Compositions and methods for treating pancreatic cancer

Abstract

In various aspects and embodiments, the present disclosure provides compositions and methods for treating pancreatic cancer (e.g., pancreatic ductal adenocarcinoma or PDAC). In accordance with aspects of the present disclosure, the composition comprises an aptamer that targets the accumulation of the composition into pancreatic cancer cells, and an antisense oligonucleotide that inhibits the expression of mRNA associated with a key signaling pathway that promotes proliferation or survival in pancreatic cancer cells, such as a KRAS-RAF-MEK-ERK signaling pathway or an RTK-RAS-ERK cascade. The exemplary antisense oligonucleotides described herein target a KRAS, including a mutant KRAS. The exemplary antisense oligonucleotides described herein target a SOS1 transcript and / or a SOS2 transcript.

Description

[0001] priority

[0002] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 358,588, filed on July 6, 2022, which is hereby incorporated by reference in its entirety. Background Art

[0003] Pancreatic ductal adenocarcinoma (PDAC) is a lethal malignancy with limited treatment options. Activating mutations of the KRAS GTPase are the main dependency factor present in more than 90% of PDAC patients. New therapies targeting RAS genes (especially KRAS) and proteins that regulate Ras activity are urgently needed. In various aspects and embodiments of the present disclosure, compositions and methods for treating pancreatic cancer are provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0004] Figure 1 Diagram illustrates the knockdown of KRAS mRNA encoding a mutant KRAS protein comprising a G12C mutation mediated by antisense oligonucleotides.

[0005] Figure 2 Schematic illustration of knockdown of expression of wild-type or mutant KRAS protein (G12C mutation) mediated by antisense oligonucleotide (ASO 28) (see Table 3).

[0006] Figure 3 Schematic illustration of knockdown of expression of mutant KRAS protein (G12C mutation) mediated by antisense oligonucleotides (ASO 28 or ASO 67) (see Table 3).

[0007] Figure 4 Schematic illustration of three-dimensional (3D) cell proliferation inhibition produced by contacting cells harboring a KRAS mutation (NCI-H358 cells harboring a KRAS G12C mutation) with an antisense oligonucleotide to inhibit the expression of mutant KRAS.

[0008] Figure 5 Diagram illustrates the knockdown of KRAS mRNA encoding a mutant KRAS protein comprising a G12V mutation mediated by antisense oligonucleotides.

[0009] Figure 6 Schematic illustration of knockdown of expression of mutant KRAS protein (LCLC97TM1 cells harboring the G12V mutation) mediated by antisense oligonucleotide (ASO 80, see Table 3).

[0010] Figure 7Schematic illustration of knockdown of expression of mutant KRAS protein (LCLC97TM1 cells harboring the G12V mutation) mediated by antisense oligonucleotide (ASO 81, see Table 3).

[0011] Figure 8 Schematic illustration of 3D cell proliferation inhibition produced by contacting cells with KRAS mutations (LCLC97TM1 cells, NCI-H441 cells, or CFPAC-1 cells with G12V mutations) with antisense oligonucleotides to inhibit the expression of mutant KRAS.

[0012] Fig. 9 Schematic illustration of 3D cell proliferation inhibition produced by contacting cells with KRAS mutations (NCI-H2009 cells or SW1116 cells with G12A mutations) with antisense oligonucleotides to inhibit the expression of mutant KRAS.

[0013] Fig.10 Diagram illustrates the knockdown of KRAS mRNA encoding a mutant KRAS protein comprising a G12D mutation mediated by antisense oligonucleotides.

[0014] Figures 11A-11C Graph illustrating the specificity of the P19 aptamer for PDAC cells versus non-PDAC cells as observed by fluorescence microscopy.

[0015] Fig.12 Schematic illustration of knockdown of KRAS mRNA encoding mutant KRAS protein comprising the G12C mutation mediated by P19 aptamer-antisense oligonucleotides with different linker structures.

[0016] Fig.13 Knockdown of KRAS mRNA mediated by antisense oligonucleotides with and without P19 aptamer linkage was compared in MIA PaCa-2 cells. P19-conjugated ASOs employed a 2x C3 spacer.

[0017] Figures 14A-14B 3D illustration of inhibition of cell proliferation by inhibiting the expression of KRAS mRNA encoding a mutant KRAS protein comprising a G12C mutation mediated by antisense oligonucleotides with and without P19 aptamer linkage in MIA PaCa-2 cells. Fig.15 A, Compounds were exposed to cells for 6 days. For 15B, compounds were exposed to cells for one hour, then washed out and cultured with medium for 6 days.

[0018] Fig.15Schematic illustration of knockdown of SOS1 mRNA in MIA PaCa-2 cells mediated by antisense oligonucleotides linked or not to the P19 aptamer.

[0019] Fig.16 Schematic illustration of knockdown of SOS1 mRNA in MIA PaCa-2 cells mediated by antisense oligonucleotides linked or not to the P19 aptamer.

[0020] Fig.17 Schematic illustration of 3D cell proliferation inhibition by suppression of mutant SOS1 mRNA expression mediated by antisense oligonucleotides linked or not to P19 in MIA PaCa-2 cells (PDAC).

[0021] Fig.18 Graph illustrating 3D cell proliferation inhibition by suppression of SOS1 mRNA expression mediated by antisense oligonucleotides linked or not to P19 in MIA PaCa-2 and NCI-H1975 (NSCLC) cells. DETAILED DESCRIPTION

[0022] In various aspects and embodiments, the present disclosure provides compositions and methods for treating pancreatic cancer (e.g., pancreatic ductal adenocarcinoma or PDAC). According to aspects of the present disclosure, the composition comprises an aptamer that targets the accumulation of the composition to pancreatic cancer cells, and an antisense oligonucleotide that inhibits the expression of mRNA associated with key signaling pathways such as the KRAS-RAF-MEK-ERK signaling pathway or the RTK-RAS-ERK cascade that promotes proliferation or survival in pancreatic cancer cells.

[0023] PDAC is one of the most lethal human cancers, with a 5-year survival rate of less than about 7%. Most patients die within 6 months of diagnosis. PDAC often has KRAS mutations. KRAS (Kirsten rat sarcoma virus) or K-Ras is part of the RAS / MAPK pathway. The K-Ras protein is a GTPase that is activated by the binding of GTP. When the K-Ras protein converts GTP to GDP, it becomes inactive. When the protein is bound to GDP, it does not transmit signals to the nucleus of the cell. In normal resting cells, K-Ras is mainly bound to GDP and is inactive. When receptor tyrosine kinases (RTKs) are activated, K-Ras-GTP is temporarily formed, which regulates a large number of intracellular signaling networks and controls mitogenic processes. K-Ras can also bind to proteins of the guanine nucleotide exchange factor (GEF) class (such as SOS1), forcing the bound nucleotide (GDP) to be released from K-Ras. Single amino acid substitutions in K-Ras are responsible for activating mutations in a variety of malignancies, including lung adenocarcinoma, mucinous adenomas, pancreatic ductal carcinoma, and colorectal cancer. Common driver mutations include the G12 substitution, which renders K-Ras persistently GTP-bound and constitutively active. K-Ras is a major component of the KRAS-RAF-MEK-ERK signaling pathway, which is a key regulator of cell proliferation. See Waters AM and Der CJ, KRAS:The Critical Driver and Therapeutics Target for Pancreatic Cancer , Cold Spring Harb. Perspect. Med. 2018.

[0024] Furthermore, the RTK-Ras-ERK cascade is a central signaling module involved in the control of biological processes including cell proliferation and survival. The coupling of RTK to Ras is mediated by the Ras-specific nucleotide exchange factor Son of Sevenless (Sos), which activates Ras by inducing the exchange of GDP for GTP. The positive feedback loop involving Ras-GTP and Sos increases the amplitude and duration of Ras activation in response to EGF stimulation.

[0025] In various aspects and embodiments, the compositions of the present disclosure include RNA aptamers associated with antisense oligonucleotides, and the antisense oligonucleotides inhibit the expression of mRNAs associated with key signaling pathways in pancreatic cancer cells (such as KRAS-RAF-MEK-ERK signaling pathways or RTK-RAS-ERK pathways). Without wishing to be bound by theory, aptamers can target cell surface molecules or endocytic membrane-associated proteins (e.g., membrane receptors or glycoproteins) overexpressed or specifically expressed on pancreatic cancer cells. Related antisense oligonucleotides inhibit the expression of endogenous nucleic acids (e.g., mRNA) in pancreatic cancer cells required for KRAS-RAF-MEK-ERK signaling pathways or RTK-RAS-ERK signaling pathways. The present disclosure contemplates compositions involving conjugation between aptamers and antisense oligonucleotides or encapsulation of antisense oligonucleotides in aptamer-modified particles. As used herein, the term "conjugated to" or "conjugated" refers to a state in which two or more entities or two or more entities are directly connected or indirectly connected by covalent or non-covalent interactions. In some embodiments, conjugation is via covalent interactions.

[0026] According to the present disclosure, the aptamer comprises a nucleotide sequence that targets the accumulation of the composition to pancreatic cancer cells, thereby overcoming the limitations of previous methods of targeting mutant K-Ras and / or related signaling cascades, which lack sufficient efficacy or effectiveness or show off-target effects. In some embodiments, the aptamer comprises the nucleotide sequence GAAUGCCC (SEQ ID NO: 1003). An exemplary aptamer comprises the nucleotide sequence CUCAAUGGCGAAUGCCCGCCUAAUAGGG (SEQ ID NO: 1004) or a derivative thereof. In some embodiments, the aptamer comprises the nucleotide sequence: GGGAGACAAGAAUAAACGCUCAAUGGCGAAUGCCCGCCUAAUAGGGCGUUAUGACUUGUUGAGUUCGACAGGAGGCUCACAACAGGC (SEQ ID NO: 1005) or a derivative thereof. In some embodiments, the aptamer comprises 1 to about 20, or 1 to about 15, or 1 to about 10, or 1 to 5 nucleobase substitutions relative to SEQ ID NO: 1004 or 1005. In some embodiments, the substitutions are modified nucleobases known in the art (e.g., substitutions of U with modified U, A with modified A, G with modified G, or C with modified C). Aptamers and derivatives are described in U.S. Pat. Nos. 10,550,394, 11,261,449, and 9,464,293, each of which is hereby incorporated by reference in its entirety. In various embodiments, the aptamer has a nucleotide sequence of about 100 nucleotides or less in length, or about 88 nucleotides or less in length, or about 80 nucleotides or less in length, or about 70 nucleotides or less in length, or about 60 nucleotides or less in length, or about 50 nucleotides or less in length, or about 40 nucleotides or less in length, or about 30 nucleotides or less in length (as described above). In various embodiments, the aptamer has a length of at least about 20 nucleotides, or a length of at least about 25 nucleotides, or a length of at least about 28 nucleotides. For example, in various embodiments, the aptamer has a length of about 25 nucleotides to about 80 nucleotides, such as a length of 25 nucleotides to about 60 nucleotides, or about 25 nucleotides to about 40 nucleotides.

[0027] In various embodiments, the aptamer nucleotide sequence can be chemically modified. In some embodiments, the aptamer comprises RNA nucleotides, i.e., nucleotides with 2' hydroxyl groups. In some embodiments, the aptamer may include non-RNA nucleotides modified at the 2' position. For example, the aptamer nucleotide sequence may include one or more (or all or substantially all) pyrimidines (i.e., fU or fC) modified with 2'-fluorine, which may enhance nuclease tolerance and / or aptamer folding in some embodiments. In some embodiments, the aptamer comprises one or more additional chemical modifications described herein, including 2' modifications known in the art (e.g., 2'-O methyl, 2'-O ethyl, 2'-O methoxyethyl (MOE) and bridging nucleotides with 2' to 4' bridges (such as LNA or cEt)), backbone modifications (e.g., phosphorothioate or phosphorodithioate) or nucleobase modifications (i.e., modified nucleotides). See U.S. Patent No. 10,064,959, which is hereby incorporated by reference. In some embodiments, the construction of the aptamer does not require backbone modifications.

[0028] In some embodiments, the aptamer has the structure 5'[fC][fU][fC]AA[fU]GG[fC]GAA[fU]G[fC][fC][fC]G[fC][fC][fU]AA[fU]AGGG 3' (SEQ ID NO: 1006) and is referred to herein as P19. In this structure, "f" represents a 2' fluoro nucleotide.

[0029] In some embodiments, the aptamer comprises one or more hydrocarbon linkers (e.g., alkylene) or polyether linkers (e.g., PEG linkers) inserted between one or more nucleotides. In some embodiments, the nucleotides of the aptamer can be replaced by hydrocarbon linkers or polyether linkers (e.g., replacing 2 to 10 nucleotides), provided that the binding or selectivity of the aptamer to pancreatic cancer cells is not substantially reduced by the replacement (e.g., reduced by more than 20% or reduced by more than 10%). In some embodiments, the nucleotides are replaced by linkers that are not present in the core motif. Exemplary spacer portions are described herein and can be oligoethylene glycol portions that provide 3 to 18 atomic spacers. Aptamers with spacers can be synthesized using phosphoramidite spacer portions known in the art.

[0030] In various embodiments, the compositions of the present disclosure inhibit the expression of the KRAS gene, which is one of the four major driver genes in PDAC (KRAS, TP53, CDKN2A and SMAD4). The KRAS protein (21 kDa) is a member of the RAS gene family and has GTPase activity, so it binds GTP in the activated state and GDP in the inactivated state. Ras regulates cell proliferation, differentiation and apoptosis by activating several signal transduction pathways, including RAF / MEK / ERK, PI3K / AKT / mTOR, PLC / PKC and RAL pathways.

[0031] In some embodiments, the antisense oligonucleotide targets KRAS mRNA. Table 1 shows exemplary nucleobase sequences of antisense oligonucleotides targeting KRAS. In some embodiments, the antisense oligonucleotide comprises or consists of a nucleotide sequence listed in Table 1 or Table 2. In some embodiments, the antisense oligonucleotide targets wild-type and mutant KRAS isoform mRNAs, that is, the oligonucleotide has no specificity for mRNA encoding a mutant form of KRAS. In these embodiments, the aptamer selectively delivers the antisense oligonucleotide to cancer cells, thereby avoiding any toxicity in normal cells due to the loss of KRAS expression, and genetic testing of the patient's KRAS mutation is not required.

[0032] In some embodiments, the antisense oligonucleotide targets a mutant KRAS mRNA (e.g., encoding a G12 mutant), and such antisense oligonucleotide may comprise or consist of a nucleotide sequence shown in Table 3. In yet other embodiments, the oligonucleotide comprises or consists of a sequence listed in Table 4. For simplicity, a DNA nucleotide sequence (i.e., including a T nucleobase) or an RNA nucleotide sequence (i.e., including a U nucleobase) may be used herein to display a nucleotide sequence. It will be understood from the context (unless otherwise stated) that when a nucleotide or sequence is intended to be RNA, the T nucleotide is substituted with a U (or a modified U, such as a pseudouridine or 1-methylpseudouridine), and vice versa.

[0033] In various embodiments, the antisense oligonucleotide comprises at least 8, or at least 10, or at least 12 consecutive nucleotides of a nucleotide sequence shown in Table 1, Table 2, Table 3, or Table 4. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence selected from Table 13. In some embodiments, the antisense oligonucleotide has 13 to 24 linked nucleotides (e.g., 13 to 18, or 13 to 16, or 14 to 16 consecutive nucleotides) of a sequence disclosed in Table 1, Table 2, Table 3, or Table 4 (or comprises the sequence).

[0034] Exemplary antisense oligonucleotides include or consist of a nucleotide sequence selected from Table 3. Antisense oligonucleotides (ASOs) constructed from the sequences in Table 3 are constructed as gap bodies. For example, unless Table 3 indicates otherwise, the nucleotide sequence is constructed as a 3-X-3 gap body with three locked nucleotides (LNA) on each end. Antisense oligonucleotides are completely phosphorothioate-connected. Alternatively, ASOs can also be constructed according to other chemical features described herein.

[0035] Exemplary antisense oligonucleotides include or consist of a nucleotide sequence selected from Table 4. Antisense oligonucleotides constructed from the sequences in Table 4 can also be constructed as gap bodies. For example, the nucleotide sequence can be constructed as a 3-X-3 gap body with three locked nucleotides (LNA) on each end. Antisense oligonucleotides can be completely phosphorothioate-linked. Alternatively, ASOs can also be constructed according to other chemical features described herein.

[0036] Exemplary nucleotide sequences and antisense oligonucleotides targeting KRAS (wild type or mutant) are described in WO 2023 / 034537 and U.S. Provisional Application No. 63 / 480,467, both of which are hereby incorporated by reference in their entirety. Such nucleotide sequences and antisense oligonucleotides can be used in conjunction with the present disclosure.

[0037] In some embodiments, the antisense oligonucleotide targets KRAS mRNA encoding mutant KRAS. In various embodiments, the mutant KRAS is selected from the group consisting of a G12C mutation, a G12V mutation, a G12A mutation, and a G12D mutation. For example, the antisense oligonucleotide may comprise or consist of a nucleotide sequence selected from Table 3 or Table 4.

[0038] In some embodiments, antisense oligonucleotides selectively target and inhibit SOS1 and / or SOS2 expression, thereby preventing SOS1 from interacting with KRAS in the "off" state (ie, the inactive state of KRAS) bound to guanosine diphosphate (GDP).

[0039] In some embodiments, the antisense oligonucleotide targets SOS1 and / or SOS2 mRNA (e.g., hybridizes with them). Son of Sevenless 1 and Son of Sevenless 2 (SOS1 and SOS2) promote RAS activation. In some embodiments, the oligonucleotide targets SOS1, transcript variant 2 (NM_001382394.1), transcript variant 3 (NM_001382395.1), or transcript variant 1 (NM_005633.4). In some embodiments, the antisense oligonucleotide targets SOS2 mRNA (NM_006939.4). In some embodiments, the antisense oligonucleotide is complementary to SOS1 or SOS2, but also has significant activity against another mRNA. Nucleotide sequences and antisense oligonucleotides targeting SOS1 or SOS2 mRNA (e.g., hybridizing to them) are described in WO2022 / 226377, U.S. Provisional Application No. 63 / 358,588, U.S. Provisional Application No. 63 / 476,895, and U.S. Provisional Application No. 63 / 479,103, the contents of which are hereby incorporated by reference in their entirety, and such nucleotide sequences and antisense oligonucleotides can be used in conjunction with the present disclosure. Exemplary nucleotide sequences for constructing antisense oligonucleotides are provided herein in Table 13.

[0040] In various embodiments, the antisense oligonucleotide comprises at least 8, or at least 10, or at least 12 continuous nucleotides of the nucleotide sequence of Table 13. In various embodiments, the antisense oligonucleotide has 13 to 24 connected nucleotides, 13 to 18 connected nucleotides, or 13 to 16 connected nucleotides. In some embodiments, the length of the antisense oligonucleotide is 14 to 16 nucleotides. In some embodiments, the antisense oligonucleotide is composed of a nucleotide sequence selected from Table 13. In some embodiments, the antisense oligonucleotide comprises or consists of a nucleotide sequence of Table 13. In some embodiments, as described herein, the nucleotide sequence of targeting SOS1 and / or SOS2 mRNA is constructed as a gap body. Unless otherwise specified, the ASO compound of Table 13 is constructed as a gap body with 2 or 3 LNAs on each end (and is completely phosphorothioate connected). In some embodiments, the wing segment can include a 5-methylcytosine nucleobase replacing an RNA nucleotide. In exemplary embodiments, the antisense oligonucleotide consists of the nucleotide sequence of SEQ ID NO:582, SEQ ID NO:835, or SEQ ID NO:1000.

[0041] In some embodiments, the combination of antisense oligonucleotide and target mRNA (for example, hybridization) causes the degradation of target mRNA or blocks the translation of target mRNA. In some embodiments, the combination of antisense oligonucleotide and target mRNA produces a duplex nucleic acid molecule, and then the duplex nucleic acid molecule recruits endogenous nucleases to degrade mRNA. In some embodiments, antisense oligonucleotide has a DNA nucleotide extension segment sufficient to recruit RNase H, thereby triggering the degradation of target mRNA. For example, antisense oligonucleotide can have an extension segment (for example, a central extension segment) of at least 6 or at least 8 DNA nucleotides, and is optionally an extension segment with 9 or 10 DNA nucleotides. In some embodiments, one or more DNA nucleotides include 2' chemical modifications independently selected from 2'-fluoro, 2'-methyl and 2'-ethyl. For example, antisense oligonucleotide can be a gap body with 5' segment and 3' segment, each of which has 2 to 6 nucleotides or 2 to 4 nucleotides, and wherein 5' segment and 3' segment do not contain DNA nucleotides. In some embodiments, the gap body is a 3-X-3 gap body, with 3 RNA nucleotides (for example, such as LNA) on each end. In some embodiments, the gap body is a 3-8-3 gap body with a central block of DNA nucleotides and a 5' segment and a 3' segment of each 3 RNA nucleotides. In other embodiments, the gap body is a 2-X-2 gap body, such as a 2-10-2 gap body or a 2-9-2 gap body with a central block of 8 to 10 DNA nucleotides and a 5' segment and a 3' segment of each 2 RNA nucleotides. In some embodiments, the gap body is a 3-X-2 gap body or a 2-X-3 gap body. In some embodiments, the gap body is a 3-10-3 gap body. In some embodiments, one or more nucleotides of the 5' segment and the 3' segment include a 2'-O substituent, and optionally all nucleotides of the 5' segment and the 3' segment include a 2'-O substituent. Exemplary 2'-O substituents are independently selected from 2'-O methyl, 2'-O ethyl, 2'-O methoxyethyl (MOE), and a bridging nucleotide having a 2' to 4' bridge (e.g., a locked nucleotide or a bicyclic nucleotide). In some embodiments, the bridging nucleotide has a methylene bridge (LNA) or a constrained ethyl bridge (cEt). In yet other embodiments, one or more cytosine nucleotides in the 5' segment and the 3' segment can be a 5-methylcytosine ("5Me") nucleobase (rather than a 2' modified RNA), and can be a 5-methyl dC ((5Me)dC). Such constructs are still considered gap bodies, in which the (5Me)dC nucleotides are flanked by RNA nucleotides on at least one side.

[0042] The term "gap body" refers to an oligonucleotide having a central block of deoxynucleotides (also referred to herein as "DNA nucleotides") and a 5' segment and a 3' segment of RNA nucleotides. As used herein, the term "DNA nucleotide" refers to a nucleotide that is not an RNA nucleotide. DNA nucleotides typically have a 2'H, but may also have various 2' chemical modifications, including 2'-halo and 2'-low alkyl (e.g., C1-4). In some embodiments, the 2' chemical modification of the DNA nucleotide is independently selected from 2'-fluoro, 2'-methyl and 2'-ethyl.

[0043] Locked nucleic acids (LNA) or "locked nucleotides" are described, for example, in U.S. Pat. No. 6,268,490, U.S. Pat. No. 6,316,198, U.S. Pat. No. 6,403,566, U.S. Pat. No. 6,770,748, U.S. Pat. No. 6,998,484, U.S. Pat. No. 6,670,461, and U.S. Pat. No. 7,034,133, all of which are hereby incorporated by reference in their entirety. LNAs are modified nucleotides that contain a bridge between the 2' carbon and the 4' carbon of the sugar moiety to produce a "locked" conformation and / or a bicyclic structure. Other suitable locked nucleotides that can be incorporated into the oligonucleotides of the present disclosure include those described in U.S. Pat. No. 6,403,566 and U.S. Pat. No. 6,833,361, both of which are hereby incorporated by reference in their entirety. In an exemplary embodiment, the locked nucleotide is independently selected from a 2' to 4' methylene bridge (referred to as LNA) and a constrained ethyl (cEt) bridge (see US Pat. No. 7,399,845 and US Pat. No. 7,569,686, both of which are hereby incorporated by reference in their entireties).

[0044] In some embodiments, antisense oligonucleotides have a modified backbone or modified internucleotide bond. The term "internucleotide bond" refers to a bond between two adjacent nucleosides in a polynucleotide molecule. Naturally, the internucleotide bond is a phosphodiester bond, which is formed between two oxygen atoms of a phosphate group and an oxygen atom of a sugar (at a 3' position or a 5' position), thereby forming two ester bonds that bridge two adjacent nucleosides. The modification of the internucleotide bond can provide different features, including but not limited to enhanced stability. For example, a phosphorothioate bond or a phosphorodithioate bond increases the tolerance of the internucleotide bond to nucleases. Another example is a phosphoacetate bond (PACE), which can improve transfection characteristics and enhance nuclease tolerance. The internucleotide bond and oligonucleotide backbone modification that can be used in the oligonucleotide of this specification include but are not limited to phosphodiester, phosphorothioate, phosphorodithioate, methylphosphonate, alkylphosphonate, alkylthiophosphonate, phosphotriester, phosphoramidate, phosphoramidite, phosphorodiamidate, siloxane, carbonate, alkoxycarbonyl, acetylamino ester, carbamate, morpholino oligonucleotide, peptide nucleic acid, borane, thioether, bridged phosphoramidate, bridged methylenephosphonate, bridged phosphorothioate and sulfone nucleoside interbond.In some embodiments, antisense oligonucleotide comprises one or more phosphorothioate or phosphorodithioate nucleotides.

[0045] In some embodiments, antisense oligonucleotides include one or more phosphorothioate or phosphorodithioate internucleotide bonds. In some embodiments, phosphorothioate bonds or phosphorodithioate bonds can be introduced between the last three to five nucleotides at the 5' end and / or 3' end of the oligonucleotide to reduce the degradation of exonucleases. In some embodiments, antisense oligonucleotides have a combination of phosphodiester bonds and phosphorothioate bonds / phosphorodithioate bonds. In some embodiments, antisense oligonucleotides contain at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or at least ten phosphorothioate or phosphorodithioate internucleotide bonds. In some embodiments, antisense oligonucleotides include substantially alternating phosphodiester and phosphorothioate internucleotide bonds. In some embodiments, antisense oligonucleotides are completely phosphorothioate / phosphorodithioate connected (that is, all bonds are phosphorothioate or phosphorodithioate). In some embodiments, antisense oligonucleotides and fit are completely phosphorothioate or phosphorodithioate connected.

[0046] In some embodiments, especially when RNase H recruitment is not required, the antisense oligonucleotide has a morpholino oligonucleotide backbone.Morpholino oligonucleotides generally do not trigger the degradation of their target RNA molecules, and can effectively block the target RNA sequence spatially.Morpholino oligonucleotides and their synthesis are generally disclosed in U.S. Patent No. 11,028,386, U.S. Patent No. 10,947,533 and U.S. Patent No. 10,927,378, each of which is hereby incorporated by reference in its entirety. In some embodiments, antisense oligonucleotides include thiomorpholino oligonucleotides and / or other substituted or modified nucleotides, such as those described in WO / 2019 / 060522 and WO / 2018 / 057430, each of which is hereby incorporated by reference in its entirety. For example, Langner et al. describe methods for synthesizing oligonucleotide analogs, termed thiophosphoramidate morpholino oligonucleotides (TMOs), comprising a morpholino nucleoside and a thiophosphate bond (“Synthesis and characterization of thiophosphoramidatemorpholino oligonucleotides and chimeras.” JACS 142.38(2020):16240-16253; see also Gabrijela et al., "Nuclear compartmentalization of TERT mRNA and TUG1 lncRNA is driven by intron retention." Nature Communications 12.1 (2021): 1-19; both documents are hereby incorporated by reference in their entirety). Therefore, the antisense oligonucleotides described herein may comprise all or part of TMO-modified nucleotides, or may comprise chimeras of TMO-modified nucleotides with unmodified nucleotides and / or other nucleotides (e.g., LNA) comprising different modifications.

[0047] In some embodiments, antisense oligonucleotides may contain one or more modified bases. In some embodiments, cytosine is replaced by 5-methylcytosine, and this replacement can enhance base pairing. If necessary, other modified bases (especially cytosine or guanine) can be used to reduce immunogenicity. Other modified bases are described in U.S. Patent No. 10,064,959, which is hereby incorporated by reference.

[0048] In an embodiment, the melting temperature of the antisense oligonucleotide hybridized to the target sequence is at least about 35°C. The Tm of an oligonucleotide is the temperature at which 50% of the oligonucleotide forms a double strand with its perfect complementary sequence and 50% of the oligonucleotide is free in the solution. Tm can be determined experimentally by measuring the absorbance of the oligonucleotide and its complementary sequence as a function of temperature. Tm can also be estimated using a known publicly available Tm calculator. In some embodiments, the Tm of an oligonucleotide hybridized to a target sequence is at least about 40°C, or at least about 45°C, or at least about 50°C. In some embodiments, the Tm of an oligonucleotide hybridized to a target sequence is about 35°C to about 60°C. In some embodiments, the Tm of an oligonucleotide hybridized to a target sequence is about 40°C to about 60°C, or about 50°C to about 60°C.

[0049] In various embodiments, the aptamer and antisense oligonucleotide are directly connected or indirectly connected through a joint. In some embodiments, the antisense oligonucleotide is directly or indirectly conjugated to the 3' end or 5' end of the aptamer. In an embodiment, the aptamer is directly or indirectly connected to the 3' end of the aptamer. When indirectly conjugated through a joint, the joint may or may not be bio-cleavable (for example, by nuclease or other enzymes, or by disulfide bond reduction cleavage). Exemplary joints may include amine, ester and / or disulfide functional groups. For example, a joint containing disulfide can be reduced by glutathione in an endocytic vesicle to dissociate the aptamer and antisense oligonucleotide. In some embodiments, the joint includes an alkylene (for example, C2 to C12, or C2 to C8 or C2 to C6) or oligoethylene glycol spacers, so as to provide, for example, a spacer of 3 to 60 atoms, such as a spacer of 3, 6, 9, 12, 15 or 18 atoms. An exemplary spacer 18, also referred to herein as a HEG spacer (hexaethylene glycol), is an 18-atom spacer that can be placed 5', 3', or internally. Spacer 18 can be incorporated in serial additions whenever a longer spacer is needed (eg, Sp18-Sp18).

[0050]

[0051] In some embodiments, the linker is a C3 propyl spacer.Similar to spacer 18, multiple C3 spacers can be added to introduce longer spacer arms (eg, {SpC3}{SpC3}).

[0052]

[0053] In some embodiments, the aptamer is directly connected to the antisense oligonucleotide through an oligonucleotide linker, for example, 1 to 30 nucleotides, 1 to 20 nucleotides, or 2 to 15 nucleotides, or 6 to 15 nucleotides, or 8 to 14 nucleotides. In some embodiments, the linker has 3 nucleotides. In some embodiments, the linker has 4 nucleotides. In some embodiments, the linker has 5 nucleotides. In some embodiments, the linker has 6 nucleotides. In some embodiments, the linker has 7 nucleotides. In some embodiments, the linker has 8 nucleotides. In some embodiments, the linker has 9 nucleotides. In some embodiments, the linker has 10 nucleotides. In some embodiments, the linker has 11 nucleotides. In some embodiments, the linker has 12 nucleotides. The nucleotide composition or sequence of the linker can be selected to avoid forming a secondary structure. For example, the linker can substantially avoid forming a base pair (such as a Watson-Crick base pair) of nucleotides and a combination of G and U nucleotides. In some embodiments, the nucleotide linker is an extension of a single core base, such as an oligo A (e.g., an A8 to A14 linker, such as an A12 linker). In various embodiments, the joint comprises DNA nucleotides or RNA nucleotides. For example, in some embodiments, the joint comprises DNA nucleotides and does not comprise a modified backbone. In some embodiments, the joint comprises one or more RNA nucleotides to allow RNA enzyme cleavage.

[0054] In some embodiments, the composition further comprises a sterol conjugate (e.g., a cholesterol conjugate) or a fatty acid conjugate (such as a palmitoyl or stearoyl lipid conjugate), which is optionally conjugated to the 3' end of the aptamer-antisense oligonucleotide conjugate. These moieties can enhance cell penetration. See US 9,012,225, which is hereby incorporated by reference in its entirety.

[0055] In some embodiments, the antisense oligonucleotide is encapsulated in the particle, and the aptamer is presented on the surface of the particle. In various embodiments, the particle is a liposome, a polymer nanoparticle or a lipid nanoparticle (LNP). Exemplary polymer nanoparticles can be formed by PLA, PLGA or their PEG copolymers. In some embodiments, the particle comprises a poly (β amino ester) polymer. In various embodiments, the LNP comprises a cationic lipid or an ionizable lipid, a neutral lipid, cholesterol or a cholesterol moiety and a PEGylated lipid. In an exemplary embodiment, the aptamer is attached to the end of a portion of the PEG group forming the hydrophilic outer shell.

[0056] In some embodiments, lipid nanoparticles (or LNPs) comprise structural lipids. Exemplary structural lipids can be selected from one or more of the following: cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine glycosides, ursolic acid, and tocopherol (e.g., alpha tocopherol). In some embodiments, the structural lipid is cholesterol.

[0057] In some embodiments, LNP comprises one or more phospholipids.Exemplary phospholipids are selected from the group consisting of the following: cardiolipin, sterol-modified lipids (modified with cholesterol moieties attached to the sn-2 carbon of the glycerol backbone), mixed acylglycerophospholipids and symmetrical acylglycerophospholipids.The head group of acylglycerophospholipids includes, for example, phosphatidic acid, lysophosphatidic acid, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphoinositide and phosphatidylserine. Exemplary phospholipids are selected from 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diondecanoyl-sn-glycero-3-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diacetoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin.

[0058] In some embodiments, the lipid nanoparticle composition further comprises one or more PEG lipids. PEG lipids are polyethylene glycol-modified lipids. Exemplary PEG lipids are selected from one or more of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol and PEG-modified dialkylglycerol. PEG lipids can be selected from PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-cholesterol, PEG tocopherol or PEG-DSPE lipids.

[0059] Lipid particle formulations for use with embodiments of the present disclosure include those described in US 9,738,593, US 10,221,127, US 10,166,298, which are hereby incorporated by reference in their entirety. In some embodiments, the liposome or nanoparticle further comprises a targeting moiety as described.

[0060] In another aspect, the present disclosure provides a method for treating a subject with pancreatic cancer. In various embodiments, cancer is adenocarcinoma (e.g., pancreatic ductal adenocarcinoma), squamous cell carcinoma, adenosquamous carcinoma and colloid carcinoma. In some embodiments, pancreatic cancer is phase 1 cancer, phase 2 cancer, phase 3 cancer or phase 4 cancer. In some embodiments, cancer is non-metastatic. In other embodiments, cancer is metastatic. The method includes administering an effective amount of a composition as described herein to a subject. In some embodiments, the subject is identified as having pancreatic cancer with a KRAS mutation, such as a KRAS mutation selected from a G12C mutation, a G12V mutation, a G12A mutation and a G12D mutation. In these embodiments, a composition having specificity for mutant KRAS mRNA can be selected, as has been described (e.g., see Table 3 and Table 4).

[0061] In various embodiments, the compositions of the present disclosure are administered parenterally, such as by intravenous or intra-arterial infusion. In some embodiments, the compositions are administered intramuscularly, subcutaneously, or directly infused into a target tissue (e.g., pancreatic tissue).

[0062] According to the chemical nature of the patient's illness and the compound, dosage and administration schedule can be different. In various embodiments, the composition is applied once every week, about every two months (that is, about every other week), about every month or about every season. Administration and administration schedule can also include changing administration and application frequency according to the patient's response.

[0063] As used herein, the term "about", unless the context requires otherwise, means ± 10% of the relevant value.

[0064] Other aspects and embodiments of the present disclosure will become apparent from the following examples.

[0065] Table 1 . Exemplary antisense oligonucleotides (ASOs) targeting KRAS wild-type (WT) mRNA

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076] Table 2 . Exemplary Selected Antisense Oligonucleotides (ASOs) Targeting KRAS Wild-Type (WT) mRNA

[0077]

[0078]

[0079] Table 3 . Exemplary antisense oligonucleotides (ASOs) targeting KRAS mutant mRNA

[0080]

[0081]

[0082]

[0083] Table 4 . Exemplary antisense oligonucleotides (ASOs) targeting KRAS mRNA

[0084]

[0085]

[0086] Example

[0087] Example 1: Knockdown of KRAS mRNA

[0088] Cell culture conditions and in vitro transfection

[0089] Various tumor cell lines with different KRAS mutations were plated in 96-well plates at a density of 20,000 cells per well and treated with 5nM and 20nM antisense oligonucleotides by Lipofectamine (Life Technology, USA) transfection. Transfection was performed according to the supplier's recommendations, using 0.3 μL Lipofectamine per well and incubated for 3 hours. After 2 days, the cells were harvested and Quantigene assays were performed for relative mRNA quantification (Life Technology, USA) and performed according to the supplier's instructions. The catalog numbers of KRAS and PPIB (reference genes for normalized expression) probes are SA-50338 and SA-50155, respectively. The percentage reduction of mRNA relative to non-targeted control oligonucleotides was calculated and summarized in Table 5. The results show that KRAS targeting oligonucleotides can inhibit KRAS mRNA in NCI-H358 cells (non-small cell lung cancer cell lines with KRAS mutations).

[0090] Table 5 . Antisense oligonucleotides (3-X-3 LNA gapmer, phosphorothioate linkage; nucleotide sequence from Table 4) Knockdown of KRAS mRNA

[0091]

[0092] Example 2: Inhibition of pERK

[0093] The NCI-H358 tumor cell line with KRAS mutation was plated in 96-well plates at a density of 20,000 cells per well and treated with 5nM and 20nM antisense oligonucleotides by Lipofectamine (Life Technology, USA) transfection. Transfection was performed according to the supplier's advice, using 0.3 μL Lipofectamine per well and incubated for 3 hours. After 4 days, cells were harvested and pERK AlphaLISA assay was performed (catalog ALSU-PERK-A10K, Perkin Elmer, USA). The pERK inhibition of each treatment was calculated by normalization with non-targeted control oligonucleotides and summarized in Table 6 below. The results show that oligonucleotides targeting KRAS inhibit pERK in NCI-H358 cells.

[0094] Table 6. KRAS knockdown-induced pERK inhibition (antisense oligonucleotides were constructed as 3-X-3 LNA gapmers, thiophosphoinositides) Acid ester connection; sequences from Table 3 and Table 4)

[0095]

[0096]

[0097] Example 3: Antisense oligonucleotide-mediated growth inhibition of various cancer cell lines

[0098] Various tumor cell lines carrying different KRAS mutations were plated in 384-well plates at a density of 800 cells per well and treated with 5 μM and 1 μM antisense oligonucleotides by co-incubation. After 7 days, cells were cultured according to the supplier's protocol by 2.0 assay (Promega, USA) was used to measure cell viability and calculate growth inhibition against a non-targeting control oligonucleotide. The results are summarized in Tables 7 to 10. The results showed that the mutation-targeted antisense oligonucleotides were effective for targeting mutant KRAS.

[0099] Table 7 . Antisense oligonucleotide-mediated growth inhibition of bronchoalveolar carcinoma (antisense oligonucleotides were constructed as 3-X- 3 LNA gap bodies, phosphorothioate linkages, from Table 3 and Table 4)

[0100]

[0101]

[0102] Table 8. Antisense oligonucleotide-mediated growth inhibition of large cell lung carcinoma (antisense oligonucleotides were constructed as 3-X- 3LNA gap body, phosphorothioate connection, from Table 3 and Table 4)

[0103]

[0104]

[0105] Table 9 . Antisense oligonucleotide-mediated growth inhibition of lung adenocarcinoma cells (the antisense oligonucleotide was constructed as 3-X-3 LNA gap, phosphorothioate linkage, from Table 3 and Table 4)

[0106]

[0107]

[0108] Table 10 . Antisense oligonucleotide-mediated inhibition of melanoma cell growth (antisense oligonucleotides were constructed as 3-X-3 LNA gap, phosphorothioate linkage; from Table 3 and Table 4)

[0109]

[0110]

[0111] Example 4: Knockdown of mutant KRAS (G12C mutation)

[0112] Cells were treated with Lipofectamine to transfect with the oligonucleotides described herein, and cells were harvested 48 hours after transfection for mRNA expression analysis. Data were normalized with PPIB mRNA levels and compared with non-targeting ASOs to calculate knockdown percentages. B2M represents cell transfection with transfection control. Figure 1 Graph illustrating mRNA knockdown of mutant KRAS with Gl2C mutation (NCI-H358 cells) using ASO 28, ASO 37, ASO 67 or ASO 80 (Table 3). When mediated by ASO 28 and ASO 67, mRNA knockdown of mutant KRAS with Gl2C mutation was significant.

[0113] For protein level analysis, cells were seeded in 12-well plates at 10,000 cells / well and transfected with ASO / Lipofectamine (3 μl lipofectamine). Cells were harvested 3 days after transfection for protein expression analysis. The ASO used in the study was ASO 28 (G12C ASO, 16-mer), and the cell lines used were NCI-H358 (Gl2C, heterozygous for KRAS mutation) and A375 (KRAS wild type). Figure 2 Knockdown of protein expression of downstream proteins of the KRAS and KRAS-RAF-MEK-ERK signaling pathways (pERK, a MAPK marker; and pS6, a downstream marker of ERK) are illustrated. Figure 2 Also illustrated is the increase in expression of apoptosis markers (cPARP) mediated by increasing amounts of ASO (ASO 28) used for transfection.

[0114] Figure 3Another experiment of knockdown of protein expression of downstream proteins of KRAS and KRAS-RAF-MEK-ERK signaling pathways (pERK, MAPK marker; and pS6, downstream marker of ERK) is illustrated. Cells were seeded in 6-well plates at 100,000 cells / well and transfected with ASO / Lipofectamine (3μl lipofectamine). Cells were harvested 3 days after transfection for protein expression analysis. The ASOs used in the study were ASO 28 (G12CASO, 16-mer) and ASO 67 (Gl2C ASO, 14-mer). The cell line used was NCI-H358 (Gl2C, heterozygous for KRAS mutation). In cells transfected with ASO28 or ASO67, the protein expressions of downstream proteins of KRAS and KRAS-RAFMEK-ERK signaling pathway (pERK, a MAPK marker; and pS6, a downstream marker of ERK) were decreased in a dose-dependent manner. Figure 3 Also illustrated is the increase in expression of apoptosis markers (cPARP) mediated by increasing amounts of ASOs (ASO 28 and ASO 67) used for transfection.

[0115] Figure 4 Schematic illustration of 3D cell proliferation inhibition resulting from inhibition of mutant KRAS expression by contacting cells with a KRAS mutation (NCI-H358 cells with a KRAS G12C mutation) with an oligonucleotide described herein (e.g., ASO 28 or ASO 67). 3D growth of NCI-H358 cells (with a G12C KRAS mutation) was measured 7 days (left) and 13 days (right) after ASO treatment.

[0116] Example 5: Knockdown of mutant KRAS (G12V mutation)

[0117] Cells were seeded at 10,000 cells / well in 12-well plates and transfected with ASO / Lipofectamine (3 μl Lipofectamine). Cells were harvested 3 days after transfection for protein expression analysis. The ASO used in the study was ASO 80 (Gl2V ASO, 14-mer), and the cell lines used were LCLC97TM1 (Gl2V, homozygous for KRAS mutation) and A375 (KRAS wild type).

[0118] Figure 5 Schematic illustration of mRNA knockdown of mutant KRAS with G12V mutation (NCI-H441 cells) using ASO 77, ASO 80 or ASO 81. Figure 6Diagram illustrates knockdown (mediated by ASO 80) of protein expression of Gl2V mutant KRAS and downstream proteins of the KRAS-RAFMEK-ERK signaling pathway (pERK and pAKT, both MAPK markers; and pS6, a downstream marker of ERK). Figure 7 The diagram illustrates the knockdown of protein expression of Gl2V mutant KRAS and downstream proteins of the KRAS-RAF-MEK-ERK signaling pathway (pERK and pAKT, both MAPK markers; and pS6, a downstream marker of ERK) mediated by ASO 81. Cells were seeded in 12-well plates at 10,000 cells / well and transfected with ASO / Lipofectamine (3μl lipofectamine). Cells were harvested 3 days after transfection for protein expression analysis. The ASO used in the study was ASO 80 (Gl2V ASO, 14mer), and the cell lines used were LCLC97TM1 (Gl2V, homozygous for KRAS mutation) and A375 (KRAS wild type).

[0119] Figure 8 Schematic illustration of 3D cell proliferation inhibition resulting from inhibiting expression of mutant KRAS by contacting cells with KRAS mutations (LCLC97TM1 cells, NCI-H441 cells, or CFPAC-1 cells) with oligonucleotides described herein (e.g., ASO 77-81). 3D growth was measured 7 days after ASO treatment.

[0120] Example 6: Knockdown of mutant KRAS (G12A mutation)

[0121] Fig. 9 Graph illustrating 3D cell proliferation inhibition resulting from inhibiting expression of mutant KRAS by contacting cells with KRAS mutations (NCI-H2009 cells or SW1116 cells) with oligonucleotides described herein (eg, see Table 3). 3D growth was measured 7 or 13 days after ASO treatment.

[0122] Example 7: Knockdown of mutant KRAS (G12D mutation)

[0123] Fig.10 Schematic illustration of mRNA knockdown of mutant KRAS (Panc04.03 cells) with G12D mutation using ASO 37.

[0124] Example 8: Binding specificity of P19 aptamer to PDAC cells

[0125] Cell culture and aptamer folding conditions

[0126] ATTC cells were grown in RPMI-1640 medium supplemented with 10% fetal bovine serum, 100 U / ml penicillin and 100 U / ml streptomycin (Pen-Strep) and incubated at 37° C. in a humidified incubator containing 5% CO 2 .

[0127] For aptamer folding conditions, the P19-labeled aptamer was resuspended in RNase-free water to the desired concentration. The resuspended aptamer was heated on a heating block at 80°C for 5 minutes. The P19-labeled aptamer tube was removed from the heating block and stored at room temperature until it reached 25°C. The aptamer was stored on ice until use.

[0128] Evaluation of P19 aptamer activity / binding assay conjugated with fluorescent dyes

[0129] The P19 aptamer was conjugated to Cy7 or Cy5 and in vitro binding was evaluated in a variety of cell lines. For binding assays, cells were plated in 12-well plates at 70% confluence the day before. On the day of treatment, cells were washed twice with binding buffer (DPBS + 5mM MgCl) and incubated with 500nM folded aptamer for 30 minutes. After 30 minutes of incubation, the medium was removed and the cells were fixed with 4% formalin at 37°C for 10 minutes in preparation for staining. According to the manufacturer's instructions, cells were washed twice with DPBS and stained with 1μg / ml Hoescht 33342 (15 minutes at room temperature, stored on ice in the dark until development). Cells were imaged using a Keyence BZX microscope using DAPI, Cy7 and Cy5 filters to detect nuclear staining and aptamer binding. The binding specificity imaging results of the P19 aptamer are summarized in Table 11, and the microscopy images are shown in Table 11. FIG. 11A to FIG. 11C The results showed that the P19 aptamer showed specificity for PDAC cells (MIA PaCa-2-GFP[++], PANC-1[+], CFPAC-1[+]) compared with non-PDAC cells (hepatocytes[-], non-small cell lung cancer cells[-]).

[0130] Table 11 . P19 aptamer shows specificity for PDAC cells compared with non-PDAC cell lines

[0131] Cell lines PDAC / Non-PDAC Combination MIA PaCa-2-GFP PDAC ++ PANC-1 PDAC + CFPAC-1 PDAC + HepG2 Non-PDAC, hepatocytes - NCI-H358 Non-PDAC, non-small cell lung cancer cells -

[0132] Example 9: Modulating the expression of KRAS

[0133] Cell culture conditions and in vitro transfection

[0134] ATCC cells were grown in RPMI-1640. The culture medium was supplemented with 10% fetal bovine serum, 100U / ml penicillin and 100U / ml streptomycin (Pen-strep or PS), and the cells were incubated at 37°C in a humidified incubator containing 5% CO2. For antisense treatment, cells were plated in 96-well plates at 70% confluence the day before. On the day of transfection, cells were washed once with OptiMEM culture medium and incubated in 90 μL OptiMEM. In OptiMEM, a transfection mixture was prepared by mixing antisense and Lipofectamine RNAiMax transfection reagents at the desired concentration, 10 μL of transfection mixture was added to each well, and incubated for 2 hours. At the end of 2 hours, 10 μL of serum was added to the wells, and the corresponding culture medium of the cell line was supplemented to a volume of 200 μL. Alternatively, the culture medium was changed 2 hours after transfection or the next day. ASO treatment can also be performed without a transfection reagent. In this case, ASOs were diluted in OptiMEM and added to the cell culture at a volume of less than 5% of the total volume.

[0135] mRNA knockdown assay

[0136] Cells were harvested by lysis 48 hours after transfection. Lysis and subsequent mRNA detection were performed according to the Quantigene assay specified by the manufacturer (ThermoFisher). The ability of ASO to knock down the desired mRNA was evaluated as described below. MIAPaCa-2 (CRL-1420, ATCC) cells were plated in transparent flat-bottomed 96-well plates with 15,000 cells per well and cultured overnight in RPMI1640 containing 10% FBS. According to the instructions of the manufacturer (Thermo Fisher), 30nM, 10nM, 3nM and 1nM ASOs were combined with RNAiMax to transfect cells. After 3 hours of transfection, the transfection mixture was removed and RPMI1640+10% FBS was supplemented and incubated for 48 hours. Thermo Fisher's QuantiGene was used to quantify mRNA according to the instructions. The results of KRAS mRNA knockdown by ASO are shown in Table 12.

[0137] Inhibition of cell growth

[0138] The ability of ASO to inhibit cell growth was evaluated as follows. MIA PaCa-2 cells were plated in a transparent 384-well plate (S-Bio, #MS-9384UZ) at 600 cells per well and cultured overnight in RPMI1640 containing 10% FBS. Cells were treated with different concentrations of ASO. After 7 days, cell viability was determined by measuring total ATP content using Cell Titer Glo reagent (Promega, G7570) according to the manufacturer's instructions. The results of cell proliferation inhibition are shown in Table 12.

[0139] P19 aptamer activity with short incubation time

[0140] Short incubation times were used to investigate the ability of ASOs to inhibit PDAC cell growth. It has been previously shown that the P19 aptamer can bind to the surface of PDAC cells within 10 min of incubation. Gymnosis was performed on MIA PaCa-2 (PDAC) using three different linkers (HEG spacer, C3 propyl spacer and oligo A 12 ) and incubated for 6 days or less (e.g., 30 minutes or 1 hour), the ASO solution was removed, and the culture medium was replenished. ASO 840 is based on SEQ ID NO: 526 as a fully phosphorothioate-linked 3-8-3 LNA gap body. After 6 days, cell viability was determined by measuring total ATP content using Cell Titer Glo reagent (Promega, G7570) according to the manufacturer's instructions.

[0141] Table 12 . Target mRNA knockdown and 3D cell proliferation inhibition using ASO 840 and aptamer ASO 840.

[0142]

[0143] Evaluation of the activity of P19 aptamers conjugated with ASO 840 and different linkers

[0144] Three different linkers (HEG spacer, C6 propyl spacer and oligo A 12 ) The P19 aptamer was conjugated to ASO 840. Each conjugate was transfected into MIA PaCa-2 (ATCC)] (KRAS G12C mutation) cells at increasing nanomolar concentrations. mRNA knockdown data are reported as percentage mRNA knockdown. Fig.12 Shown, the use of three different linkers (HEG spacer, C3 propyl spacer and oligo A 12 ), P19 aptamer-conjugated ASO 840 retained specific targeting activity at all P19 conjugate concentrations tested. Knockdown using ASO 840 is shown as a control. Fig.13 Knockdown of KRAS mRNA in MIAPaCa-2 cells mediated by antisense oligonucleotide (ASO 840) with and without P19 aptamer was further compared. FIG. 14A to FIG. 14B Schematic illustration of the results of the in vitro characterization of MIA PaCa-2 cells harboring a KRAS mutation (G12C mutation) with three different linkers (HEG spacer, C3 propyl spacer, and oligo A 12 )-conjugate (ASO 840) to inhibit the expression of mutant KRAS and produce 3D cell proliferation inhibition. Fig.14A MIA PaCa-2 cells were exposed to the P19 aptamer-conjugate for 6 days. Fig. 14B In the experiment, MIAPaCa-2 cells were exposed to P19 aptamer-conjugates for 1 hour, then washed out and supplemented with culture medium for 6 days. Washout experiments showed that P19 aptamer-conjugates with C6 propyl spacers (ASO 840) showed increased inhibition of 3D cell proliferation compared to P19 aptamer alone, ASO 840 alone, and other P19 aptamer-ASO840 conjugates.

[0145] Example 10: Regulating the expression of SOS

[0146] Cell culture conditions and in vitro transfection

[0147] ATCC cells were grown in RPMI-1640. The culture medium was supplemented with 10% fetal bovine serum, 100U / ml penicillin and 100U / ml streptomycin (Pen-strep or PS), and the cells were incubated at 37°C in a humidified incubator containing 5% CO2. For antisense treatment, cells were plated in 96-well plates at 70% confluence the day before. On the day of transfection, cells were washed once with OptiMEM culture medium and incubated in 90 μL OptiMEM. In OptiMEM, a transfection mixture was prepared by mixing antisense and Lipofectamine RNAiMax transfection reagents at the desired concentration, 10 μL of transfection mixture was added to each well, and incubated for 2 hours. At the end of 2 hours, 10 μL of serum was added to the wells, and the corresponding culture medium of the cell line was supplemented to a volume of 200 μL. Alternatively, the culture medium was changed 2 hours after transfection or the next day. ASO treatment can also be performed without a transfection reagent. In this case, ASOs were diluted in OptiMEM and then added to the cell culture at a volume of less than 5% of the total volume.

[0148] mRNA knockdown assay

[0149] Cells were harvested by lysis 48 hours after transfection. Lysis and subsequent mRNA detection were performed according to the Quantigen assay specified by the manufacturer (ThermoFisher).

[0150] The ability of ASO to knock down the desired mRNA is evaluated as described below. MIA PaCa-2 (CRL-1420, ATCC) cells are plated in transparent flat-bottom 96-well plates with 15,000 cells per well and cultured overnight in RPMI1640 containing 10% FBS. According to the instructions of the manufacturer (Thermo Fisher), 5nM and 20nM ASOs are combined with RNAiMax to transfect cells. After 3 hours of transfection, the transfection mixture is removed and RPMI1640+10% FBS is supplemented and incubated for 48 hours. ThermoFisher's QuantiGene is used to perform mRNA quantification according to the instructions. The results of the SOS1 mRNA and SOS2 mRNA knockdown performed by ASO are shown in Table 13.

[0151] Inhibition of cell growth

[0152] The ability of ASO to inhibit cell growth was evaluated as follows. MIA PaCa-2 cells were plated in a transparent 384-well plate (S-Bio, #MS-9384UZ) at 600 cells per well and cultured overnight in RPMI1640 containing 10% FBS. Cells were treated with different concentrations of ASO. After 7 days, cell viability was determined by measuring total ATP content using Cell Titer Glo reagent (Promega, G7570) according to the manufacturer's instructions. The results of cell proliferation inhibition are shown in Table 13.

[0153] Table 13 . SOS1 mRNA and SOS2 mRNA knockdown and 3D cell proliferation inhibition (ASOs were constructed as 3-X-3, 2-X- 3, 3-X-2 or 2-X-2 LNA gap, completely phosphorothioate linked)

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171] Three different linkers (HEG spacer, C6 propyl spacer and oligo A 12 ) The P19 aptamer was conjugated to ASO 674. ASO 674 is a fully phosphorothioate-linked 3-8-3 gapmer. Each conjugate was transfected into MIA PaCa-2 (ATCC) cells at increasing nanomolar concentrations. SOS1 mRNA and SOS2 mRNA knockdown data are reported as percentage mRNA knockdown. Fig.15 It was shown that using three different linkers (HEG spacer, C3 propyl spacer and oligo A12), P19 aptamer-conjugated ASO 674 retained SOS1-specific targeting activity against all P19 conjugates. Fig.16 It was shown that P19 aptamer-conjugated ASO 232 (fully phosphorothioate-linked 3-8-3 gapmer) retained SOS1-specific targeting activity for the P19 conjugate using a 2x C3 propyl spacer compared to the antisense oligonucleotide alone.

[0172] Fig.17 Schematic illustration of 3D cell proliferation inhibition produced by contacting MIA PaCa-2 cells with a P19 aptamer-conjugate (e.g., ASO 232) using a C6 linker to inhibit SOS1 mRNA expression. Fig.17 In the experiment, MIA PaCa-2 cells were exposed to P19 aptamer-conjugates for 7 days or 1 hour, then washed out and replenished with culture medium. Washout experiments showed that P19 aptamer-conjugate with C6 propyl spacer (ASO 232) showed increased inhibition of 3D cell proliferation compared to ASO232 alone.

[0173] Fig.18 Graph illustrating 3D cell proliferation inhibition resulting from inhibition of SOS1 mRNA expression in MIA PaCa-2 (PDAC) and NCI-H1975 (NSCLC, ATCC CRL-5908) cells cultured with P19 aptamer-ASO 232 conjugate (C6 linker) for 7 days and 30 minutes followed by washout. Fig.18 In the results, the results showed that ASO 232 had 3D cell proliferation inhibition effects on both MIA PaCa-2 (PDAC) and NCI-H1975 (NSCLC, ATCC CRL-5908) cells. The P19 aptamer-conjugate with a C6 propyl spacer (ASO 232) showed increased 3D cell proliferation inhibition only in MIA PaCa-2 (PDAC) cells, but not in NCI-H1975 (NSCLC, ATCC CRL-5908) cells. These results support the specificity of the P19 aptamer for MIA PaCa-2 (PDAC) cells.

Claims

1. A composition comprising: an aptamer comprising a nucleotide sequence that targets the accumulation of the composition to pancreatic cancer cells, and Antisense oligonucleotides that inhibit the expression of mRNA associated with the KRAS-RAF-MEK-ERK signaling pathway or the RTK-RAS-ERK signaling pathway in pancreatic cancer cells.

2. The composition of claim 1, wherein the aptamer comprises the nucleotide sequence GAAUGCCC (SEQ ID NO: 1003).

3. The composition of claim 2, wherein the aptamer comprises the nucleotide sequence CUCAAUGGCGAAUGCCCGCCUAAUAGGG (SEQ ID NO: 1004) or a derivative thereof.

4. The composition of claim 3, wherein the aptamer comprises the nucleotide sequence: GGGAGACAAGAAUAAACGCUCAAUGGCGAAUGCCCGCCUAAUAGGGCGUUAUGACU UGUUGAGUUCGACAGGAGGCUCACAACAGGC (SEQ ID NO: 1005) or a derivative thereof.

5. The composition of any one of claims 1 to 4, wherein the aptamer nucleotide sequence is chemically modified. The composition of claim 5 , wherein the aptamer nucleotide sequence comprises 2′F-Py.

7. The composition of any one of claims 1 to 6, wherein the antisense oligonucleotide targets KRAS mRNA.

8. The composition of claim 7, wherein the antisense oligonucleotide comprises at least 8, or at least 10, or at least 12 consecutive nucleotides of an oligonucleotide of any one of Tables 1 to 4.

9. The composition of claim 8, wherein the antisense oligonucleotide has 13 to 24 linked nucleotides.

10. The composition of claim 8, wherein the antisense oligonucleotide has 13 to 16 linked nucleotides.

11. The composition of any one of claims 7 to 10, wherein the antisense oligonucleotide targets KRAS mRNA encoding mutant KRAS.

12. The composition of claim 11, wherein the mutant KRAS is selected from the group consisting of a G12C mutation, a G12V mutation, a G12A mutation, and a G12D mutation.

13. The composition of claim 12, wherein the antisense oligonucleotide consists of a nucleotide sequence selected from Table 3 or Table 4.

14. The composition of any one of claims 1 to 6, wherein the antisense oligonucleotide targets SOS1 mRNA and / or SOS2 mRNA.

15. The composition of claim 14, wherein the antisense oligonucleotide comprises at least 8, or at least 10, or at least 12 consecutive nucleotides of a sequence of Table 13.

16. The composition of claim 15, wherein the antisense oligonucleotide has 13 to 24 linked nucleotides.

17. The composition of claim 15, wherein the antisense oligonucleotide has 13 to 16 linked nucleotides.

18. The composition of claim 15, wherein the antisense oligonucleotide consists of a nucleotide sequence selected from Table 13.

19. The composition of any one of claims 1 to 18, wherein the antisense oligonucleotide has a stretch of at least 6 DNA nucleotides sufficient to recruit RNase H.

20. The composition of claim 19, wherein the antisense oligonucleotide has a stretch of at least 8 DNA nucleotides, and the stretch is optionally a stretch of 9 or 10 DNA nucleotides.

21. The composition of claim 19 or 20, wherein one or more DNA nucleotides comprise a 2' chemical modification independently selected from 2'-fluoro, 2'-methyl and 2'-ethyl.

22. The composition of any one of claims 19 to 21, wherein the antisense oligonucleotide is a gapmer having a 5' segment and a 3' segment, each of the 5' segment and the 3' segment having 2 to 6 nucleotides or 2 to 4 nucleotides, and wherein the 5' segment and the 3' segment do not contain DNA nucleotides.

23. The composition of claim 22, wherein the antisense oligonucleotide is a 3-X-3 gap, a 2-X-2 gap, a 2-X-3 gap, or a 3-X-2 gap.

24. The composition of claim 22 or 23, wherein one or more nucleotides of the 5' segment and the 3' segment comprise a 2'-0 substituent, optionally wherein all of the nucleotides of the 5' segment and the 3' segment comprise a 2'-0 substituent.

25. The composition of claim 24, wherein the 2'-O substituents are independently selected from 2'-O methyl, 2'-O ethyl, 2'-O methoxyethyl (MOE), and a bridged nucleotide having a 2' to 4' bridge.

26. The composition of claim 25, wherein the bridging nucleotide has a methylene bridge (LNA) or a constrained ethyl bridge (cEt).

27. The composition of any one of claims 1 to 26, wherein the antisense oligonucleotide has a modified backbone.

28. The composition of claim 27, wherein the antisense oligonucleotide and / or the aptamer comprises one or more phosphorothioate or phosphorodithioate nucleotides.

29. The composition of claim 28, wherein the oligonucleotide and / or the aptamer is fully phosphorothioate or phosphorodithioate linked.

30. The composition of any one of claims 1 to 29, wherein the cytidine nucleobase in the antisense oligonucleotide and / or the aptamer is 5-methylcytidine.

31. The composition of any one of claims 1 to 30, wherein the antisense oligonucleotide hybridizes to its target sequence with a Tm of at least about 35°C, or at least about 40°C, or at least about 45°C, or at least about 50°C.

32. The composition of claim 31, wherein the Tm of the oligonucleotide that hybridizes to a target sequence is about 35°C to about 60°C, or about 40°C to about 60°C, or about 50°C to about 60°C.

33. The composition of any one of claims 1 to 32, wherein the aptamer is directly linked to the antisense oligonucleotide or indirectly linked via a linker.

34. The composition of claim 33, wherein the linker is an oligoethylene glycol spacer, and optionally a hexaethylene glycol spacer.

35. The composition of claim 33, wherein the linker is a C3 spacer.

36. The composition of claim 33, wherein the linker is a nucleotide linker.

37. The composition of claim 36, wherein the nucleotide linker has a length of 1 to 20 nucleotides, or a length of 2 to 15 nucleotides.

38. The composition of claim 37, wherein the linker is a stretch of a single nucleobase.

39. The composition of claim 38, wherein the linker is oligo A.

40. The composition of claim 39, wherein the oligo A linker has 12 nucleobases.

41. The composition of any one of claims 37 to 40, wherein the linker comprises DNA nucleotides.

42. The composition of any one of claims 37 to 40, wherein the linker comprises RNA nucleotides.

43. The composition of claim 33, wherein the linker is a non-nucleotide linker and is optionally cleavable.

44. The composition of any one of claims 1 to 32, wherein the antisense oligonucleotide is encapsulated in a particle and the aptamer is presented on the surface of the particle.

45. The composition of claim 44, wherein the particle is a liposome, a polymer nanoparticle, or a lipid nanoparticle.

46. ​​A method for treating a subject having pancreatic cancer, comprising administering to the subject an effective amount of the composition of any one of claims 1 to 45.

47. The method of claim 46, wherein the pancreatic cancer is non-metastatic.

48. The method of claim 46, wherein the pancreatic cancer is metastatic.

49. The method of any one of claims 46 to 48, wherein the subject is identified as having pancreatic cancer with a KRAS mutation.

50. The method of claim 49, wherein the KRAS mutation is selected from the group consisting of a G12C mutation, a G12V mutation, a G12A mutation, and a G12D mutation.

Images