An SNP molecular marker related to the body height trait of horses and its application
By developing SNP molecular markers at the 16223041bp position of horse chromosome 4, the problem of difficulty in breeding high-body and high horses in the prior art has been solved, efficient genotype-assisted breeding has been achieved, the body height and motor performance of horses have been improved, and the genetic improvement and breeding process of the horse industry has been promoted.
Patent Information
- Application Number
- CN202510337291.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2045-03-21
AI Technical Summary
It is difficult to efficiently breed tall horses with excellent sports performance in the prior art, and lack effective molecular marker assisted selection methods, which affects the genetic improvement and breeding process of the horse industry.
A SNP molecular marker based on EquCab3.0 version was developed, located at the 16223041bp position of horse chromosome 4, with a polymorphism of A/G. It is used to detect the body high traits of horses, and design corresponding primer pairs and kits to screen out horse breeds with high traits through genotype-assisted breeding and breeding.
It significantly improves the body height of the horse, enhances the motility performance, improves the slaughtering rate and meat production, shortens the genetic breeding years, optimizes the genetic improvement progress and breeding efficiency of stallions, and reduces breeding costs.
Smart Images

Figure CN119842929B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of animal breeding, and particularly relates to an SNP molecular marker related to the body height trait of horses and its application. Background Art
[0002] Horses are one of the important livestock resources, and their body type characteristics directly affect their athletic performance, reproductive ability, and economic value. There is a rich variety of horse breeds, which have formed various breeds adapted to different environments and uses through long-term natural selection and artificial breeding. Body type, including body height, body length, chest girth, cannon bone circumference, etc., is a complex trait controlled by multiple genes and is one of the most important traits in the process of horse domestication and breeding. As a key indicator of body type, body height has a significant impact on the athletic ability, load-carrying ability, and economic value of horses. Horses with a high body height are usually more robust in body type and have better athletic performance, especially outstanding in horse racing, riding, and agricultural work, and can better meet market demands and improve economic benefits. By means of scientific breeding and genetic improvement, cultivating horse breeds with excellent body types can not only improve the comprehensive performance of horses but also provide important support for the development of the livestock industry.
[0003] With the increasing demand for high-performance horses, especially in fields such as horse racing, riding, and agricultural work, the market demand for horses with a large body size and strong athletic ability is continuously growing. Cultivating horse breeds with a large body size and high performance can better meet these market demands and promote the sustainable development of the horse industry. The body size and athletic performance of horses are the result of the combined action of multiple factors such as genetics, nutrition, training, and the environment. With the rapid development of molecular genetic technologies such as marker-assisted selection, studying the major genes of the main performance of horses has become a hot field. Using the polymorphic sites of candidate genes as molecular auxiliary markers for the genetic effects of horse traits, and then precisely breeding horses, provides new ideas for improving their athletic performance, reproductive ability, and disease resistance. Therefore, developing specific molecular markers for horses and applying them to the breeding of horses with a large body size and high performance has important practical significance. The application of these molecular markers will significantly improve the breeding efficiency and accuracy, accelerate the process of genetic improvement, optimize the gene combination, thereby enhancing the comprehensive performance and economic benefits of horses, and providing strong scientific and technological support for the modernization and high-quality development of the horse industry.
[0004] Insulin-like growth factor-binding protein 1 (IGFBP1) is a secreted protein that binds IGF in the extracellular environment and is expressed in most tissues as an essential mediator of cell growth, development, and survival. Studies have shown that height is moderately positively correlated with IGFI and IGFBP3, but significantly negatively correlated with IGFBP1. Knockout of IGFBP1 can significantly alleviate hypoxia-induced growth retardation and developmental delay, while overexpression of IGFBP1 leads to growth and developmental retardation under normal hypoxia conditions. Notably, IGFBP1 itself does not have mitogenic activity, but it can inhibit the ability of IGF1 and IGF2 to stimulate cell proliferation by binding to them. When an excess of IGF1 or IGF2 is added, this inhibitory effect disappears, indicating that IGFBP1 mainly regulates embryonic growth and development by binding to and inhibiting the activity of IGF. In addition, studies have also found that height and body mass index are closely related to IGFBP1 and IGFBP2. IGFBP1 mainly regulates the action of growth hormone (GH) by inhibiting the activity of IGF1, thereby affecting bone growth and development. Clinical cases also support the function of IGFBP1. A patient with severe growth and developmental disorders since birth had significantly elevated circulating levels of IGFBP1 and lower levels of IGF2. The patient showed a good response to growth hormone (GH) drug treatment, further indicating the key role of IGFBP1 in growth regulation. Thus, IGFBP1 plays a key role in height growth and bone development by regulating the biological activity of IGF1. In-depth study of the mechanism of action of IGFBP1 in individual growth and its impact on body height is of great significance for basic biological research and helps to breed large horse breeds. Summary of the Invention
[0005] To solve the problems existing in the prior art, the present invention provides an SNP molecular marker related to horse body height traits and its application.
[0006] The present invention screened out an SNP molecular marker related to horse body height traits. This SNP molecular marker is based on the EquCab3.0 version number and is located at position 16223041 bp on chromosome 4 of the horse, with a polymorphism of A / G.
[0007] In the first aspect, the present invention provides an SNP molecular marker, the SNP molecular marker comprising the nucleotide sequence shown in SEQ ID NO.1, the 151st position of the nucleotide sequence being a polymorphic site with a polymorphism of A / G.
[0008] For the convenience of detection, the present invention has developed primers for amplifying the SNP molecular marker based on the polymorphism locus at the 16,223,041bp position on chromosome 4 of the horse and its upstream and downstream sequences based on the EquCab3.0 version genome. Combining the upstream and downstream sequences of the polymorphism locus, the present invention has obtained the sequence shown in SEQ ID NO.1. Those skilled in the art can understand that based on the above polymorphism locus and its upstream and downstream sequences, sequence fragments of different lengths can be developed as SNP molecular markers for the amplification and detection of this locus. Therefore, the sequence shown in SEQ ID NO:1 does not constitute a limitation on the SNP molecular marker of the present invention. As long as the sequence fragment contains the polymorphism locus at the 16,223,041bp position on chromosome 4 of the EquCab3.0 version horse reference genome, it is within the protection scope of the SNP molecular marker of the present invention.
[0009] The nucleotide sequence shown in SEQ ID NO.1:
[0010] CTGTCTCGCGCTTGGACTCGGAGGAGAAGTTCTGGGTGTCTGTGCTCTGAGACTCGTAGTCGACCTTGTAGCGCTGGCTGTCCTTGGCATGGCCTTTCTTGATGACGTCCATCTTGGTGTGGATCGTGTGGAATTTGGGGTCCGGCATGCRGTGTGTGCTGGGCACGGCCTGGTTGTCCACACTCCCTGCGCTGTGGTCCTCCTCCGACTCACTGCTGTTTCCTTGAAAAGCACAAGGGACACAAAGACTGTTATGGATATTTAATGACATTCTTCTTAAAATCTTACTACTGCGACCAAG.
[0011] Furthermore, the genotypes AA or AG of the SNP molecular marker correspond to the high body height trait, and the genotype GG of the SNP molecular marker corresponds to the low body height trait.
[0012] In the second aspect, the present invention provides a primer pair, and the primer pair is used for amplifying the aforementioned SNP molecular marker.
[0013] According to the position of the polymorphism locus of the SNP molecular marker provided above in the genome and its upstream and downstream sequences, those skilled in the art can develop various types of primers for amplifying the SNP molecular marker. Therefore, the above primers can be any primers capable of detecting the genotype of the SNP molecular marker.
[0014] Further, the primer pair includes nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2.
[0015] In a third aspect, the present invention provides a kit, including the aforementioned molecular marker or the aforementioned primer pair.
[0016] The above-mentioned kit may further contain other reagents for PCR amplification, including: one or more of PCR reaction buffer, DNA polymerase, probe, dNTP, Mg 2+ and water.
[0017] In a fourth aspect, the present invention provides the application of the SNP locus as a target in any of the following:
[0018] (1) IGFBP1 gene typing,
[0019] (2) Predicting or detecting the body height trait of horses, or preparing a reagent for predicting or detecting the body height trait of horses,
[0020] (3) Screening or identifying horse breeds with high body height traits, or preparing a reagent for screening or identifying horse breeds with high body height traits,
[0021] (4) Molecular marker-assisted breeding of horse body height traits,
[0022] (5) Improvement of horse breeds related to body height traits,
[0023] (6) Selective breeding of horse body height traits,
[0024] (7) Improvement of horse germplasm resources,
[0025] The SNP locus is based on the EquCab3.0 version, located at the 16223041bp position of chromosome 4 in horses, and the polymorphism is A / G.
[0026] The "target" described in the present invention means that any detection reagent capable of detecting its polymorphism can be designed for this target, such as primer pairs and probes.
[0027] In a fifth aspect, the present invention provides the application of the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned kit in any of the following:
[0028] (1) IGFBP1 gene typing,
[0029] (2) Predicting or detecting the body height trait of horses, or preparing a reagent for predicting or detecting the body height trait of horses,
[0030] (3) Screening or identifying horse breeds with high body height traits, or preparing a reagent for screening or identifying horse breeds with high body height traits,
[0031] (4) Molecular marker-assisted breeding for horse body height traits,
[0032] (5) Improvement of horse breeds related to body height traits,
[0033] (6) Selective breeding for horse body height traits,
[0034] (7) Improvement of horse germplasm resources.
[0035] Further, the aforementioned IGFBP1 gene can be an IGFBP1 gene from any source, such as the gene numbered ENSG00000146678.
[0036] Further, predicting the body height trait of a horse is an early prediction of the horse body height trait.
[0037] In a sixth aspect, the present invention provides a method for detecting the body height trait of a horse, comprising:
[0038] Detecting the polymorphism of the SNP locus in the horse to be tested, and judging the body height trait of the horse to be tested according to the detection result;
[0039] The SNP locus is based on the EquCab3.0 version, a SNP molecular marker located at position 16223041bp on chromosome 4 of the horse, and the polymorphism is A / G.
[0040] Further, the judging the body height trait of the horse to be tested according to the detection result includes:
[0041] Horses with the genotype detection result of AA or AG at the SNP locus have higher body height traits compared to horses with the detection result of GG.
[0042] In a seventh aspect, the present invention provides a method for breeding horse breeds with high body height traits, comprising:
[0043] When carrying out breeding, collecting the SNP locus genotypes of the horse population, and using horses with the genotype of AA or AG for mating;
[0044] Collecting the SNP locus genotypes of the born horses, and retaining individuals with the genotype of AA or AG;
[0045] The SNP locus is based on the EquCab3.0 version, a SNP molecular marker located at position 16223041bp on chromosome 4 of the horse, and the polymorphism is A / G.
[0046] In an eighth aspect, the present invention provides a method for selecting and breeding horse body height traits, comprising:
[0047] Detect the genotype of the aforementioned SNP locus in reserve breeding stallions, select individuals with the genotype AA or AG as breeding stallions, and eliminate individuals with the GG genotype. In this way, horses with high body height traits can be selected as breeding stallions to achieve the breeding of the body height traits of breeding stallions.
[0048] In a ninth aspect, the present invention provides a method for genetic improvement of horses, including: detecting the genotype of the aforementioned SNP locus in reserve breeding stallions, selecting individuals with the genotype AA or AG, and eliminating individuals with the GG genotype;
[0049] Using individuals with the genotype AA or AG as breeding stallions for breeding, and continuing to select individuals with the genotype AA or AG as breeding stallions in the offspring, while eliminating individuals with the GG genotype, so as to gradually increase the frequency of allele A in the offspring horse population, thereby reducing the proportion of breeding stallions with low body height in the offspring.
[0050] The horses described in the present invention can be either adult horses or foals.
[0051] The present invention has the following beneficial effects:
[0052] (1) The present invention screened and identified a molecular marker related to the body height trait of horses. There are extremely significant differences in the body height of horses with different genotypes of this molecular marker; the average body height of horses with the genotype AA or AG is 161.27 cm, and the average body height of horses with the genotype GG is 122.67 cm. The A allele significantly increases the body height. The AA or AG genotype is the dominant genotype, corresponding to the high body height trait. Therefore, by applying this molecular marker, the body height of horses can be greatly increased, thereby increasing the slaughter rate and meat production of horses, affecting their production performance, and accelerating the genetic improvement progress and breeding process of breeding stallions.
[0053] (2) By detecting the genotype of the molecular marker related to the body height trait of horses provided by the present invention to assist in the selection of breeding stallions, the body height of horses can be effectively increased by selecting breeding stallions with the AA or AG genotype, which is convenient for the comprehensive breeding of subsequent breeding stallions.
[0054] (3) By applying the molecular marker related to the body height trait of horses provided by the present invention to the breeding of high body height traits, the body height of the selected horses can be greatly increased, thereby increasing the slaughter rate and meat production, and improving the production performance of breeding stallions.
[0055] (4) By applying the molecular marker related to the body height trait of horses provided by the present invention in the cultivation of horse lines with high body height traits, a horse line with high body height can be obtained, thereby increasing the slaughter rate, meat production, etc. of the horses in this line, improving the production performance of the horses in this line, and accelerating the genetic improvement progress and breeding process of breeding stallions.
[0056] (5) By applying the molecular markers related to the horse body height trait provided by the present invention to the genetic improvement of horses, the genetic breeding period can be greatly shortened, the horse slaughter rate can be increased, and the genetic improvement progress and breeding process of breeding horses can be accelerated.
[0057] (6) By applying the molecular markers related to the horse body height trait provided by the present invention in screening foals with high body height genetic traits, foals with high body height can be screened out at the foal stage and selected for retention, thereby realizing the breeding of the high body height trait of breeding horses at the foal stage, which can greatly improve the breeding efficiency and save the feeding cost. BRIEF DESCRIPTION OF THE DRAWINGS
[0058] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0059] Figure 1 It is a statistical chart of the body height phenotypes of the high body height group horses and the low body height group horses provided in Example 1 of the present invention; among them, represents P < 0.0001.
[0060] Figure 2 It is a Manhattan plot of the genome-wide SNP effect distribution of the horse body height trait provided in Example 2 of the present invention; among them, the upper figure is the Manhattan plot of three selection signals of FST, XPCLR, and XPEHH, and the selected position within the frame represents the genomic position of the rs395786667 molecular marker of the IGFBP1 gene.
[0061] Figure 3 It is a Venn diagram of the genes screened by the three selection signal methods between the high body height group and the low body height group provided in Example 2 of the present invention.
[0062] Figure 4 It is a gene locus frequency diagram between the high body height group and the low body height group provided in Example 2 of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0063] To make the objectives, technical solutions, and advantages of the present invention clearer, the following will clearly and completely describe the technical solutions in the present invention in conjunction with the drawings in the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.
[0064] The experimental methods involved in the following examples are all conventional methods in the art unless otherwise specified. For example, reference can be made to the experimental manuals in the art, such as the Molecular Cloning: A Laboratory Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended in the manufacturer's instructions.
[0065] The experimental materials and reagents involved in the following examples can be obtained from commercial sources unless otherwise specified.
[0066] Example 1 Obtaining SNP Molecular Markers
[0067] 1. Based on the National Animal Germplasm Resources Bank, ear tissue samples or blood samples of horse breeds in the high body height group and the low body height group were collected, total DNA was extracted, the DNA was quality controlled, and high-depth whole-genome resequencing was sent to a sequencing company with an average sequencing depth of about 10×. Phenotypic data such as growth performance measurements of the corresponding horse breeds were collected. The average body height of the high body height group was 161.27 cm, and the average body height of the low body height group was 122.67 cm (as Figure 1 shown).
[0068] 2. The fastq files downloaded from the sequencing company were sorted out. Reads that did not meet the standards and had poor quality were removed. After quality control and filtering of the raw data, high-quality sequencing data were obtained. The MEM algorithm of the BWA (Version 0.7.15) software was used to align the Clean Data to the horse reference genome (EquCab3.0) to obtain the initial bam file, and the SAMtools (Version 1.9) software was used to sort the bam file and remove PCR duplicates.
[0069] 3. First, use the HaplotypeCaller module of the GATK (Version 4.1.4.0) software to perform variant detection on all individuals and generate gvcf files. Then, use the CombineGVCFs function of the GATK software to merge the gvcf files of all individuals. Finally, use GenotypeGVCFs for genotyping. Only autosomes are used for subsequent analysis, and the SelectVariants function is used to perform initial filtering on the generated vcf file. SNP filtering conditions: QD < 0.0, MQ < 3.0, ReadPosRankSum < -8.0, MQRankSum < -12.5. Use GATK4 to perform variant detection on 241 samples and perform hard filtering (QD < -2.0 || ReadPosRankSum < -8.0 || FS > 60.0 || MD < 40.0 || SOR > 3.0 || efMQRankSum < -12.5 || QUAL < 30).
[0070] After quality control, finally, 241 domestic and foreign horse breed individuals and 10,714,899 SNP loci were used for subsequent genome-wide selection signal analysis.
[0071] Example 2 Validation of Molecular Markers Related to Horse Body Height Traits
[0072] 1. The research population in this study consisted of 241 domestic and foreign horse breed individuals, and the samples were from the National Animal and Poultry Germplasm Resources Bank.
[0073] 2. By using the VCFtools (Version 0.1.16) software, calculate the FST between the high body height group and the low body height group, with the parameter of window length 50 kb and step size 10 kb. Use the XPCLR (Version 1.1.2) software to calculate the XPCLR between the high body height group and the low body height group, with the parameter of window length 50 kb and step size 10 kb. Use the Selscan (Version 2.0.0) software to calculate the XPEHH between the high body height group and the low body height group. Screen the top 5% of the windows with the strongest signal values as significant regions. Use the ggplot2 (Version 3.4.4) software in R (Version 4.3.2) to visualize the analysis results ( Figure 2 )). The three methods respectively annotated 1319, 825, and 433 significant regions ( Figure 3, among which the three methods jointly identified 85 significantly associated genes, including the IGFBP1 gene). The intersection of the three screening methods annotated a total of 85 genes (including the IGFBP1 gene). The visualization results showed that in chromosome 4, within the 16.18MB-16.23MB region, this gene region was selected in the high-body high group and the low-body high group. By using VCFtools software to calculate the FST value of a single point in the high-body high group and the low-body high group, the FST value of the SNP molecular marker (rs395786667) was 0.887464 (indicating a significant allele frequency difference between the two groups).
[0074] 3. Plink (Version 1.90) software was used to calculate the genotype significance of the rs395786667 molecular marker site (located in the second exon of the IGFBP1 gene) between the high-body-high group and the low-body-high group. The results of the Fisher test and the chi-square test showed that the difference in this site between the high-body-high group and the low-body-high group was extremely significant (P<0.01) (e.g. Figure 4 as shown).
[0075] The above results indicate that the present invention verified the function of the rs395786667 molecular marker (a SNP molecular marker located at the 16223041bp position of horse chromosome 4, with a polymorphism of A / G) through a group of 241 domestic and foreign horse breeds. The A allele at this site significantly increases body height, and the AA or AG genotype is the dominant genotype, corresponding to the high body height trait.
[0076] Example 3 Application of SNP molecular markers in horse breeding for high-quality traits
[0077] The reserve stallions are tested for rs395786667 molecular markers; individuals with the AA or AG genotype obtained by the test are selected as the reserve stallions, and the GG genotype stallion individuals are eliminated. Horses with high body height traits can be selected as reserve stallions to achieve the selection of stallions for body height traits.
[0078] The specific method for amplifying the rs395786667 molecular marker is as follows:
[0079] 1. Primer pairs include:
[0080] Forward primer (SEQ ID NO: 2): 5′-AGGGAGTGTGGACAACCAGG-3′;
[0081] Reverse primer (SEQ ID NO:3): 5′-TGTCTGTGCTCTGAGACTCG-3′.
[0082] 2. The PCR amplification method is as follows:
[0083] (1) Extract the genomic DNA of the horse to be tested;
[0084] (2) Using the genomic DNA as a template, perform PCR amplification with the primers shown in SEQ ID NO: 2-3;
[0085] (3) Analyze the PCR amplification products.
[0086] 3. PCR reaction system
[0087] The amplification system is 50 μL in total and includes: 1 μL of 100 ng / μL template DNA, 1 μL each of 10 pmol / μL forward primer and reverse primer, 1 μL of 10 mmol / L dNTP Mixture, 1 μL of 1.25 U / 25 μL TaKaRa Ex Taq DNA polymerase, 25 μL of 2×PCR reaction buffer, and the balance is double-distilled water.
[0088] 4. PCR reaction program
[0089] The PCR reaction program is: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing at 55 °C or 60 °C for 30 s, extension at 72 °C for 1-2 min, for a total of 30-35 cycles; incubation at 72 °C for 2 min.
[0090] For the obtained PCR amplification products, the nucleotide type at the 151st position can be directly detected by gene sequencing (a highly commercialized method), and the gene can be judged as AA, AG or GG according to the gene sequencing results.
[0091] Example 4 Application of SNP molecular marker in breeding horse lines with high body height traits
[0092] Detect the rs395786667 molecular marker in the reserve breeding stallions; select and retain individuals with the detected allele genotypes of AA or AG as breeding stallions, and breed the selected male and female breeding horses; detect the rs395786667 molecular marker in the horses born from the breeding, retain individuals with AA or AG genotypes, eliminate individuals with GG genotypes, and conduct breeding, then a horse line with high production performance and high body height traits can be cultivated.
[0093] In this example, the method for detecting the rs395786667 molecular marker is the same as that in Example 3.
[0094] Example 5 A method for genetic improvement of horses
[0095] Detect the rs395786667 molecular marker in reserve stallions; select stallion individuals with the AA or AG genotype and eliminate those with the GG genotype; use the selected individuals as stallions for breeding, and continue to select stallion individuals with the AA or AG genotype of the rs395786667 molecular marker in the offspring, and eliminate those with the GG genotype; gradually increase the frequency of allele A in the offspring horse population, thereby increasing the body height of the offspring stallions.
[0096] The method for detecting the rs395786667 molecular marker in this example is the same as that in Example 3.
[0097] Example 6 Application of SNP molecular marker in screening foals with high body height traits
[0098] Detect the rs395786667 molecular marker in the foals to be screened; when the genotype of the detected molecular marker is AA or AG, the foal to be screened has the genetic trait of high body height and is retained; when the genotype is GG, the foal to be screened has the genetic trait of low body height and is eliminated.
[0099] The method for detecting the rs395786667 molecular marker in this example is the same as that in Example 3.
[0100] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present invention and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing examples, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing examples, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the various embodiments of the present invention.
Claims
1. Use of SNP locus as a target in any of the following: (1) Predicting or detecting the body height trait of horses, or preparing a reagent for predicting or detecting the body height trait of horses, (2) Screening or identifying horse breeds with high body height traits, or preparing a reagent for screening or identifying horse breeds with high body height traits, (3) Molecular marker-assisted breeding for horse body height traits, (4) Improvement of horse breeds related to body height traits, (5) Selective breeding for horse body height traits, (6) Improvement of horse germplasm resources, The SNP locus is based on the EquCab3.0 version, a SNP molecular marker located at position 16223041bp on horse chromosome 4, with polymorphism A / G; the genotypes AA or AG of the SNP locus correspond to high body height traits, and the genotype GG corresponds to low body height traits.
2. Use of a molecular marker, primer pair, or kit in any of the following: (1) Predicting or detecting the body height trait of horses, or preparing a reagent for predicting or detecting the body height trait of horses, (2) Screening or identifying horse breeds with high body height traits, or preparing a reagent for screening or identifying horse breeds with high body height traits, (3) Molecular marker-assisted breeding for horse body height traits, (4) Improvement of horse breeds related to body height traits, (5) Selective breeding for horse body height traits, (6) Improvement of horse germplasm resources; The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, the 151st position of the nucleotide sequence is a polymorphic site, with polymorphism A / G, the genotypes AA or AG of the SNP molecular marker correspond to high body height traits, and the genotype GG of the SNP molecular marker corresponds to low body height traits; The primer pair is used to amplify the molecular marker; The kit includes the molecular marker or the primer pair.
3. A method for detecting the body height trait of a horse, characterized in that, It includes: Detecting the polymorphism of the SNP locus in the horse to be tested, and judging the body height trait of the horse to be tested according to the detection result; The SNP locus is based on the EquCab3.0 version, a SNP molecular marker located at position 16223041bp on horse chromosome 4, with polymorphism A / G; The genotypes AA or AG of the SNP locus correspond to high body height traits, and the genotype GG corresponds to low body height traits.
4. A method for cultivating a horse breed with a high body height trait, characterized in that, It includes: When breeding, collecting the SNP locus genotypes of the horse population, and using horses with genotypes AA or AG for mating; Collecting the SNP locus genotypes of the born horses, and retaining individuals with genotypes AA or AG; The SNP locus is based on the EquCab3.0 version, a SNP molecular marker located at position 16223041bp on horse chromosome 4, with polymorphism A / G.