A molecular marker closely linked to wheat scab resistance qtl-qfHB4a.1 and application thereof

By constructing natural wheat populations and developing PARMS markers, the problem of difficult analysis of wheat scab resistance genes was solved, realizing an efficient and low-cost breeding screening method and improving the accuracy of wheat disease resistance screening.

CN119842965BActive Publication Date: 2025-12-12INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510198628.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-23
Publication Date
2025-12-12
Estimated Expiration
2045-02-23

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently analyzing resistance genes in wheat scab, which limits the use of resistant materials in breeding, and traditional chemical control methods can easily cause environmental pollution.

Method used

By constructing 240 natural wheat populations, the QTL-qFHB4A.1 site on wheat chromosome 4A was identified using GWAS analysis, and a closely linked PARMS marker was developed for screening wheat scab resistance.

Benefits of technology

It enables efficient screening of wheat resistance to Fusarium head blight, improves selection efficiency and accuracy, reduces costs, and is applicable to wheat breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005282367460000041
    Figure BDA0005282367460000041
  • Figure BDA0005282367460000061
    Figure BDA0005282367460000061
  • Figure HDA0005282367470000011
    Figure HDA0005282367470000011
Patent Text Reader

Abstract

The application belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker closely linked with a wheat scab resistance QTL-qFHB4A.1 and application. qFHB4A.1 A peak SNP closely linked with the scab resistance site is located at the 584,934,370th base of the 4A chromosome of a Chinese spring reference genome, and can explain 4.8% of the phenotypic variation rate. Genotype detection is performed on 96 materials by using the PARMS marker designed by using the SNP, and it is found that the operation is simple and the typing is clear, and the wheat scab has a good selection effect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology and genetic breeding, and particularly relates to a molecular marker closely linked to a wheat scab resistance QTL-qFHB4A.1 and application thereof. BACKGROUND

[0002] Wheat scab is a fungal disease of wheat caused by Fusarium graminearum, which often occurs in areas with warm and humid climates. In epidemic years, scab can cause severe yield reduction of wheat; meanwhile, the scab-affected wheat kernels contain deoxynivalenol (DON toxin), which not only endangers human and animal health, but also seriously affects the edible and feeding values. Therefore, the occurrence of scab can cause serious economic losses to wheat production. Although chemical control can play a certain role in years when the disease is not serious, it is easy to cause environmental pollution. Therefore, analyzing the genetic mechanism of scab resistance and breeding new wheat varieties resistant to scab is the most economical and effective means to prevent and control scab.

[0003] Studies have shown that wheat scab resistance is a quantitative trait controlled by multiple genes. Due to the complexity of resistance and the fact that its phenotypic identification is easily affected by environmental conditions, the research on wheat scab resistance gene mining and molecular mechanism has been slow. At present, wheat germplasm with good resistance to scab has been found in the United States, Japan, Brazil and Switzerland, and the scab resistance loci located based on these germplasms are almost distributed on each chromosome of wheat, but most of the gene loci have small effect values. Wheat landraces Su Mai 3 and Wangshuibai from Jiangsu Province of China are recognized as materials with high resistance to scab in the world so far; a major gene locus Fhb1 located on 3BS is located in both of the two materials. In 2019, Professor Ma Zhengqiang's team of Nanjing Agricultural University and Professor Bai Guihua's team of Kansas State University in the United States cloned the Fhb1 gene, which encodes a histidine-rich calcium-binding protein TaHRC.

[0004] Although Su Mai 3 and other landraces have strong resistance to scab, they are difficult to use in breeding due to the presence of unfavorable linkage, and other agronomic traits are poor. Therefore, mining new scab-resistant materials and resistance-related gene loci is an important aspect of wheat scab resistance breeding.

[0005] The present application uses a 240-portion wheat natural population to detect QTLs of scab in multiple environments, aiming to find new QTL loci with improvement effects on wheat scab, and to develop practical high-throughput and low-cost molecular markers accordingly, which are used for selecting wheat scab resistance. SUMMARY

[0006] The application aims at providing the application of a reagent for detecting base 584,934,370 on chromosome 4A of wheat in screening breeding of wheat scab resistance.

[0007] Another object of the application is to provide the application of a primer for detecting base 584,934,370 on chromosome 4A of wheat in screening breeding of wheat scab resistance.

[0008] The last object of the application is to provide a method for screening breeding of wheat scab resistance.

[0009] In order to achieve the above object, the application adopts the following technical measures:

[0010] Obtaining a molecular marker closely linked to wheat scab resistance QTL-qFHB4A.1

[0011] (1) A population of 240 wheat varieties (lines) at home and abroad was used to conduct scab inoculation identification in the South Lake Experimental Field of Hubei Academy of Agricultural Sciences from 2014 to 2016 for three consecutive years, and the pathogenic strain was Huanggang No. 1.

[0012] (2) The 240 wheat populations were subjected to genotype analysis by using a 90K SNP chip, and markers with a deletion rate of more than 20% and a minimum allele frequency of less than 5% were removed, and a total of 19,803 SNPs were used for GWAS.

[0013] (3) The genotype and phenotype data of the above-mentioned 240 populations were used to conduct correlation analysis by using a mixed linear model of GEMMA v0.98 software. When P≤0.001, it was considered that the marker was significantly correlated with the trait.

[0014] (4) Correlation analysis found that the anti-scab locus was located on chromosome 4A of wheat, which was significant under the BLUE environment in 2016, and explained 4.8% of the phenotypic variation. The representative correlation marker was BS00035122_51. The physical position on the reference genome sequence of the wheat variety Zhongnongchun was 584.9 Mb. In three environments, the average FHB index of the material containing the disease-resistant allele was 15.5%-35.7% lower than that of the material containing the disease-susceptible allele.

[0015] (5) According to the principle of primer design, the nucleotide sequences of the front and rear positions of the peak SNP marker BS00035122_51 closely linked to qFHB4A.1 are obtained, and the detection primer sequence of the PARMS marker is: PFHB4A-Fc: GAAGGTGACCAAGTTCATGCTCAACCAGAGATTAGCTGGAGTGC; PFHB4A-Ft: GAAGGTCGGAGTCAACGGATTTCAACCAGAGATTAGCTGGAGTGT; PFHB4A-R: AATAAGAAGTCCTATAAGTTCGCAAAG.

[0016] The protection scope of the present application includes:

[0017] The reagent for detecting the 584,934,370th base on the 4A chromosome of wheat is applied to the screening breeding of wheat scab resistance.

[0018] The reagent for detecting the 584,934,370th base on the 4A chromosome of wheat is applied to the preparation of a wheat scab resistance screening kit.

[0019] The above-mentioned application is used, if the 584,934,370th base on the 4A chromosome of wheat is T, it is determined that the wheat is scab-resistant wheat.

[0020] The above-mentioned application is used, if the 584,934,370th base on the 4A chromosome of wheat is C, it is determined that the wheat is scab-sensitive wheat.

[0021] The above-mentioned application is used, and the reagent is preferably a primer.

[0022] The above-mentioned primer is preferably a PARMS detection primer, and more preferably the primer provided by the present application: PFHB4A-Fc: GAAGGTGACCAAGTTCATGCTCAACCAGAGATTAGCTGGAGTGC; PFHB4A-Ft: GAAGGTCGGAGTCAACGGATTTCAACCAGAGATTAGCTGGAGTGT; PFHB4A-R: AATAAGAAGTCCTATAAGTTCGCAAAG.

[0023] A wheat scab resistance screening breeding method comprises detecting the 584,934,370th base on the 4A chromosome of wheat by using conventional schemes in the art, and the conventional schemes include but are not limited to: sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0024] The version number of the wheat Chinese Spring genome used in the present application is IWGSC RefSeq v1.0, and the website is https: / / www.wheatgenome.org / .

[0025] Compared with the prior art, the present application has the following advantages:

[0026] (1) The present application obtains the wheat scab QTL site qFHB4A.1, which can be repeatedly detected, and can explain 4.8% of the phenotypic variation rate.

[0027] (2) The present application obtains the PARMS marker closely linked to qFHB4A.1, which has a simple and low-cost detection method, and can improve the selection efficiency and accuracy of wheat scab resistance screening. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 Figure 4 is the frequency distribution of scab phenotypes of 240 wheat natural populations in three environments.

[0029] Figure 2 Figure 6 is the difference in scab phenotypes of different genotypes of qFHB4A.1 site in three environments and BLUE.

[0030] Figure 3 Figure 8 is the genotyping results of the PARMS marker in 96 materials DETAILED DESCRIPTION

[0031] The technical solutions described in the present application are all conventional technologies in the art unless otherwise specified; the reagents or materials described are all from commercial channels unless otherwise specified. The version number of the wheat Chinese Spring genome used in the present application is IWGSC RefSeq v1.0, https: / / www.wheatgenome.org / .

[0032] Example 1:

[0033] SNP molecular marker closely linked to wheat scab resistance QTL-qFHB4A.1:

[0034] Test materials: 240 wheat varieties (lines) from domestic and foreign were used to form WAPS (Wheat Association Panel for Scab research) population. The materials used are described in the literature: Zhu Zhanwang, Xu Deng'an, Cheng Shunhe, et al. Identification and tracing of Chinese wheat varieties resistant to stripe rust gene Fhb1 [J]. Acta Agronomica Sinica, 2018, 44(4): 473-482.

[0035] (1) Fusarium head blight resistance identification: The identification of Fusarium head blight was conducted in the South Lake test field of Hubei Academy of Agricultural Sciences from 2014 to 2016 for three consecutive years. The pathogenic strain was Huanggang No. 1. The test adopted a completely randomized block design, 2-row blocks, row length 1 m, row spacing 0.25 m, 2 times of repetition, and spray inoculation. Twenty days after inoculation, the number of diseased spikes, the number of spikelets per spike, and the number of diseased spikelets per spike were investigated. The FHB index was calculated using the formula: FHB index = incidence rate x severity, wherein the incidence rate was the ratio of the number of diseased spikes to the total number of spikes, and the severity was the average of the ratio of the number of diseased spikelets per spike to the number of spikelets per spike, both in percentage. Then the BLUE value of FHB index in three years was calculated. Figure 1 ).

[0036] (2) Genotype analysis: 240 wheat populations were subjected to genotype analysis using a 90K SNP chip. 22922 SNPs with good typing results were selected for subsequent analysis. Markers with a missing rate of more than 20% and a minimum allele frequency of less than 5% were removed, leaving a total of 19803 SNPs for GWAS.

[0037] (3) GWAS analysis: The mixed linear model of GEMMA v0.98 software was used for association analysis. When P≤0.001, it was considered that the marker was significantly associated with the trait.

[0038] (4) Obtaining qFHB4A.1 and its associated SNP markers: The association analysis found a Fusarium head blight resistance locus on chromosome 4A, which was significant in 2016 and BLUE, explaining 4.8% of the phenotypic variation. The representative associated marker was BS00035122_51, and its flanking sequence was: 5'-GTCCTATAAGTTCGCAAAGCAAACTGCTGCAGATTGAAAGT AAGAGACGG[A / G]CACTCCAGCTAATCTCTGGTTGAAATCGAGTATGGTACAAAACAG GGCGT-3'. The physical position on the wheat variety Chinese Spring reference genome sequence (IWGSC, http: / / www.wheatgenome.org) was 584.9 Mb (Table 1). In three environments, the average FHB index of materials containing the resistant allele was 15.5%-35.7% lower than that of materials containing the susceptible allele Figure 2 ).

[0039] Table 1 qFHB4A.1 and its associated SNP markers

[0040]

[0041] Example 2:

[0042] Development of a PARMS marker closely linked to wheat scab:

[0043] According to the principle of primer design, the detection primer sequence of the PARMS marker is obtained as follows based on the nucleotide sequences of the front and rear positions on the peak SNP marker BS00035122_51 closely linked to qFHB4A.1:

[0044] PFHB4A-Fc: GAAGGTGACCAAGTTCATGCT CAACCAGAGATTAGCTGGAGTGC;

[0045] PFHB4A-Ft: GAAGGTCGGAGTCAACGGATT TCAACCAGAGATTAGCTGGAGTGT;

[0046] PFHB4A-R: AATAAGAAGTCCTATAAGTTCGCAAAG.

[0047] The method for detecting the genotype of the wheat qFHB4A.1 locus to be tested by using the above PARMS primer set is as follows:

[0048] (1) Extract the genomic DNA of the wheat to be tested.

[0049] (2) Prepare the reaction system. The reaction system is 5 μL, including 2.5 μL 2xPARMS PCR reaction mix (a product of Wuhan Jingpeibio Technology Co., Ltd.), primer PFHB4A-Fc, primer PFHB4A-Ft, primer PFHB4A-R aqueous solution, DNA and water. In the reaction system, the concentrations of primer PFHB4A-Fc and primer PFHB4A-Ft are both 150 nM, and the concentration of primer PFHB4A-R is 400 nM.

[0050] (3) Add 5 μL of mineral oil (to prevent sample evaporation) to the reaction system, and then perform PCR amplification.

[0051] The reaction program is as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, with a decrease of 0.8℃ per cycle until 57℃, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 32 cycles.

[0052] (4) After step (3) is completed, perform signal reading on TECAN Infinite M1000, and then make the following judgments: if blue is displayed, the corresponding wheat is or is suspected to be scab susceptible; if green is displayed, the corresponding wheat is or is suspected to be scab resistant.

[0053] Using the above primers, the genotype of Yangmai 158 and Zhengmai 366 was detected. In the scab-resistant wheat Yangmai 158, the sequence amplified by the primer is:

[0054] CAACCAGAGATTAGCTGGAGTGTCCGTCTCTTACTTTCAATCTGCAGCAGTTTGTCTTTGCGAACTTATAGGACTTCTTATT.

[0055] In the scab-sensitive wheat Zhengmai 366, the sequence amplified by the primer is: CAACCAGAGATTAGCTGGAGTGCCCGTCTCTTACTTTCAATCTGCAGCAGTTTGTCTTTGCGAACTTATAGGACTTCTTATT.

[0056] Example 3:

[0057] Universality of the PARMS marker in the selection of wheat scab resistance:

[0058] Using the PARMS primer set and experimental method designed in Example 2, 96 wheat varieties (collected by the applicant) were genotyped. The results showed that among the above 96 wheat varieties (lines), there were 77 materials with red color, and the genotype CC was detected; there were 16 materials with green color, and the genotype TT was detected; if the color was gray, it indicated that the genotype could not be detected, and there were 3 materials (Table 2, Figure 3 ).

[0059] According to the method described in Example 1, the scab inoculation identification was carried out in the South Lake test field of Hubei Academy of Agricultural Sciences from 2014 to 2016 for three consecutive years, and the FHB index was calculated. Then the FHB index BLUE value of three years was calculated.

[0060] The scab resistance of TT genotype wheat was higher than that of CC genotype, and the difference of FHB index was 14.9%, reaching a significant level (Table 2).

[0061] Table 2 Phenotype of two genotypes of PARMS marker qFHB4A.1 in 96 wheat varieties

[0062]

Claims

1. The use of a reagent for detecting the 23rd base of the polynucleotide as shown in SEQ ID NO. 1 in the selection breeding of wheat scab resistance; if a homozygote of T is detected at the 23rd base of the polynucleotide as shown in SEQ ID NO. 1, the wheat is determined as scab resistant wheat; if a homozygote of C is detected at the 23rd base of the polynucleotide as shown in SEQ ID NO. 1, the wheat is determined as scab sensitive wheat.

2. The use of a reagent for detecting the 23rd base of the polynucleotide as shown in SEQ ID NO. 1 in the preparation of a wheat scab resistance screening kit; if a homozygote of T is detected at the 23rd base of the polynucleotide as shown in SEQ ID NO. 1, the wheat is determined as scab resistant wheat; if a homozygote of C is detected at the 23rd base of the polynucleotide as shown in SEQ ID NO. 1, the wheat is determined as scab sensitive wheat.

3. Use according to claim 1 or 2, characterized in that: The reagent is a primer.

4. The use according to claim 3, wherein the primer is: PFHB4A-Fc: GAAGGTGACCAAGTTCATGCTCAACCAGAGATTAGCTGGAGTGC; PFHB4A-Ft: GAAGGTCGGAGTCAACGGATTTCAACCAGAGATTAGCTGGAGTGT; PFHB4A-R: AATAAGAAGTCCTATAAGTTCGCAAAG.

5. A method for screening and breeding wheat scab resistance, comprising detecting the 23rd base of the polynucleotide as shown in SEQ ID NO. 1, wherein the detection method is sequencing, TaqMan probe, AS-PCR, molecular beacon, high resolution melting curve, CAPS, SNaPshot, KASP, PARMS, gene chip or mass spectrometry; if a homozygote of T is detected at the 23rd base of the polynucleotide as shown in SEQ ID NO. 1, the wheat is determined as scab resistant wheat; if a homozygote of C is detected at the 23rd base of the polynucleotide as shown in SEQ ID NO. 1, the wheat is determined as scab sensitive wheat.

Citation Information

Patent Citations

  • KASP molecular marker of wheat scab resistance QTL Qfhb.sdau-4AL and application of KASP molecular marker

    CN118531144A

  • Molecular marker for detecting gibberellic disease resistant QTL QFhb-yaas-4AL and application

    CN119265344A