present invention, the digestive tract specimens of 5 suspected infectious parasites collected were first divided into two, one of which was detected using the present invention (according to the treatment method of Example 3), and the other was subjected to metagenomic sequencing, measuring 20Mb reads, and 12 CPUs were used for metagenomic computational analysis. Finally, the difference in the detection cycle between gene chip detection and metagenomic sequencing gene detection was compared. The results are shown in Table 8.

[0097] Table 10 Comparison of the timeliness of gene chip detection method and metagenomic sequencing gene detection

[0098]

[0099]

[0100] As shown in Table 10, the whole process of metagenomic sequencing gene detection method takes 26 hours, while the detection using gene chip only takes 5 hours, which shortens the cycle. In addition, the data analysis and report interpretation based on gene chip are simpler than the metagenomic sequencing gene detection method, so the application threshold is lower, and it can more quickly detect the effect of potential pathogenic parasites in the sample to be tested.

[0101] Example 5

[0102] Accuracy of gene chip detection of parasites

[0103] In order to verify the accuracy of the method for detecting parasites using gene chips in Example 3 of the present invention, 5 human specimens (samples 1-5) with clinical diagnosis and PCR test results indicating parasitic infection were collected, and a healthy person's oral exfoliated cell sample (sample 6) was collected as a negative control. All specimens were divided into two, one of which was detected using the gene chip detection method of Example 3; the other was detected by the metagenomic sequencing gene detection and analysis method. The difference in the detection results of the gene chip detection method and the metagenomic sequencing gene detection method was compared. The gene chip detection method described in Example 3 was used for detection, and its nucleic acid extraction, total nucleic acid amount, fluorescent labeling, and signal data quality inspection all passed the standards, so subsequent data analysis and result determination were performed. The results are shown in Table 11.

[0104] Table 11 Comparison of pathogen detection by gene chip detection method and metagenomic sequencing gene detection method

[0105] sample Clinical diagnosis + PCR results Gene chip Metagenomic sequencing Sample 5 Pinworms Pinworms Pinworms Sample 6 Cryptosporidium parvum+, Ascaris lumbricoides+, Pinworm+ Cryptosporidium parvum+, Ascaris lumbricoides+, Pinworm+ Cryptosporidium parvum+, Ascaris lumbricoides+, Pinworm+ Sample 7 Cryptosporidium parvum +, Entamoeba histolytica + Cryptosporidium parvum + Entamoeba histolytica Cryptosporidium parvum+ Sample 8 Taenia solium Taenia solium Taenia solium Sample 9 Leishmania donovani+ Leishmania donovani - Sample 10 - - -

[0106] Note: + indicates detection (positive); - indicates no detection / discovery (negative)

[0107] It can be seen from Table 11 that the detection sensitivity and specificity of the gene chip are both 100%, while the specificity of metagenomic sequencing is 100%, but the sensitivity is only 80% (4 / 5).

[0108] The above results show that the specific probe designed by the present invention is more sensitive in detecting 29 food-infecting parasites, and is particularly suitable for low pathogenic microorganism loads. In addition, the gene chip of the present invention can accurately detect 29 parasites that cause infectious diseases, with excellent sensitivity and specificity, and can be used for rapid screening of food-borne pathogenic parasites.

[0109] Although the present invention is described herein with reference to a number of illustrative embodiments of the present invention, it will be appreciated that those skilled in the art may devise many other modifications and implementations that fall within the scope and spirit of the principles disclosed herein. More specifically, within the scope of the present disclosure, drawings, and claims, a variety of variations and modifications may be made to the components and / or layout of the subject combination layout. In addition to the variations and modifications made to the components and / or layout, other uses will also be apparent to those skilled in the art.

Claims

1. A 29-item combined detection kit for parasites, characterized in that: The kit comprises a gene chip, which comprises a probe combination of Hymenolepidium microti, Clonorchis sinensis, Balantidium coli, Angiostrongylus cantonensis, Schistosoma japonicum, Fasciola hepatica, Cryptosporidium microti, Giardia lamblia, Necator americanus, Ancylostoma duodenale, Taenia asiatica, Taenia saginata, Taenia solium, Entamoeba histolytica, Toxoplasma gondii, Blastocystis hominis, Trichomonas vaginalis, Strongyloides stercoralis, Wuchereria bancrofti, Trichinella spiralis, Ascaris lumbricoides, Spirometra mansoni, Echinococcus granulosus, Echinococcus multilocularis, Paragonimus, Leishmania donovani, Pinworm, Fasciola brasiliensis and Whipworm; wherein, Primers and probes for detecting Hymenolepis minor: the primer sequences are shown in SEQ.01 and SEQ.02, and the probe sequence is shown in SEQ.03; Primers and probes for detecting Clonorchis sinensis: the primer sequences are shown in SEQ.04 and SEQ.05, and the probe sequence is shown in SEQ.06; Primers and probes for detecting Balantidium coli: the primer sequences are shown in SEQ.07 and SEQ.08, and the probe sequence is shown in SEQ.09; Primers and probes for detecting Angiostrongylus cantonensis: the primer sequences are shown in SEQ.10 and SEQ.11, and the probe sequence is shown in SEQ.12; Primers and probes for detecting Schistosoma japonicum: the primer sequences are shown in SEQ.13 and SEQ.14, and the probe sequence is shown in SEQ.15; Primers and probes for detecting Fasciola hepatica: the primer sequences are shown in SEQ.16 and SEQ.17, and the probe sequence is shown in SEQ.18; Primers and probes for detecting Cryptosporidium parvum: the primer sequences are shown in SEQ.19 and SEQ.20, and the probe sequence is shown in SEQ.21; Primers and probes for detecting Giardia lamblia: the primer sequences are shown in SEQ.22 and SEQ.23, and the probe sequence is shown in SEQ.24; Primers and probes for detecting Necator americanus: the primer sequences are shown in SEQ.25 and SEQ.26, and the probe sequence is shown in SEQ.27; Primers and probes for detecting Ancylostoma duodenale: the primer sequences are shown in SEQ.28 and SEQ.29, and the probe sequence is shown in SEQ.30; Primers and probes for detecting Asian tapeworm: the primer sequences are shown in SEQ.31 and SEQ.32, and the probe sequence is shown in SEQ.33; Primers and probes for detecting Taenia saginata: the primer sequences are shown in SEQ.34 and SEQ.35, and the probe sequence is shown in SEQ.36; Primers and probes for detecting Taenia solium: the primer sequences are shown in SEQ.37 and SEQ.38, and the probe sequence is shown in SEQ.39; Primers and probes for detecting Entamoeba histolytica: the primer sequences are shown in SEQ.40 and SEQ.41, and the probe sequence is shown in SEQ.42; Primers and probes for detecting Toxoplasma gondii: the primer sequences are shown in SEQ.43 and SEQ.44, and the probe sequence is shown in SEQ.45; Primers and probes for detecting Blastocystis hominis: the primer sequences are shown in SEQ.46 and SEQ.47, and the probe sequence is shown in SEQ.48; Primers and probes for detecting Trichomonas vaginalis: the primer sequences are shown in SEQ.49 and SEQ.50, and the probe sequence is shown in SEQ.51; Primers and probes for detecting Strongyloides stercoralis: the primer sequences are shown in SEQ.52 and SEQ.53, and the probe sequence is shown in SEQ.54; Primers and probes for detecting Wuchereria bancrofti: the primer sequences are shown in SEQ.55 and SEQ.56, and the probe sequence is shown in SEQ.57; Primers and probes for detecting Trichinella spiralis: the primer sequences are shown in SEQ.58 and SEQ.59, and the probe sequence is shown in SEQ.60; The primers and probe for detecting human Ascaris are shown in SEQ.61 and SEQ.62, and the probe sequence is shown in SEQ.63; Primers and probes for detecting Spirochete mansoni: the primer sequences are shown in SEQ.64 and SEQ.65, and the probe sequence is shown in SEQ.66; Primers and probes for detecting Echinococcus granulosus: the primer sequences are shown in SEQ.67 and SEQ.68, and the probe sequence is shown in SEQ.69; Primers and probes for detecting Echinococcus multilocularis: the primer sequences are shown in SEQ.70 and SEQ.71, and the probe sequence is shown in SEQ.72; Primers and probes for detecting Paragonimus: the primer sequences are shown in SEQ.73 and SEQ.74, and the probe sequence is shown in SEQ.75; Primers and probes for detecting Leishmania donovani: the primer sequences are shown in SEQ.76 and SEQ.77, and the probe sequence is shown in SEQ.78; Primers and probes for detecting pinworms: the primer sequences are shown in SEQ.79 and SEQ.80, and the probe sequence is shown in SEQ.81; Primers and probes for detecting Fasciola brasiliensis: the primer sequences are shown in SEQ.82 and SEQ.83, and the probe sequence is shown in SEQ.84; Primers and probes for detecting whipworms: the primer sequences are shown in SEQ.85 and SEQ.86, and the probe sequence is shown in SEQ.

87.

2. A 29-item combined detection kit for parasites according to claim 1, characterized in that: The gene chip also includes a control probe IC and a control probe HC.

3. A 29-item combined detection kit for parasites according to claim 2, characterized in that: The probe sequence of the control probe IC is shown in SEQ.

88.

4. A 29-item combined detection kit for parasites according to claim 2, characterized in that: The probe sequence of the control probe HC is shown in SEQ.

89.

5. The 29-item combined detection kit for parasites according to claim 1, characterized in that: The kit includes an operating instruction, and the steps of preparing genomic nucleic acid from the sample to be tested in the operating instruction include sample preparation, reagent plate preparation, reagent plate loading, machine extraction, installation of magnetic rod sleeve, and nucleic acid transfer.

6. A 29-item combined detection kit for parasites according to claim 5, characterized in that: The kit includes an operating instruction, which records the PCR reaction system: 5 μl of sample; PCR amplification reagent mixture 12.5 μl; PCR amplification primer mixture 7.5 μl; total volume 25.0 μl.

7. A 29-item combined detection kit for parasites according to claim 6, characterized in that: The PCR amplification reagent mixture includes Hot start Taq enzyme, dNTP and a buffer system.

8. The 29-item combined detection kit for parasites according to claim 1, characterized in that: The kit includes an operating instruction manual, which records the PCR reaction parameters: 94°C for 5 minutes, 1 cycle; 94°C for 30 seconds, 54°C for 40 seconds, 72°C for 1 minute, 36 cycles; 72°C for 5 minutes, 1 cycle; 12°C hold.

9. The 29-item combined detection kit for parasites according to claim 4, characterized in that: The operating instructions also include chip hybridization, and the steps of chip hybridization are: raising the temperature of the constant temperature hot plate to a constant temperature of 42°C, fixing the chip with a hybridization module preheated at 42°C; taking the PCR product out of the amplification instrument and placing it in an ice bath; After the PCR product is added to the hybridization solution according to the hybridization system, it is mixed by pipetting, and the mixture is added dropwise from the sample addition hole into the corresponding microarray reaction chamber at 42°C for 30 minutes of hybridization.

10. A 29-item combined detection kit for parasites according to claim 9, characterized in that: The hybridization system includes PCR products and 10% hybridization solution; The volume ratio of the PCR product to 10% hybridization solution is 1:4.

Images