Mouse model construction method for selectively knocking out integrin alpha5 molecules in fibroblasts

Abstract

The invention provides a method for constructing a mouse model for selectively knocking out integrin alpha5 molecules in fibroblasts. The method comprises the following steps: hybridizing an integrin alpha5 knockout mouse (alpha5Flox / Flox) and a Col1a2-CreERT fibroblast tool mouse; the method comprises the following steps: constructing primers, respectively performing genotype identification on F2 generations of hybrid mice, screening simultaneously positive mice, and naming the mice as alpha5Flox / Flox; after the Col1a2-CreERT mouse is grown up, tamoxifen is continuously injected into the abdominal cavity of the Col1a2-CreERT mouse for 5 days to induce expression of Cre recombinase, and the alpha5-CKO mouse of which the integrin alpha5 molecule in the fibroblast is selectively knocked out is obtained. The invention also provides an application of the alpha5-CKO mouse, and the alpha5-CKO mouse is used for constructing an IBD (Inflammation Bowel Disease) mouse model. The mouse model construction method can be used for IBD progress research by applying the mouse model with the fibroblasts selectively knocking out the integrin alpha5 molecules, and an animal model basis is provided for research on the effect and mechanism of the integrin alpha5 molecules in IBD intestinal fibrosis progress.

Description

Technical Field

[0001] The present invention belongs to the technical field of mouse model construction, and specifically relates to a mouse model construction method for selectively knocking out integrin α5 molecules in fibroblasts and an application thereof. Background Art

[0002] Intestinal fibrosis is a common complication of inflammatory bowel disease (IBD), characterized by excessive deposition of extracellular matrix (ECM). Currently, there is no effective treatment to prevent or repair the progression of fibrosis. Fibroblasts are the main source of ECM and can also participate in regulating inflammatory responses and tissue fibrosis in the development of IBD by interacting with immune cells.

[0003] The tissue fibrosis matrix is ​​a very dynamic environment, and many key cell-cell and cell-matrix interactions are mediated by members of the integrin family. Previous reports on integrin α5 have mainly focused on cancer cells and vascular endothelial cells. The latest published studies have shown that integrin α5 is mainly expressed in intestinal fibroblasts, which mainly affects tumor growth by regulating ECM remodeling and affecting T cell infiltration. It is an independent prognostic factor for colorectal adenocarcinoma, suggesting a potential treatment method that targets integrin α5 and combines immunotherapy to inhibit the growth of intestinal cancer. However, in inflammatory bowel inflammation, the function of integrin α5 in fibroblasts is still unclear. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a method for constructing a mouse model with selective knockout of integrin α5 molecules in fibroblasts and its application in view of the above-mentioned deficiencies in the prior art. The mouse model construction method uses a mouse model with selective knockout of integrin α5 molecules in fibroblasts, which can be used for IBD progression research, and provides an animal model basis for exploring the role and mechanism of integrin α5 molecules in the progression of intestinal fibrosis in IBD.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is: a method for constructing a mouse model for selectively knocking out integrin α5 molecules in fibroblasts, the method comprising:

[0006] S1. Integrin α5 knockout mice (α5 Flox / Flox ) and fibroblast tool mice (Col1a2-CreERT) to obtain hybrid mice F1 generation, and the hybrid mice F1 generation are self-fertilized to obtain hybrid mice F2 generation;

[0007] S2. Construct primers to identify the genotypes of the hybrid mice F2 obtained in S1, and select mice that are positive at the same time and name them α5Flox / Flox ;Col1a2-CreERT mice;

[0008] The primers used in the genotype identification are primer set A and primer set B;

[0009] The primer set A is primer P1 and primer P2;

[0010] The primer group B is primer P3, primer P4, primer P5 and primer P6;

[0011] The nucleotide sequence of the primer P1 is shown in SEQ ID NO: 1;

[0012] The nucleotide sequence of the primer P2 is shown in SEQ ID NO: 2;

[0013] The nucleotide sequence of the primer P3 is shown in SEQ ID NO: 3;

[0014] The nucleotide sequence of the primer P4 is shown in SEQ ID NO:4;

[0015] The nucleotide sequence of the primer P5 is shown in SEQ ID NO:5;

[0016] The nucleotide sequence of the primer P6 is shown in SEQ ID NO:6;

[0017] α5 obtained in S3 and S2 Flox / Flox When Col1a2-CreERT mice reached adulthood, they were intraperitoneally injected with tamoxifen for 5 consecutive days to induce Cre recombinase expression, and α5-CKO mice with selective knockout of integrin α5 molecules in fibroblasts were obtained.

[0018] The present invention also provides the use of α5-CKO mice with selective knockout of integrin α5 molecules in fibroblasts constructed by the above-mentioned mouse model construction method, wherein the α5-CKO mice are used to construct an inflammatory bowel disease (IBD) mouse model.

[0019] Preferably, the IBD mouse model is used to study the role of integrin α5 molecules in the progression of intestinal fibrosis in IBD and provide an animal model basis for the study of its mechanism, or to prepare drugs for inflammatory bowel disease.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] 1. The present invention successfully constructed a model animal with selective knockout of integrin α5 molecules in fibroblasts. The integrin α5 molecules in the model were expressed normally before tamoxifen treatment, and the integrin α5 molecules in the in vivo fibroblasts could not be expressed after tamoxifen induction. The model can be used to study the function of integrin α5 protein in fibroblasts in vivo and its role in intestinal fibrosis in inflammatory bowel disease, liver and lung related diseases, etc. The establishment and application of this animal model will help to deeply understand the role of fibroblasts in inflammation and tumor progression, especially how integrin α5 protein molecules regulate the function of fibroblasts and its importance as a potential therapeutic target.

[0022] 2. The animal model prepared by the present invention can be used for drug screening and efficacy research for integrin α5 target sites, immune-related diseases and tumor drugs, etc., to accelerate the new drug development process, save time and cost, and reduce the risk of drug development. It can be used for the progress of fibrotic diseases, such as intestinal fibrosis during intestinal inflammation and tumor progression, and fibrosis related to liver and lung tumor progression; it provides a powerful tool for studying the function of integrin α5 protein and tumor drug screening.

[0023] The present invention is further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The α5-deficient mouse (α5-CKO) with fibroblast-specific knockout was established in Example 1 of the present invention. Figure 1 (A) Schematic diagram of the establishment process of α5-CKO mice. (B) Identification of the genotype of the F2 generation mice in (A). The upper image of the nucleic acid electrophoresis gel shows the use of primers P1 and P2 PCR to identify the α5 Flox / Flox Genotype. The figure below the nucleic acid electrophoresis gel shows the PCR identification of the Col1a2-CreERT genotype of mice using primers P3, P4, P5, and P6. The table shows the genotype identification results of 6 of the mice.

[0025] Figure 2 This is the tolerance of α5-CKO mice in Example 2 of the present invention to DSS-induced acute intestinal inflammation. Figure 2 (A) Establishment of DSS-induced acute enteritis mouse model. (B) Changes in mouse body weight. (C) Statistical analysis of enteritis incidence scores (Disease Activity Index, DAI) in mice after DSS treatment. (D) Macroscopic detection of intestinal pathological changes in mice after DSS treatment. (E) Statistics of colon length in mice after DSS treatment. (F) H&E staining of the distal end of the colon in mice after DSS treatment. (G) Scoring of histological pathological changes in the colon in mice after DSS treatment. DETAILED DESCRIPTION

[0026] Example 1

[0027] The process of constructing the mouse model of selectively knocking out the integrin α5 molecule in fibroblasts (α5-CKO) in this embodiment ( Figure 1 A), comprising the following steps:

[0028] 1) Conditional integrin α5 knockout mice (α5 Flox / Flox ), The Jackson Laboratory purchased Col1a2-CreERT (fibroblast tool mouse); constructed primers, and used PCR technology to identify the genotypes of the two mice;

[0029] 2) hybridizing the two mice to obtain hybrid mice of F1 generation, and self-pollinating the hybrid mice of F1 generation to obtain hybrid mice of F2 generation;

[0030] 3) Primers were constructed to identify the genotype of the F2 generation of hybrid mice, and hybrid mice with selective knockout of integrin α5 in fibroblasts (α5 Flox / Flox ; Col1a2-CreERT).

[0031] Primer set A and primer set B were used to identify the genotypes of the two genotypes of mice and their hybrid offspring. The mice that were positive for both primer set A and primer set B were α5 Flox / Flox ;Col1a2-CreERT mice;

[0032] Among them, primer group A is primer P1 and primer P2, and primer group B is primer P3, primer P4, primer P5 and primer P6;

[0033] The nucleotide sequence of primer P1 is TCCGACTACTTTTCCGAGCG (SEQ ID NO: 1),

[0034] The nucleotide sequence of primer P2 is CTCCCAGAGGCGAATGACTC (SEQ ID NO: 2),

[0035] The nucleotide sequence of primer P3 is CAGGAGGTTTCGACTAAGTTGG (SEQ ID NO: 3,

[0036] The nucleotide sequence of primer P4 is CATGTCCATCAGGTTCTTGC (SEQ ID NO: 4),

[0037] The nucleotide sequence of primer P5 is AGTGGCCTCTTCCAGAAATG (SEQ ID NO: 5),

[0038] The nucleotide sequence of primer P6 is TGCGACTGTGTCTGATTTCC (SEQ ID NO: 6).

[0039] 4) In the offspring of hybrid animals, cre recombinase will be expressed in fibroblasts with activated Col1a2 promoter and recognize the loxp site in the floxed α5 gene; when the offspring of hybrid animals reach adulthood, tamoxifen is injected intraperitoneally for 5 consecutive days to fuse the ligand binding region of the estrogen receptor with cre recombinase to produce a chimeric recombinase, which enters the nucleus to exert its effect, thereby specifically knocking out α5 in fibroblasts (α5-CKO mice).

[0040] (I) Extraction of mouse genomic DNA

[0041] 1) Cut the mouse tail (about 0.5 cm in length), put it into a numbered 1.5 mL centrifuge tube and cover it.

[0042] 2) Add 0.5 mL of lysis buffer (purchased from Thermo Fisher Scientific) and 50 μL of proteinase K storage solution to each tube and seal the lid tightly.

[0043] 3) Place the centrifuge tube in a hybridization oven and rotate at 56°C overnight.

[0044] 4) The next day, centrifuge the sample at 12,000 rpm for 10 minutes at room temperature.

[0045] 5) Pour the supernatant into a 1.5 mL Eppendorf tube, add 1 mL of anhydrous ethanol (about 2 times the volume of the supernatant), cover tightly and shake gently until flocculent precipitation is visible. Shake at 13000 rpm for 15 min, and discard the supernatant.

[0046] 6) Add 1 mL of 70% ethanol, wash, centrifuge at 13000 rpm for 10-15 minutes, discard the supernatant, collect the precipitate, and air-dry at room temperature for 15 minutes. Add 80-100 μL of sterile water to each tube, cover it and place it at room temperature or 37°C for 1 hour to fully dissolve. Place it at room temperature for several hours, and store it at -20°C after the DNA is completely dissolved, or directly perform experiments such as PCR or hybridization. If the DNA is not completely dissolved, it can be placed in a 37°C water bath for 30-60 minutes, but not overnight. The DNA concentration should be controlled at 50-100 ng / μL, and the OD260 / 280 should be between 1.8-2.0.

[0047] (II) PCR identification of mouse genotype

[0048] 1) Primers P1 and P2 can identify wild type (no loxp sites inserted on both sides of the α5 gene, PCR product band of 309 bp) and α5 Flox / Flox Mouse (sites were inserted on both sides of the α5 gene, and the PCR product band was 371 bp). This pair of primers can amplify bands of 309 bp and / or 371 bp from the offspring hybrid mice, which are used to identify wild-type and α5 Flox / Flox Transgenic positive mice. Figure 1 The red arrow in the nucleic acid electrophoresis diagram in B indicates that the band corresponding to Wt 309 is the wild-type genotype, and the band corresponding to Mut371 is α5 Flox / Flox Transgenic positive genotypes (Table 1).

[0049] Table 1 α5 Flox / Flox Mouse identification method

[0050]

[0051] 2) Primers P3, P4, P5, and P6 were used to identify wild-type and transgenic mice of Col1a2-CreERT. The primer pair P3 / P4 can amplify a band of 180 bp from transgenic mice, which cannot distinguish between heterozygotes and homozygotes, but can be identified as cre-positive mice. The PCR product of the primer pair P5 / P6 is an endogenous control sequence with a size of 521 bp. Both cre-positive and cre-negative mice show bands. Figure 1 The red arrow in the lower figure of the nucleic acid electrophoresis diagram in B indicates that the corresponding band of Control521 is the endogenous control sequence band, and the corresponding band of Tg18 is the cre-positive genotype. The genotype of mice with this band is Cre-positive mice (Table 2).

[0052] Table 2 Identification methods of Col1a2-CreERT mice

[0053]

[0054]

[0055] 3) Mouse crosses and genotyping screening for α5 Flox / Flox ; Col1a2-CreERT mice: The hybrid offspring of the above two genotypes were genotyped, and the mice that were positive for primers P1 and P2, primers P3, primers P4, primers P5 and primers P6 at the same time were α5 Flox / Flox ; Col1a2-CreERT mice; all identified by genotype; α5 Flox / Flox ; Col1a2-CreERT is a homozygous genotype, and all offspring can be used for experiments. It is currently in the group expansion stage. Figure 1Table B shows the genotype analysis of 6 representative F2 hybrid mice. The analysis is based on the results of nucleic acid electrophoresis. Taking the B48 mouse as an example, the P1 / P2 primers identified a single band of Mut371, which is α5 Flox / Flox Homozygous (HO) mice; the presence of Control521 identified by P3 / P4 primers indicated that there was no problem with the endogenous control sequence; the presence of Tg180 band identified by P5 / P6 primers indicated that it was a Col1a2-CreERT positive mouse. The B48 mice were finally identified as α5 Flox / Flox ; Col1a2-CreERT mice, which contain cre recombinase activity and can be induced by tamoxifen to produce α5-CKO homozygous mice.

[0056] Taking the B54 mouse as an example, its P1 / P2 primer identification band contains both Wt309 and Mut371 bands, which is α5 Flox / -Heterozygous (HE) mice; the presence of Control521 band identified by P3 / P4 primers indicated that there was no problem with the endogenous control sequence; the presence of Tg180 band identified by P5 / P6 primers indicated that it was a Col1a2-CreERT positive mouse. The B48 mice were finally identified as α5 Flox / - ; Col1a2-CreERT mice. This mouse contains Cre recombinase activity and can be induced by tamoxifen to produce α5-CKO heterozygous mice.

[0057] Taking the B64 mouse as an example, the P1 / P2 primers identified a single band of Mut371, which is α5 Flox / Flox Homozygous (HO) mice; the presence of Control521 band identified by P3 / P4 primers indicates that there is no problem with the endogenous control sequence; the absence of Tg180 band identified by P5 / P6 primers indicates that it is a Col1a2-CreERT negative mouse. B64 mice were finally identified as α5 Flox / Flox Pure and single gene mice do not contain Cre recombinase activity and cannot induce the generation of α5-CKO mice.

[0058] Figure legend: HO: homozygous α5 loxP / loxP Mouse; HE: heterozygous α5 loxP / - Mice. (+) is cre-positive mice, (-) is cre-negative mice. ×: mouse hybrid; Mice self-fertilized.

[0059] 4) Cre-ERT2 mice are a type of mice that express a fusion protein containing a mutant of the ligand binding region of the estrogen receptor (ER) (ER) and the Cre recombinase. Cre-ERT2 is inactive in the cytoplasm without Tamoxifen induction; when Tamoxifen is induced, the metabolite of Tamoxifen, 4-OHT (estrogen analogue), binds to ERT, allowing Cre-ERT2 to enter the nucleus and exert Cre recombinase activity. In the offspring of hybrid animals, cre recombinase will be expressed in fibroblasts with an activated Col1a2 promoter and recognize the loxp site in the floxed α5 gene; when the offspring of hybrid animals reach adulthood, tamoxifen is injected intraperitoneally for 5 consecutive days, which can fuse the mutant of the ligand binding region of the estrogen receptor with the cre recombinase to produce a chimeric recombinase, allowing it to enter the nucleus and exert its effect, thereby specifically knocking out α5 in fibroblasts (α5-CKO mice). Figure 1 A. Schematic diagram.

[0060] Example 2

[0061] This example is an application of the α5CKO mouse constructed by the construction method of Example 1 in treating inflammatory bowel disease.

[0062] 1) Method for constructing an inflammatory bowel disease (IBD) mouse model using α5CKO mice: an acute enteritis model was established by treating the mice with 3% DSS for five days.

[0063] 2) Phenotypic analysis of the α5CKO mouse IBD model was performed, mainly through changes in mouse body weight, colon length, and histological pathological change scores.

[0064] 3) Study on the progression of IBD disease by using the α5 protein molecule in fibroblasts. The main purpose is to detect the degree of fibrosis in DSS-induced intestinal inflammation tissues. In a mouse intestinal inflammation model, the absence of α5 in fibroblasts can reduce the degree of intestinal inflammation and fibrosis.

[0065] (I) Establishment of DSS-induced acute IBD mouse model

[0066] To investigate the function and mechanism of integrin α5 in fibroblasts during intestinal inflammation, we selected a dextran sulfatesodium (DSS)-induced enteritis model. Tamoxifen was first dissolved in corn oil at a concentration of 20 mg / ml and shaken at 37°C overnight. After tamoxifen was dissolved, it was stored at 4°C during injection. Flox / FloxCol1a2-CreERT mice were intraperitoneally injected with tamoxifen (50 mg / kg body weight) for 5 consecutive days to continuously knock out α5 from the fibroblast population (α5-CKO mice). The control group was injected with corn oil as a carrier (α5-Ctrl mice). After an interval of 10 days, 3% DSS (molecular weight 36,000-50,000) was added to the drinking water of the mice for four days to establish an acute enteritis model ( Figure 2 A). Figure 2 Figure A: Red triangle: Tamoxifen or corn oil treatment for 5 consecutive days; Blue horizontal bar: 3% DSS treatment for 4 consecutive days; Black arrow: mice were anesthetized and sacrificed.

[0067] (ii) In a mouse enteritis model, α5 deficiency in fibroblasts can reduce the degree of enteritis and fibrosis.

[0068] During the establishment of acute enteritis in mice, the body weight of mice in the experimental and control groups was measured and recorded every day. The fecal viscosity and occult blood of mice were observed at the same time, and the inflammation index (DAI score) was scored. After the experiment, the mice were anesthetized and killed, and the complete colon tissue was taken to record the length (Colon length). The colon tissue was cut and fixed, paraffin-embedded, and sliced. The tissue sections were stained with H&E and Masson, and the tissue change score (Histology score) was calculated based on the H&E staining results.

[0069] 1. For details of the scoring criteria for the inflammation index (DAI score), see Table 3.

[0070] Table 3 Scoring details of the inflammation index (DAI score)

[0071]

[0072]

[0073] 2. Colon tissue fixation, paraffin embedding, and sectioning

[0074] (1) Sampling: Fresh tissues are collected in a standardized manner from each tissue site and cut into tissue blocks of approximately 3-4 mm in size using a blade, not exceeding 5 mm.

[0075] (2) Fixation: Place the cut tissue blocks in 4% paraformaldehyde (PFA) for fixation. The ideal volume ratio of tissue block to 4% paraformaldehyde is 1:7.

[0076] (3) Wash off PFA: After fixation, rinse with running water three times, 5 minutes each time.

[0077] (4) Dehydration and transparency: This step should be set at an appropriate time according to different tissues. The basic process is as follows

[0078] Dehydration: 30% ethanol → 50% ethanol → 70% ethanol (key step: can be 2 hours on the same day or overnight) → 95% ethanol 1 → 95% ethanol 2 → anhydrous ethanol

[0079] Adjust the dehydration time according to the size and type of tissue: 95% ethanol should be controlled within 30 min-1 h, and 100% ethanol should be controlled within 5 min-30 min.

[0080] Transparent: 50% ethanol + 50% xylene → xylene 1 → xylene 2 → xylene 3

[0081] By using the properties of the clearing agent that can be mixed with both the dehydrating agent and the paraffin wax, the dehydrating agent can be replaced and the paraffin wax can be introduced into the tissue. Xylene is volatile and toxic, so this step is performed in a fume hood.

[0082] During the transparent process, timely observe the tissue morphology and adjust the transparent time. Observe whether the tissue is transparent successfully under light. It is OK if it is transparent enough. Generally, the transparent time is about 5min-30min. After transparent, put it in a small plastic box and mark it.

[0083] (5) Wax dipping: Melt the paraffin wax and keep the temperature at about 55°C. Three wax dipping passes are required in total. Because the tissue contains too much xylene in the first pass, the first wax dipping time should be as short as possible, about 15 minutes, and the next two passes can be appropriately extended to 30 minutes to 1 hour. The wax purity quality requirements for this step are not high, but it should be noted that the melting point of the paraffin wax in this step is 54-56°C.

[0084] (6) Embedding: Embedding is carried out on an embedding machine, which has a 60°C workbench and a -10°C workbench. The top is melted paraffin, and the wax is pressed out from the wax outlet.

[0085] Take a metal trough, add some paraffin, and then fix the tissue with tweezers, move it to a -10℃ table, the paraffin will solidify quickly, and the tissue will be fixed inside, and finally cover it with a marked lid. Put it on the freezing table, and you can take down the iron trough after about half an hour.

[0086] (7) Sections: Reference thickness for different tissues: liver, lung, and heart: 4-6 μm; conventional: 4 μm; lymph node and kidney: 2 μm.

[0087] (8) Slide spreading: Use a brush to carefully transfer the cut sections to clean water on a slide stand at 38-40°C. After a few minutes, the sections will be completely wrinkle-free. Select the sections with intact tissue shapes and no knife marks for scooping. Two sections can be scooped from one section. Use adhesive slides for stronger adsorption capabilities.

[0088] (9) Baking the slices: Place the slices in a 60°C oven and bake overnight. Take them out and store them at room temperature for later use.

[0089] 3. H&E staining of colon tissue sections

[0090] (1) Paraffin dissolution: Place the sections in an in situ hybridization apparatus at 70°C and bake for 30 min.

[0091] (2) Dewaxing: Rapidly place the baked sections in xylene, twice, 5 min each time.

[0092] (3) Gradient hydration: Place in 100%, 90%, 80%, and 70% ethanol for 5 min each, and then place in distilled water for 5 min.

[0093] (4) Nuclear staining: Aspirate the water and add hematoxylin staining solution (purchased from Bio-Tech Biotechnology Co., Ltd.) for 5 min. Rinse off the hematoxylin staining solution with running water and observe the degree of staining under a microscope.

[0094] (5) Differentiation: Differentiate with 1% hydrochloric acid alcohol (purchased from Biyuntian Biotechnology Co., Ltd.) for 1 to 3 seconds, wash with water, and soak in tap water for 5 to 10 minutes to turn blue. Observe the color under a microscope. If the color is not dark enough, directly add hematoxylin staining solution for 1 minute, then differentiate again and wash immediately. If the color is too dark, increase the differentiation time appropriately.

[0095] (6) Restaining: Add one drop of 0.5% eosin staining solution (purchased from Bio-Tech Biotechnology Co., Ltd.) and stain for 10-15 seconds. Wash with distilled water and observe under a microscope.

[0096] (7) Gradient dehydration: dehydration was performed with 80%, 90%, 95% and 100% ethanol.

[0097] (8) Transparency: Xylene twice, 5 min each, and dry at room temperature.

[0098] (9) Sealing: Add a drop of neutral gum on the tissue and seal with a coverslip. Observe and photograph under a microscope after 24 hours.

[0099] (10) Results

[0100] Blue: normal cell nuclei are bright blue, apoptotic cell nuclei are blue-black, necrotic cells are light blue or blue disappears, cartilage matrix and calcium salt particles are dark blue, and mucus is gray-blue;

[0101] Red: The cytoplasm is pink to pink of varying shades, the eosinophilic granules in the cytoplasm are bright red, the collagen fibers are light pink, the elastic fibers are bright pink, the red blood cells are orange-red, and the proteinaceous fluid is pink.

[0102] 4. Organizational change score, see Table 4.

[0103] Table 4 Histology score

[0104]

[0105] 5. Masson staining of colon tissue sections

[0106] Masson staining selectively stains cell nuclei, collagen fibers, and muscle fibers by using three anionic dyes: hematoxylin, brilliant green, and ponceau-acid fuchsin. During staining, different tissues can be stained with anionic dyes of different molecular sizes according to the different permeability of the tissues, showing different colors. For example, after Masson staining of fixed tissues, red blood cells, cell nuclei, etc. are stained with the smallest molecular anionic dye hematoxylin, showing purple; muscle fibers, cytoplasm, etc. are stained with the medium-sized anionic dye ponceau-acid fuchsin, showing red; and collagen fibers, etc. are stained with the large molecular anionic dye brilliant green, showing green. This experiment was performed using the Masson staining kit of Biyuntian Biotechnology Co., Ltd. This kit is complete in components, providing the hematoxylin staining solution, acid differentiation solution, ponceau-acid fuchsin staining solution, brilliant green staining solution, and phosphotungstomolybdic acid differentiation solution required for Masson staining.

[0107] Experimental steps:

[0108] (1) Paraffin dissolution: Place the sections in an in situ hybridization apparatus at 70°C and bake for 30 min.

[0109] (2) Dewaxing: Rapidly place the baked sections in xylene, twice, 5 min each time.

[0110] (3) Gradient hydration: Place in 100%, 90%, 80%, and 70% ethanol for 5 min each, and then place in distilled water for 5 min.

[0111] (4) Hematoxylin staining: Add 50 μl of hematoxylin staining solution to each tissue section, stain for 5 minutes, remove the staining solution, and wash with distilled water for 5 minutes. Differentiate with an appropriate amount of acidic differentiation solution for 30 seconds, rinse with running water to return to blue for 10 minutes, and wash with distilled water once (for a few seconds). Note: Depending on the actual size of the slice, 50-200 μL of staining solution can be added. This instruction manual takes 50 μl as an example.

[0112] (5) Ponceau-Acid Fuchsin Staining: Add 50 μL of Ponceau-Acid Fuchsin Staining Solution to each tissue section, stain for 10 minutes, remove the staining solution, rinse with distilled water for a few seconds (no more than 10 seconds), differentiate with an appropriate amount of phosphomolybdic acid differentiation solution for 2 minutes, and remove the differentiation solution.

[0113] (6) Brilliant green staining: Add 50 μL of Brilliant green staining solution to each tissue section and stain for 1 min. Remove the staining solution and rinse with distilled water for a few seconds.

[0114] (7) Differentiate with appropriate amount of acidic differentiation solution for 1 minute and remove the differentiation solution.

[0115] (8) Gradient dehydration: dehydration was performed with 80%, 90%, 95% and 100% ethanol.

[0116] (9) Transparency: Xylene twice, 5 min each, and dry at room temperature.

[0117] (10) Sealing: Add a drop of neutral gum on the tissue and seal with a coverslip. Observe and photograph under a microscope after 24 hours.

[0118] The results showed that in the acute enteritis model, the weight loss of α5-CKO mice was significantly lower than that of α5-Ctrl mice ( Figure 2 B); and compared with α5-Ctrl control mice, the intestinal inflammatory index (DAI) of α5-CKO mice was significantly lower ( Figure 2 C); the colon length is significantly longer ( Figure 2 D, E). HE staining showed that the colonic fold structure of α5-Ctrl mice was severely damaged and the lymphocyte infiltration was aggravated, while the intestinal structure of α5-CKO mice remained basically normal ( Figure 2 F, G), Figure 2 α5-CKO is a mouse with tamoxifen-induced fibroblast α5-specific knockout, and α5-Ctrl is a control mouse with corn oil-uninduced knockout.

[0119] Taken together, the above data indicate that α5-CKO mice are more tolerant to DSS-induced acute enteritis than α5-Ctrl control mice.

[0120] The degree of fibrosis in DSS-induced enteritis tissue was further detected. Hematoxylin and eosin (H&E) staining of colon tissues of mice with DSS-induced acute enteritis model showed that the colons of DSS-induced α5-Ctrl mice had severe inflammation and fibrosis, with distorted crypt structures, multiple inflammatory cells, and extensive edema in the mucosa and submucosa. In contrast, the mucosal integrity of α5-CKO mice exposed to DSS was well preserved. Masson staining of collagen in colon tissue showed that the colons of α5-Ctrl mice showed severe fibrosis, and the collagen deposition in the intestinal submucosa of α5-CKO mice was significantly less. From this, we can know that in the mouse enteritis model, the loss of α5 in fibroblasts can reduce the degree of enteritis and fibrosis.

[0121] This study investigates the role of integrin α5 expression in fibroblasts in intestinal inflammation. We established fibroblast-specific knockout mice with integrin α5 deficiency (α5-CKO). We selected a dextran sulfatesodium (DSS)-induced enteritis model. DSS is widely used in the study of inducing ulcerative colitis (UC). Both symptoms and pathological changes are similar to those of human UC, and the infiltration of lymphocytes and macrophages plays an important role in this process. The results showed that:

[0122] (1) In the DSS-induced intestinal inflammation model, α5-CKO mice showed a protective effect against intestinal inflammation compared with corn oil-uninduced knockout control mice (α5-Ctrl).

[0123] (2) Further testing of the degree of fibrosis in DSS-induced intestinal inflammatory tissues revealed that the degree of fibrosis in the intestinal inflammatory tissues of α5-CKO mice was significantly lower than that in the control mice (α5-Ctrl) without corn oil knockout, as evidenced by a decrease in collagen abundance.

[0124] The present invention demonstrates that the mouse model using fibroblasts to selectively knock out integrin α5 molecules can be used to study the progression of IBD disease, providing an animal model basis for exploring the role and mechanism of integrin α5 molecules in the progression of IBD intestinal fibrosis.

[0125] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent change made to the above embodiment according to the technical essence of the invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A method for constructing a mouse model for selectively knocking out integrin α5 molecules in fibroblasts, characterized in that: The method is: S1. Integrin α5 knockout mice Flox / Flox hybridizing with Col1a2-CreERT fibroblast tool mice to obtain hybrid mice F1 generation, and self-fertilizing the hybrid mice F1 generation to obtain hybrid mice F2 generation; S2. Construct primers to identify the genotypes of the hybrid mice F2 obtained in S1, and select mice that are positive at the same time and name them α5 Flox / Flox ;Col1a2-CreERT mice; The primers used in the genotype identification are primer set A and primer set B; The primer set A is primer P1 and primer P2; The primer group B is primer P3, primer P4, primer P5 and primer P6; The nucleotide sequence of the primer P1 is shown in SEQ ID NO: 1; The nucleotide sequence of the primer P2 is shown in SEQ ID NO: 2; The nucleotide sequence of the primer P3 is shown in SEQ ID NO: 3; The nucleotide sequence of the primer P4 is shown in SEQ ID NO:4; The nucleotide sequence of the primer P5 is shown in SEQ ID NO:5; The nucleotide sequence of the primer P6 is shown in SEQ ID NO:6; α5 obtained in S3 and S2 Flox / Flox When Col1a2-CreERT mice reached adulthood, they were intraperitoneally injected with tamoxifen for 5 consecutive days to induce Cre recombinase expression, and α5-CKO mice with selective knockout of integrin α5 molecules in fibroblasts were obtained.

2. An application of the α5-CKO mouse with selective knockout of integrin α5 molecules in fibroblasts constructed by the mouse model construction method according to claim 1, characterized in that: The α5-CKO mice are used to construct an inflammatory bowel disease (IBD) mouse model.

Images