Modified bacterial reverse transcription elements with enhanced DNA production

Abstract

The invention relates to modified bacterial reverse transcription elements with enhanced DNA production. Engineered reverse transcripts modified to enhance the production of multi-copy single-stranded DNA (msDNA) are provided. In addition, vector systems encoding such engineered reverse transcripters and methods of using engineered reverse transcripters and vector systems encoding same in a variety of applications such as CRISPR / Cas mediated genome editing, recombinant engineering, cell barcoding, and molecular recording are also disclosed.

Description

[0001] This application is a divisional application of a Chinese patent application with an application date of September 11, 2020, application number 202080078530.1, and invention name “Modified bacterial reverse transcription elements with enhanced DNA production”.

[0002] Priority application

[0003] This application claims the benefit of priority to the filing date of U.S. Provisional Application Serial No. 62 / 899,625, filed on September 12, 2019, the contents of which are specifically incorporated herein by reference in their entirety.

[0004] Incorporated by reference into the sequence listing provided as a text file

[0005] The sequence listing is provided as a text file "2072305.txt", which was created on September 10, 2020, and which is 12,288 bytes in size. The contents of this text file are incorporated herein by reference in their entirety. Technical Field

[0006] The present invention relates to modified bacterial retrotranscription elements with enhanced DNA production. Background Art

[0007] Retromer is a reverse transcription element, which is present in almost all myxobacteria (Dhundale et al. Journal of Bacteriology 164, 914-917 (1985)), rarely found in Escherichia coli (E. coli) (Lampson et al. Science 243, 1033-1038 (1989)), V. cholerae (Inouye et al. Microbiology and Immunology 55, 510-513) and other bacteria. The retromer operon encodes RNA primers (multi-copy single-stranded RNA, msr), RNA sequences to be reverse transcribed (multi-copy single-stranded DNA, msd) and reverse transcriptase in sequence. The retromer transcript is folded by itself and partially reverse transcribed to generate single-stranded DNA (single stranded DNA, ssDNA) of about 80 bases. Although the DNA from the retromer source is single-stranded, it contains a hairpin of double-stranded DNA. Multiple retroviral ssDNAs can also complement each other to form larger double-stranded elements. Retroviral variants have different DNA lengths and base contents, but widely share this overall form.

[0008] ssDNA generated by retrotransposons has been used for genome engineering in two contexts: in bacteria, with the lambda Red Beta recombinase for recombineering (Farzadfard et al. Science 346, 1256272, (2014)); and in eukaryotic contexts, as homology-directed repair (HDR) templates for Cas9 editing in yeast (Sharon et al. Cell 175, 544-557.e516, (2018)). Despite the promise, these applications suffer from lower-than-expected efficiency and background limitations that may stem from elements in the endogenous form of the retrotransposons. These include (1) a branched structure with a phosphodiester bond linking the 5' end of the ssDNA to the 2' hydroxyl of the msr RNA, (2) invariant flanking regions that may be required for reverse transcription of the retrotransposons but are not part of the repair template, (3) limited overall length, and (4) a native poly T stretch that functions as a terminator for Pol III transcription. Summary of the invention

[0009] Provided are engineered retrotransposons modified to enhance the production of multicopy single-stranded DNA (msDNA), which solve many existing problems associated with efficiency and low copy number. Also described herein are vector systems encoding such engineered retrotransposons and methods of using engineered retrotransposons and vector systems in a variety of applications such as CRISPR / Cas-mediated genome editing, recombineering, barcoding of cells, and molecular documentation.

[0010] In one aspect, an engineered reverse transcriptase is provided, comprising: a) a msr pre-sequence; b) a msr gene encoding multiple copies of single-stranded RNA (msRNA); c) a msd gene encoding multiple copies of single-stranded DNA (msDNA); d) a msd post-sequence comprising a self-complementary region having sequence complementarity with the msr pre-sequence, wherein the length of the self-complementary region is at least 1 to 50 nucleotides longer than the wild-type complementary region, so that the engineered reverse transcriptase can enhance the production of msDNA; and e) a ret gene encoding a reverse transcriptase.

[0011] The self-complementary region is formed by hydrogen bonds between the 3' and 5' ends of the ncRNA. In certain embodiments, the length of the complementary region is at least 1, at least 2, at least 4, at least 6, at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, at least 30, at least 40, or at least 50 nucleotides longer than the wild-type complementary region. For example, the self-complementary region can have a length that is 1 to 50 nucleotides longer than the wild-type complementary region, including any length within this range, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides longer. In certain embodiments, the length of the self-complementary region is 1 to 16 nucleotides longer than the wild-type complementary region.

[0012] In certain embodiments, the msr gene and the msd gene are provided in a trans arrangement or a cis arrangement. In some embodiments, the ret gene is provided in a trans arrangement relative to the msr gene and / or the msd gene.

[0013] In certain embodiments, the msr gene, msd gene, and ret gene are derived from bacterial retrotransposons, including but not limited to myxobacterial retrotransposons (e.g., Mx65, Mx162), Escherichia coli retrotransposons (e.g., E67, Ec73, EC83, EC86, EC107), Salmonella enterica retrotransposons (e.g., msDNA-St85), and Vibrio cholerae retrotransposons (e.g., Vc81, Vc95, Vc137).

[0014] In certain embodiments, the engineered reverse transcriptase also includes a heterologous sequence of interest. The heterologous sequence can be inserted into, for example, an msr gene or an msd gene. For example, a heterologous sequence can be inserted into the loop of an msd stem loop. In some embodiments, the heterologous sequence encodes a polypeptide or peptide. In other embodiments, the heterologous sequence encodes a donor polynucleotide, which comprises a 5' homology arm hybridized with a 5' genomic target sequence and a 3' homology arm hybridized with a 3' genomic target sequence, wherein the 5' homology arm and the 3' homology arm are located at the flank of the nucleotide sequence of the target editor to be integrated into the genomic target locus by homology directed repair (homology directed repair, HDR) or recombineering. In other embodiments, the heterologous sequence includes a CRISPR pre-spacer DNA sequence. In one embodiment, the CRISPR pre-spacer DNA sequence includes a modified "AAG" pre-spacer sequence adjacent motif (protospacer adjacent motif, PAM).

[0015] In certain embodiments, the engineered retrotransposons further comprise a barcode sequence. The barcode sequence can be located, for example, in a hairpin loop of the msDNA.

[0016] In another aspect, a vector system is provided, which comprises one or more vectors containing the engineered retrotranscriptor described herein. In certain embodiments, the msr gene and the msd gene are provided by the same vector or different vectors. In some embodiments, the msr gene, the msd gene and the ret gene are provided by the same vector, wherein the vector comprises a promoter operably connected to the msr gene and the msd gene. In some embodiments, the promoter is also operably connected to the ret gene. In other embodiments, the vector also comprises a second promoter operably connected to the ret gene. In certain embodiments, the msr gene, the msd gene and the ret gene are provided by different vectors.

[0017] In certain embodiments, one or more vectors of the vector system are viral vectors or non-viral vectors (eg, plasmids).

[0018] In certain embodiments, the vector system comprises an engineered retromer comprising a heterologous sequence encoding a donor polynucleotide comprising a 5' homology arm that hybridizes to a 5' genomic target sequence and a 3' homology arm that hybridizes to a 3' genomic target sequence flanking the donor polynucleotide sequence. The donor polynucleotide sequence can replace or edit the genomic target locus, for example, by homology directed repair (HDR) or recombineering.

[0019] In certain embodiments, the vector system further comprises a vector encoding an RNA-guided nuclease.Exemplary RNA-guided nucleases include, but are not limited to, Cas nucleases (e.g., Cas9, Cpf1) and engineered RNA-guided FokI nucleases.

[0020] In certain embodiments, the vector system further comprises a vector encoding a bacteriophage recombinant protein for recombineering. In some embodiments, the vector is a replication-defective prophage encoding a bacteriophage recombinant protein.

[0021] In certain embodiments, the vector system comprises an engineered retrotransposon comprising a heterologous sequence encoding a CRISPR protospacer DNA sequence. In some embodiments, the vector system further comprises a vector encoding a Cas1 or Cas2 protein. In some embodiments, the vector system further comprises a vector containing a CRISPR array sequence.

[0022] In another aspect, an isolated host cell is provided, the host cell comprising an engineered retrotransposon or vector system described herein.

[0023] In certain embodiments, the host cell is a prokaryotic, archaeal or eukaryotic host cell. For example, the host cell can be a bacterial, protist, fungal, animal or plant host cell. In some embodiments, the host cell is a mammalian host cell. The host cell can be a human or non-human mammalian host cell. In other embodiments, the host cell is an artificial cell or a genetically modified cell.

[0024] In another aspect, a kit comprising an engineered retrotransposon as described herein, or a vector system or host cell comprising such an engineered retrotransposon is provided. In some embodiments, the kit further comprises instructions for methods of using the engineered retrotransposon.

[0025] In another aspect, a method for genetically modifying a cell is provided. In some cases, the method includes transfecting a cell with an engineered reverse transcriptase. For example, the method may include: a) transfecting a cell with an engineered reverse transcriptase comprising a heterologous sequence encoding a donor polynucleotide, the donor polynucleotide comprising a 5' homology arm hybridized with a 5' genomic target sequence and a 3' homology arm hybridized with a 3' genomic target sequence, the 5' homology arm and the 3' homology arm are flanked by a nucleotide sequence of the purpose editor to be integrated into the genomic target locus by homology directed repair (HDR); and b) RNA-guided nuclease and guide RNA are introduced into the cell, wherein the RNA-guided nuclease forms a complex with the guide RNA, the guide RNA guides the complex to the genomic target locus, wherein the RNA-guided nuclease produces a double-strand break in the genomic DNA at the genomic target locus, and the donor polynucleotide produced by the engineered reverse transcriptase is integrated at the genomic target locus identified by its 5' homology arm and 3' homology arm by homology directed repair (HDR). HDR with engineered retrotransposons encoding donor polynucleotides can be used, for example, to produce gene replacement, gene knockout, deletion, insertion, inversion or point mutation. In some cases, HDR with engineered retrotransposons encoding donor polynucleotides can be used, for example, to repair genes, gene knockout, deletion, insertion, inversion or point mutation. Such methods can thus produce genetically modified cells. In some embodiments, the method also includes phenotypic analysis of genetically modified cells or sequencing of the genome of genetically modified cells.

[0026] In another aspect, a method for genetically modifying a cell by recombineering is provided, the method comprising: a) transfecting a cell with an engineered retrotransposons comprising a heterologous sequence encoding a donor polynucleotide, the donor polynucleotide comprising a 5' homology arm hybridizing to a 5' genomic target sequence and a 3' homology arm hybridizing to a 3' genomic target sequence, the 5' homology arm and the 3' homology arm flanking a nucleotide sequence of a target edited substance to be integrated into a genomic target locus by recombineering; and b) introducing a bacteriophage recombination protein into the cell, wherein the bacteriophage recombination protein mediates homologous recombination at the target locus, so that the donor polynucleotide produced by the engineered retrotransposons is integrated at the target locus recognized by its 5' homology arm and 3' homology arm, to produce a genetically modified cell. For example, recombineering with engineered retrotransposons encoding donor polynucleotides can be used to produce gene replacement, gene knockout, deletion, insertion, inversion or point mutation. In certain embodiments, the donor polynucleotide can be used to modify a plasmid, a bacterial artificial chromosome (BAC) or a bacterial chromosome (in a bacterial cell) by recombinant engineering. In some embodiments, the method also includes phenotyping the genetically modified cell or sequencing the genome of the genetically modified cell.

[0027] In certain embodiments, the phage recombinant protein is introduced into the bacterial cell by inserting a replication-defective lambda prophage into the bacterial genome. In one embodiment, the phage comprises exo, bet and gam genes.

[0028] In another aspect, a method of barcoding a cell is provided, the method comprising transfecting the cell with an engineered retrotransposon comprising a barcode, as described herein.

[0029] In another aspect, a method for producing an in vivo molecular recording system is provided, the method comprising: a) introducing a Cas1 protein or a Cas2 protein of a CRISPR adaptation system into a host cell; b) introducing a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence into a host cell, wherein the CRISPR array nucleic acid sequence is integrated into the genomic DNA in the host cell or into a vector in the host cell; and c) introducing a plurality of engineered reverse transcriptons comprising a CRISPR pre-spacer DNA sequence into a host cell, wherein each reverse transcripton comprises a different pre-spacer DNA sequence, which can be processed and inserted into the CRISPR array nucleic acid sequence. In certain embodiments, the Cas1 protein or the Cas2 protein is provided by a vector. In certain embodiments, the engineered reverse transcripton is provided by a vector. In certain embodiments, a plurality of engineered reverse transcriptons comprise at least three different pre-spacer DNA sequences.

[0030] In another aspect, an engineered cell comprising an in vivo molecular recording system is provided, the engineered cell comprising: a) a Cas1 protein or a Cas2 protein of a CRISPR adaptation system; b) a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence that enters a host cell, wherein the CRISPR array nucleic acid sequence is integrated into the genomic DNA or vector in the engineered cell; and c) a plurality of engineered reverse transcriptons, each comprising a CRISPR pre-spacer DNA sequence, wherein each reverse transcripton comprises a different pre-spacer DNA sequence, which can be processed and inserted into the CRISPR array nucleic acid sequence. In certain embodiments, the Cas1 protein or the Cas2 protein is provided by a vector. In certain embodiments, the engineered reverse transcripton is provided by a vector. In certain embodiments, a plurality of engineered reverse transcriptons comprises at least three different pre-spacer DNA sequences.

[0031] In another aspect, a kit is provided comprising an engineered cell comprising an in vivo molecular recording system as described herein. In some embodiments, the kit further comprises instructions for in vivo molecular recording.

[0032] In another aspect, a method of producing recombinant msDNA is provided, the method comprising: a) transfecting a host cell with an engineered retrotransposon or vector system described herein; and b) culturing the host cell under suitable conditions, wherein the msDNA is produced. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figures 1A to 1D Schematic diagram showing the retromer operon and potential uses of retromers. Figure 1A A schematic diagram of the retromer operon encoding msr, msd and reverse transcriptase is shown, wherein the reverse transcriptase can synthesize a DNA copy of a portion of the msd gene encoding multiple copies of single-stranded DNA. Figure 1B Recombineering is shown to be a potential use of retrotransposons, where Beta can protect ssDNA and can promote annealing of ssDNA to complementary ssDNA targets, such as DNA targets in cells. Figure 1C CRISPR / Cas9 gene editing is shown to be a potential use of retrotransposons, where retrotransposons can provide ssDNA templates that can repair variant or mutant target sites. Figure 1D Molecular records are shown to have potential use as retrotransposons (e.g., as provided in WO2018191525 A1, which is specifically incorporated herein by reference in its entirety).

[0034] Figures 2A to 2B The retromer elements and their assembly are shown. Figure 2ARetromer elements are shown: (1) the 5' end of msr ​​and the reverse transcribed msd are covalently bonded to the initiating guanosine via a 2' to 5' bond, a branched structure that hinders use in genome engineering, (2) invariant flanking regions that may be required for reverse transcription of the retromer and therefore cannot easily become part of the repair template, and (3) the stem is currently believed to be of limited overall length. Another problem for genome engineering is the natural retromer poly T stretch that functions as a terminator for Pol III transcription. Figure 2B It is shown that the non-protein coding (msr-msd) portion of the retromer operon produces a transcript with significant secondary structure, and reverse transcriptase (RT) recognizes a specific start site in the transcript and then reverse transcribes the transcript portion into RT-DNA (msd).

[0035] Figures 3A to 3D . Figure 3A The base structure of wild-type ec86 (also called retrotransposon-Eco1 ncRNA) after reverse transcription is shown, where msd DNA is at the top (SEQ ID NO:1GTCAGAAAAAACGGGTTTCCTGGTTGGCTCGGAGAGCATCAGGCGATGCTCTCCGTTCCAACAAGGAAAACAGACAG TAACTCAGA) and msr RNA is the lower sequence (SEQ ID NO:2-AUGCGCACCCUUAGCGAGAGGUUUAUCAUUAAGGUCAACCUCUGGAUGUUGUUUCGGCAUCCUGCAUUGAAUCUGAGUUACU). Figure 3B Shown is the amount of ssDNA produced following ec86 expression, as detected by qPCR analysis. Figure 3C PAGE analysis of wild-type and variant msd is shown. Figure 3D The base structures of the following two variant msds are shown: retromer-Eco1 v32 ncRNA, which was modified from ec86 wild type (GTCAGAAAAAACGGGTTGTCGCCAGTCTGACTGG CGACAAACAGCTTGTAACTCAGA, SEQ ID NO: 3), and retromer-Eco1 v35 ncRNA, which was modified from v32 ncRNA (GTCAGAAAAAACGGGTGGAGAGGTTGCTGCAACCTCTCCATTTTCTTGTAACTCAGA, SEQ ID NO: 4).

[0036] Figures 4A to 4DThe expression system used to produce extended msd ssDNA is shown. Figure 4A An expression construct is shown that separates msr / msd from the retroviral reverse transcriptase (RT), allowing for the production of longer (modified) reverse transcribed msdssDNA. Figure 4B Shown is the arrangement of msr ​​and msd in an expression cassette separated from the reverse transcriptase coding region (presented in trans). Figure 4C Several stretches of msd ssDNA in the msr / msd expression cassette are shown separated from the reverse transcriptase coding region (presented in trans), indicating that the msd region can be significantly expanded to include heterologous sequences. Figure 4D PAGE analysis of msdssDNA is shown, which includes Figures 4A to 4C The extended MSD ssDNA produced is shown.

[0037] Figure 5 Retromer characteristic parameters that may be modified are shown.

[0038] Figures 6A to 6F . Fig. 6A The customized sequencing preparation route is schematically shown. In the presence of RNase, ssDNA is treated with debranching RNA lariats 1 (DBR1), and then a series of single-type polynucleotides are added using a template-independent polymerase (TdT), a reverse anchor primer containing an adapter is used to generate a complementary strand, a second adapter is ligated, and then this adapter-ligated double-stranded DNA is indexed and multiplexed (SEQ ID NO: 29). Figure 6B It was shown that the number of nucleotides added by TdT is controllable. Figure 6C The ordered msd ssDNAec86 v 32 sequence (GTCAGAAAAAACGGGTTGTCGCCAGTCTGACTGGCGACAAACAGCTTGTAACTCAGA, SEQ ID NO: 5) is shown, illustrating verification by sequencing. Fig.6D The predicted msd ssDNAec86 v32 sequence (GTCGAAAAAACGGGTT GTCGCCAGTCTGACTGGCGACAAACAGCTTGTAACTCAGA, SEQ ID NO: 6) is shown, which illustrates the sequencing result (GTCAGAAAAAACGGGTTGTCGCCAGTCTGACTGGCGACAAACAGCTTGTAACTCAG, SEQ ID NO: 7). Fig. 6EThe literature wild-type msdssDNA ec86 sequence (GTCAGAAAAAA CGGGTTTCCTGGTTGGCTCGGAGAGCATCAGGCGATGCTCTCTCCGTTCCAACAAGGAAAACAGACAGTAACTCAGA, SEQ ID NO: 8) is shown, which illustrates the sequencing result (GTCAGAAAAAACGGGTTTCCTGGTTGGCTCGGAGAGCATCAGGCGATGCTCTCTCCGTTCCAACAAGGAAAACAGACATAACTCAG, SEQ ID NO: 9). Fig. 6F The literature wild-type msd ssDNA ec83 sequence (TTGAAGCCGCGGAACAAACTTTTTGATCCGCAACCTACTGGATTGCGGCTCAAAAAGTTTGTTCCGCAACTGTAAATGTAATC, SEQ ID NO: 10) is shown, which illustrates the sequencing result (AGCCGCGGAACAAACTTTTTGATCCGCAACC TACTGGATTGCGGCTCAAAAAGTTTGTTCCGCAACTGTAAATGTAATC, SEQ ID NO: 11).

[0039] Figures 7A to 7C-2 Modification of msd DNA is shown. Fig. 7A Schematic representation of the association of changes in the retromer RNA with the barcode that will end up in the msd DNA. Figure 7B Shown is the increased production of ssDNA from the retrotransposons with the longer msd-post-complementary region compared to the wild-type retrotransposons without the longer msd-post-region. Figure 7C-1 and 7C-2 Extension and reduction of the 5' and 3' terminal regions of the retroviral noncoding RNA (ncRNA) are shown. Figure 7C-1 The basic retromer structure used is schematically shown, where the extended complementary region in the ncRNA is marked with a solid black line, while the rest of the ncRNA is dashed. Figure 7C-2 The diagram shows that extension of the ncRNA complementary region increases the abundance of RT-DNA relative to the wild-type sequence (where the abundance of the wild-type is 100%), but shortening the ncRNA complementary region decreases the abundance of RT-DNA. The data shown are from pooled experiments for each variant (n=3, replicates shown).

[0040] Figures 8A to 8B The diagram shows that the amount of ssDNA can be reduced by shortening the reverse transcription stem of the ncRNA, but extension of the stem does not negatively affect ssDNA production. Fig. 8AThe modified portion of the ncRNA structure is schematically shown, with the stem region shown as a solid black line and the rest of the ncRNA shown as a dotted line. Figure 8B The graph shows that extension of the ncRNA region by about 15 to 30 nucleotides maintains the abundance of RT-DNA at approximately the same level as observed for the non-extended wild-type ncRNA sequence, whereas when the length of the ncRNA region is reduced to less than about 14 nucleotides, the amount of ssDNA generated by reverse transcription is reduced compared to the non-extended wild-type ncRNA sequence.

[0041] Figures 9A to 9B The effects of fragmenting and fixing the reverse transcription stem region of ncRNA are shown. Fig.9A is a schematic diagram of ncRNA, wherein the reverse transcription stem region of ncRNA is shown as a solid black line. Fig. 9B The diagram shows the abundance of reverse transcribed DNA of ncRNA structural variants relative to the wild-type sequence. The data are from a combined experiment for each variant. The sequences of broken stem, fixed stem and tolerable broken stem ncRNA structural variants are provided in the examples.

[0042] Figures 10A to 10E Shown are the effects of insertions and deletions in the reverse transcribed region of a ncRNA on the abundance of DNA reverse transcribed from the ncRNA. Fig. 10A The ncRNA is schematically shown, wherein the reverse transcribed region of the ncRNA is shown as black dashed and solid lines. The dashed lines identify the region flanking the msd stem. Fig. 10B Graph showing the abundance of RT-DNA generated by reverse transcription of a series of ncRNA variants, each with a 3-base deletion relative to the wild-type sequence at a different position along the msd stem-loop. The position of the deletion is plotted along the x-axis. Fig. 10C Graph showing the abundance of RT-DNA generated by reverse transcription of a series of ncRNA variants, each with a 3-base insertion at a different position along the msd stem-loop relative to the wild-type sequence. The position of the insertion is plotted along the x-axis. Fig. 10D Graph showing the abundance of RT-DNA generated by reverse transcription of a series of ncRNA variants, each with a single base change relative to the wild-type sequence at a different position along the MSD stem-loop. The position of the insertion is plotted along the x-axis. Fig. 10E The diagram shows that Figures 10B to 10D The modifiability scores for the MSD loop positions are based on the structural changes and observed consequences of these changes. The modifiability scores are based on the average impact of these changes, with data from pooled experiments for each variant. A schematic diagram of the stem, loop, and flanking regions of the folded ncRNA is shown in Figures 10B to 10C middle.

[0043] Figures 11A to 11BThe use of modified retrotransposons to improve CRISPR-based genome alterations is shown. Fig.11A Schematic diagram illustrating the integration of retroviral RT-DNA by CRISPR integrases Cas1 and Cas2 to modify the genomic CRISPR array. Fig. 11B The diagram shows that retromer-derived spacer DNA can be enhanced by extending self-complementary regions at the 5' and 3' ends of the ncRNA.

[0044] definition

[0045] The term "about" as used herein in reference to a measurable value such as an amount, length, etc., is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% of a given value.

[0046] "Recombinant" as used herein to describe a nucleic acid molecule refers to a polynucleotide of genomic, cDNA, bacterial, semisynthetic or synthetic origin that, by reason of its origin or manipulation, is not related in whole or in part to polynucleotides with which it is associated in nature.

[0047] The term "recombinant" used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide. Generally, a gene of interest is cloned and then expressed in a transformed organism as further described below. The host organism expresses the foreign gene under expression conditions to produce the protein.

[0048] As used herein, "cell" refers to any type of cell isolated from a prokaryotic, eukaryotic, or archaeal organism (which includes bacteria, archaea, fungi, protists, plants, and animals), including cells from tissues, organs, and biopsies, as well as recombinant cells, cells from cell lines cultured in vitro, and cell fragments, cell components, or organelles containing nucleic acids. The term also encompasses artificial cells, such as nanoparticles, liposomes, polymers, or microcapsules, which encapsulate nucleic acids. For example, the methods described herein can be performed, for example, on a sample comprising a single cell or a population of cells. The term also includes genetically modified cells.

[0049] The term "transformation" refers to the insertion of an exogenous polynucleotide (e.g., an engineered retrovirus) into a host cell, regardless of the method used for insertion. For example, direct uptake, transduction, or f-conjugation are included. The exogenous polynucleotide can be maintained as a non-integrating vector, such as a plasmid, or alternatively can be integrated into the host genome.

[0050] "Recombinant host cell," "host cell," "cell," "cell line," "cell culture," and other such terms referring to microbial or higher eukaryotic cell lines that are cultured as unicellular entities, refer to cells that can or have been used as recipients for recombinant vectors or other transfer DNA, and include the original progeny of the original cell that has been transfected.

[0051] A "coding sequence" or a sequence "encoding" a selected polypeptide is a nucleic acid molecule that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences (or "control elements"). The boundaries of the coding sequence can be determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. The coding sequence can include, but is not limited to, cDNA from viral mRNA, prokaryotic mRNA, or eukaryotic mRNA, genomic DNA sequences from viral DNA or prokaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence can be located 3' to the coding sequence.

[0052] Typical "control elements" include, but are not limited to, transcriptional promoters, transcriptional enhancer elements, transcriptional termination signals, polyadenylation sequences (located 3' to the translation stop codon), sequences for optimizing translation initiation (located 5' to the coding sequence), and translation termination sequences.

[0053] "Operably linked" refers to an arrangement of elements in which the components so described are configured to perform their usual functions. Thus, a given promoter operably linked to a coding sequence is capable of affecting the expression of the coding sequence when appropriate enzymes are present. The promoter need not be contiguous with the coding sequence, as long as it functions to direct its expression. Thus, for example, there may be an intervening untranslated but transcribed sequence between the promoter sequence and the coding sequence, and the promoter sequence may still be considered to be "operably linked" to the coding sequence.

[0054] "Encoded by" refers to a nucleic acid sequence encoding a polypeptide or RNA sequence. For example, a polypeptide sequence or a portion thereof contains an amino acid sequence of at least 3 to 5 amino acids, more preferably at least 8 to 10 amino acids, even more preferably at least 15 to 20 amino acids from a polypeptide encoded by the nucleic acid sequence. An RNA sequence or a portion thereof contains a nucleotide sequence of at least 3 to 5 nucleotides, more preferably at least 8 to 10 nucleotides, even more preferably at least 15 to 20 nucleotides.

[0055] The term "isolated", "purified" or "biologically pure" refers to a substance that is free of components that normally accompany it as present in its natural state to varying degrees. "Isolated" means the degree of separation from the original source or environment. "Purity" means a degree of separation higher than separation. A "purified" or "biologically pure" protein is sufficiently free of other substances so that any impurities do not substantially affect the biological properties of the protein or cause other adverse consequences. In other words, if the nucleic acid or peptide of the present invention is substantially free of cellular material, viral material or culture medium when produced by recombinant DNA technology, or substantially free of chemical precursors or other chemicals when chemically synthesized, the nucleic acid or peptide of the present invention is purified. Purity and homogeneity are generally determined using analytical chemistry techniques, such as polyacrylamide gel electrophoresis or high performance liquid chromatography. The term "purified" can mean that the nucleic acid or protein produces essentially one band in an electrophoretic gel. For proteins that can be modified (e.g., phosphorylated or glycosylated), different modifications can produce different isolated proteins that can be purified separately.

[0056] "Substantially purified" generally refers to the separation of a substance (compound, polynucleotide, protein, polypeptide, peptide composition) such that the substance accounts for the majority percentage of the sample in which it is present. Generally speaking, in a sample, the substantially purified component accounts for 50%, preferably 80% to 85%, and more preferably 90% to 95% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well known in the art and include, for example, ion exchange chromatography, affinity chromatography, and sedimentation based on density.

[0057] "Expression" refers to the production of a gene product detectable by a cell. A gene product can be a transcription product (i.e., RNA), which can be referred to as "gene expression", or a gene product can be a translation product (i.e., protein) of a transcription product, depending on the context. "Purified polynucleotides" refers to a polynucleotide of interest or a fragment thereof that is substantially free of proteins and / or nucleic acids naturally associated with the polynucleotide, e.g., containing less than about 50%, preferably less than about 70%, more preferably less than about at least 90% of proteins and / or nucleic acids naturally associated with the polynucleotide. Techniques for purifying polynucleotides of interest are available in the art and include, for example, destroying cells containing polynucleotides with chaotropic agents, and separating polynucleotides and proteins by ion exchange chromatography, affinity chromatography, and sedimentation according to density.

[0058] The term "transfection" is used to refer to the uptake of foreign DNA by a cell. A cell is "transfected" when foreign DNA is introduced into the cell membrane. Many transfection techniques are generally known in the art. See, for example, Graham et al. (1973) Virology, 52: 456, Sambrook et al. (2001) Molecular Cloning, a laboratory manual, 3rd edition, Cold Spring Harbor Laboratories, New York, Davis et al. (1995) Basic Methods in Molecular Biology, 2nd edition, McGraw-Hill, and Chu et al. (1981) Gene 13: 197. This technique can be used to introduce one or more foreign DNA portions into a suitable host cell. The term refers to the stable and transient uptake of genetic material, as well as uptake of DNA that includes peptide-linked or antibody-linked DNA.

[0059] "Vector" is capable of transferring a nucleic acid sequence to a target cell (e.g., viral vectors, non-viral vectors, microparticle vectors, and liposomes). Generally speaking, "vector construct," "expression vector," and "gene transfer vector" mean any nucleic acid construct capable of directing the expression of a nucleic acid of interest and capable of transferring a nucleic acid sequence to a target cell. Thus, the term includes cloning and expression vehicles, as well as viral vectors.

[0060] As used herein, "mammalian cell" refers to any cell derived from a mammalian subject that is suitable for transfection with an engineered retrotransposons or a vector system comprising an engineered retrotransposons. The cell may be xenogeneic, autologous, or allogeneic. The cell may be a primary cell obtained directly from a mammalian subject. The cell may also be a cell in culture and expansion derived from a cell obtained from a mammalian subject. Immortalized cells are also included in this definition. In some embodiments, the cell has been genetically engineered to express a recombinant protein and / or nucleic acid.

[0061] The term "subject" includes animals, including both vertebrates and invertebrates, including but not limited to invertebrates such as arthropods, mollusks, annelids, and cnidarians; and vertebrates such as amphibians, including frogs, salamanders, and caecilians; reptiles, including lizards, snakes, turtles, crocodiles, and alligators; fish; mammals, including humans and non-human mammals, such as non-human primates, including chimpanzees and other apes and monkeys; laboratory animals, such as mice, rats, rabbits, hamsters, guinea pigs, and chinchillas; domestic animals, such as dogs and cats; farm animals, such as sheep, goats, pigs, horses, and cattle; and birds, such as poultry, wild birds, and game birds, including chickens, turkeys and other quail, ducks, geese, etc. In some cases, the disclosed methods can be used in experimental animals, veterinary applications, and for the development of animal models of disease, including but not limited to rodents, including mice, rats, and hamsters; primates, and transgenic animals.

[0062] "Gene transfer" or "gene delivery" refers to a method or system for reliably inserting a target DNA or RNA into a host cell. This method can result in transient expression of non-integrated transferred DNA, extrachromosomal replication and expression of transfer replicons (e.g., episomes), or integration of the transferred genetic material into the genomic DNA of the host cell. Gene delivery expression vectors include, but are not limited to, vectors derived from viral vectors, non-viral vectors, alphaviruses, poxviruses and vaccinia viruses, and bacterial plasmid vectors.

[0063] The term "derived from" is used herein to identify the original source of a molecule, and is not meant to limit the method by which the molecule is made (eg, it may be by chemical synthesis or recombinant means).

[0064] A polynucleotide "derived from" a specified sequence refers to a polynucleotide sequence that comprises a continuous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10 to 12 nucleotides, and even more preferably at least about 15 to 20 nucleotides corresponding to a region of a specified nucleotide sequence (i.e., having identity or complementarity therewith). The resulting polynucleotide is not necessarily physically derived from the target nucleotide sequence, but can be generated in any manner (including but not limited to chemical synthesis, replication, reverse transcription or transcription, based on the information provided by the base sequence in the region from which the polynucleotide is derived). Therefore, it can represent the sense or antisense orientation of the original polynucleotide.

[0065] "Barcode" refers to one or more nucleotide sequences that are used to identify nucleic acids or cells associated with the barcode. The barcode length can be 3 to 1000 or more nucleotides, preferably 10 to 250 nucleotides in length, and more preferably 10 to 30 nucleotides in length, including any length within these ranges, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 nucleotides in length. For example, a barcode can be used to identify a single cell, a subpopulation of cells, a colony or a sample from which a nucleic acid is derived. Barcodes can also be used to identify the location of cells, colonies, or samples from which nucleic acids are derived (i.e., positional barcodes), such as the location of colonies in a cell array, the location of holes in a multiwell plate, or the location of tubes, flasks, or other containers in a support. For example, barcodes can be used to identify genetically modified cells from which nucleic acids are derived. In some embodiments, barcodes are used to identify specific types of genome editing or specific types of donor nucleic acids.

[0066] The terms "hybridize" and "hybridization" refer to the formation of a complex between nucleotide sequences that are sufficiently complementary to form a complex via Watson-Crick base pairing.

[0067] The term "homologous region" refers to a nucleic acid region homologous to another nucleic acid region. Therefore, it is determined whether a "homologous region" exists in a nucleic acid molecule with reference to another nucleic acid region in the same or different molecule. In addition, since nucleic acid is usually double-stranded, the term "homologous region" used herein refers to the ability of nucleic acid molecules to hybridize with each other. For example, a single-stranded nucleic acid molecule can have two homologous regions that can hybridize with each other. Therefore, the term "homologous region" includes nucleic acid segments with complementary sequences. The length of the homologous region can be different, but generally will be between 4 to 500 nucleotides (for example, about 4 to about 40, about 40 to about 80, about 80 to about 120, about 120 to about 160, about 160 to about 200, about 200 to about 240, about 240 to about 280, about 280 to about 320, about 320 to about 360, about 360 to about 400, about 400 to about 440, etc.).

[0068] As used herein, the term "complementary" or "complementarity" refers to a polynucleotide that can form base pairs with each other. Base pairs are usually formed by hydrogen bonds between nucleotide units oriented in antiparallel between polynucleotide chains. Complementary polynucleotide chains can be base-paired in a Watson-Crick manner (e.g., A and T, A and U, C and G) or in any other manner that allows the formation of a duplex. As known to those skilled in the art, when RNA is used instead of DNA, it is believed that the base complementary to adenosine is uracil (U) instead of thymine (T). However, unless otherwise stated, when uracil is represented in the context of the present invention, the ability to replace thymine is implied. "Complementarity" can exist between two RNA chains, two DNA chains, or between an RNA chain and a DNA chain. It is generally understood that two or more polynucleotides can be "complementary" and can form a duplex, although with incomplete or less than 100% complementarity. Two sequences are "fully complementary" or "100% complementary" if at least one contiguous portion of each polynucleotide sequence (including the region of complementarity) is perfectly base paired with the other polynucleotide without any mismatches or interruptions in such region. Two or more sequences are considered to be "fully complementary" or "100% complementary" even if one or both polynucleotides contain additional non-complementary sequences, as long as the contiguous region of complementarity in each polynucleotide is able to fully hybridize with the other. "Incomplete" complementarity refers to a situation where less than all of the contiguous nucleotides in such a complementary region are able to base pair with each other. Determining the percentage of complementarity between two polynucleotide sequences is a matter for those of ordinary skill in the art.

[0069] The term "Cas9" as used herein encompasses type II clustered regularly interspaced short palindromic repeats (clustered regularly interspaced short palindromic repeat, CRISPR) system Cas9 endonucleases from any species, and also includes biologically active fragments, variants, analogs and derivatives thereof that retain Cas9 endonuclease activity (i.e., catalyzing the site-directed cutting of DNA to generate double-strand breaks). Cas9 endonucleases bind and cut DNA at sites comprising sequences complementary to the guide RNA (gRNA) bound thereto. For the purpose of targeting Cas9, gRNA may include sequences "complementary" to the target sequence (e.g., major or minor alleles), capable of performing sufficient base pairing to form a duplex (i.e., gRNA hybridizes with the target sequence). In addition, gRNA may include a sequence complementary to a PAM sequence, wherein gRNA also hybridizes with a PAM sequence in the target DNA.

[0070] The term "donor polynucleotide" refers to a polynucleotide that provides the intended editing sequence to be integrated into the genome at the target locus by HDR or recombineering.

[0071] A "target site" or "target sequence" is a nucleic acid sequence that is recognized by the homology arms of a guide RNA (gRNA) or a donor polynucleotide (i.e., sufficiently complementary for hybridization). A target site can be allele-specific (e.g., a major or minor allele). For example, a target site can be a genomic site that is intended to be modified, such as by inserting one or more nucleotides, replacing one or more nucleotides, deleting one or more nucleotides, or a combination thereof.

[0072] "Homologous arm" means a part of a donor polynucleotide, which is responsible for targeting the donor polynucleotide to the genomic sequence to be edited in the cell. The donor polynucleotide generally comprises a 5' homology arm hybridized with a 5' genomic target sequence and a 3' homology arm hybridized with a 3' genomic target sequence, and the 5' homology arm and the 3' homology arm are located at the flank of the nucleotide sequence of the target editor of the genomic DNA. Homologous arms are referred to herein as 5' and 3' (i.e., upstream and downstream) homology arms, which relate to the relative position of the nucleotide sequence of the homology arm and the donor polynucleotide containing the target editor. 5' and 3' homology arms hybridize with the region in the target locus in the genomic DNA to be modified, and are referred to herein as "5' target sequence" and "3' target sequence", respectively. For example, the nucleotide sequence comprising the target editor can be integrated into the genomic DNA by HDR or recombineering at the genomic target locus recognized by 5' and 3' homology arms (i.e., fully complementary for hybridization).

[0073] In general, "CRISPR adaptation system" refers to transcripts and other elements that participate in the expression of CRISPR-related ("Cas") genes or guide the activity of CRISPR-related ("Cas") genes, including sequences encoding Cas genes and CRISPR array nucleic acid sequences (which include a leader sequence and at least one repeat sequence). In some embodiments, one or more elements of the CRISPR adaptation system are derived from type I, type II, or type III CRISPR systems. Cas1 and Cas2 are present in all three types of CRISPR-Cas systems, and they are involved in spacer acquisition. In the IE system of Escherichia coli, Cas1 and Cas2 form a complex in which the Cas2 dimer bridges two Cas1 dimers. In this complex, Cas2 plays a non-enzymatic scaffolding role, which binds to double-stranded fragments of invading DNA, while Cas1 binds to the single-stranded flanks of DNA and catalyzes its integration into the CRISPR array.

[0074] In some embodiments, one or more elements of a CRISPR system are derived from a specific organism that contains an endogenous CRISPR system, such as Streptococcus pyogenes. Generally speaking, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the target sequence site (also referred to as a prospacer in the context of an endogenous CRISPR system).

[0075] In some embodiments, the vector comprises a regulatory element operably linked to an enzyme coding sequence encoding a CRISPR enzyme, such as a Cas protein. Non-limiting examples of Cas proteins include

[0076] Cas1,Cas1B,Cas2,Cas3,Cas4,Cas5,Cas6,Cas7,Cas8,Cas9 (also known as Csn1 and Csx12),Cas1O,Csy1,Csy2,Csy3,Cse1,Cse2,Csc1,Csc2,Csa5,Csn2,Csm2,Csm3,Csm4,Csm5,Csm6,Cmr1,Cmr3,Cmr4,Cmr5,Cmr6,Csb1,Csb2,Csb3,Csx17,Csx14,Csx1O,Csx16,CsaX,Csx3,Csx1,Csx15,Csf1,Csf2,Csf3,Csf4,

[0077] Homologs thereof or modified forms thereof.

[0078] In certain embodiments, the present disclosure provides a protospacer adjacent to a short (3 to 5 bp) DNA sequence called a protospacer sequence adjacent to a motif (PAM). PAM is important for type I and type II systems during acquisition. In type I and type II systems, the protospacer is excised at a position adjacent to the PAM sequence, and the other end of the spacer is cut using a ruler mechanism to maintain the regularity of the size of the spacer in the CRISPR array. The conservation of the PAM sequence varies between CRISPR-Cas systems and can be evolutionarily associated with Cas1 and the leader sequence.

[0079] In some embodiments, the present disclosure provides that the defined synthetic DNA produced in the cell is integrated into the CRISPR array in a directed manner, for example by using an engineered reverse transcription subsystem in the cell, the integration preferentially but not exclusively occurs adjacent to the leader sequence. In the IE type system from E. coli, it was demonstrated that the first direct repeat sequence adjacent to the leader sequence was duplicated, and the newly acquired spacer region was inserted between the first and second direct repeat sequences.

[0080] In one embodiment, the pre-spacer is a defined synthetic DNA. In some embodiments, the length of the defined synthetic DNA is at least 3, 5, 10, 20, 30, 40 or 50 nucleotides, or 3 to 50, or 10 to 100, or 20 to 90, or 30 to 80, or 40 to 70, or 50 to 60 nucleotides. In one embodiment, the oligonucleotide sequence or the defined synthetic DNA includes a modified "AAG" pre-spacer sequence adjacent motif (PAM).

[0081] In some embodiments, the regulatory element is operably connected to one or more elements of the CRISPR system to drive the expression of one or more elements of the CRISPR system. Generally speaking, CRISPR (clustered regularly interspaced short palindromic repeats), also known as SPIDR (interspersed direct repeats in the spacer region), constitutes a family of DNA loci that are usually specific to a specific bacterial species. The CRISPR locus contains different types of interspersed short sequence repeats (short sequence repeat, SSR), which are recognized in Escherichia coli (Ishino et al, J. BacterioL, 169: 5429-5433 (1987); and Nakata et al., J. BacterioL, 171: 3553-3556 (1989)), and related genes. Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (see, Groenen et al., Mol. Microbiol., 10:1057-1065 (1993); Hoe et al., Emerg. Infect. Dis., 5:254-263 (1999); Masepohl et al, Biochim. Biophys. Acta 1307:26-30 (1996); and Mojica et al, Mol. Microbiol, 17:85-93 (1995)). CRISPR loci are generally different from other SSRs in the structure of the repeat sequence, which is called short regularly spaced repeat (SRSR) (Janssen et al, OMICS J. Integ. Biol., 6: 23-33 (2002); and Mojica et al, Mol. Microbiol., 36: 244-246 (2000)). Generally speaking, repeats are short elements that appear in clusters that are regularly separated by unique insertion sequences of essentially constant length (Mojica et al., (2000), supra). Although repeat sequences are highly conserved between strains, the number of interspersed repeat and spacer sequences often varies from strain to strain (van Embden et al., J. Bacteriol., 182: 2393-2401 (2000)).CRISPR loci have been identified in more than 40 prokaryotes (see, e.g., Jansen et al, Mol. Microbiol., 43:1565-1575 (2002); and Mojica et al, (2005)), including but not limited to Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacteriumn, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Acidophilus, Picrophilus), Thernioplasnia, Corynebacterium, Mycobacterium, Streptomyces, Aquifrx, Porphvromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myrococcus, Campylobacter, Wolinella, Acinetobacter The bacteria are classified as follows: Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthomonas, Yersinia, Treponema, and Thermotoga.

[0082] In some embodiments, the enzyme coding sequence encoding the CRISPR enzyme is codon optimized for expression in a specific cell, such as a eukaryotic cell. Eukaryotic cells can be those of a specific organism or derived from the specific organism, such as a mammal, including but not limited to humans, mice, rats, rabbits, dogs, or non-human primates. Generally speaking, codon optimization refers to the process of modifying a nucleic acid sequence for enhanced expression in a target host cell, wherein the modification is performed by replacing at least one codon (e.g., about one or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) of a native sequence with a codon that is more frequently or most frequently used in the genes of the host cell, while maintaining the native amino acid sequence. Various species show specific preferences for certain codons of specific amino acids. Codon bias (differences in codon usage between organisms) is generally related to the translation efficiency of messenger RNA (mRNA), which in turn is believed to depend on the properties of the codons being translated and the availability of specific transfer RNA (tRNA) molecules, etc. The advantage of the selected tRNA in the cell generally reflects the most commonly used codons in peptide synthesis. Therefore, genes can be customized based on codon optimization to achieve optimal gene expression in a given organism. Codon usage tables are readily available, for example, in the "Codon Usage Database", and these tables can be adapted in a variety of ways. See Nakamura, Y., et al. "Codon usage tabulated from the international DNA sequence databases: status for the year 2000" Nucl. Acids Res. 28: 292 (2000). Computer algorithms for codon optimization of specific sequences for expression in specific host cells are also available, such as Gene Forge (Aptagen; Jacobus, Pa.). In some embodiments, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more, or all codons) in the sequence encoding the CRISPR enzyme correspond to the most frequently used codons for a specific amino acid.

[0083] "Administering" a nucleic acid (e.g., an engineered retrotransposon construct or a vector comprising an engineered retrotransposon construct) to a cell includes transduction, transfection, electroporation, translocation, fusion, phagocytosis, shooting or ballistic methods, and the like, i.e., any means by which a nucleic acid can be transported across a cell membrane.

[0084] Before further describing the present disclosure, it should be understood that the disclosed subject matter is not limited to the specific embodiments described, as such may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims.

[0085] When a range of values ​​is provided, it is understood that every intervening value, to the tenth of the unit of the lower limit, between the upper and lower limits of that range, and any other stated or intervening values ​​in that stated range, is encompassed within the disclosed subject matter unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosed subject matter, subject to any expressly excluded limits in the stated ranges. When the stated range includes one or both limits, ranges excluding either or both of those included limits are also encompassed within the disclosed subject matter.

[0086] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the disclosed subject matter belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the disclosed subject matter, preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials associated with the cited publications.

[0087] It must be noted that, as used herein and in the appended claims, nouns not modified with quantifiers include one / kind or more / kinds unless the context clearly indicates otherwise. Thus, for example, reference to "cell" includes a plurality of such cells, reference to "nucleic acid" includes reference to one or more nucleic acids and their equivalents known to those skilled in the art, and so on. It should also be noted that the claims may be written to exclude any optional elements. Therefore, this statement is intended to serve as an antecedent basis for the use of such exclusive terms such as "only", "only" and any feature or element described herein (which includes the use of "negative" limitations) in relation to reference.

[0088] It should be understood that, for clarity, certain features of the disclosed subject matter described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for brevity, various features of the disclosed subject matter described in the context of a single embodiment may also be provided individually or in any suitable subcombination. All combinations of embodiments related to the present disclosure are specifically included in the disclosed subject matter and disclosed herein, as if each and every combination were individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically included in the present disclosure and disclosed herein, as if each and every such subcombination were individually and explicitly disclosed herein.

[0089] The publications discussed herein are provided only for their disclosures prior to the filing date of the present application. Anything herein shall not be construed as admitting that the disclosed subject matter has no right to precede such publications. In addition, the publication date provided may be different from the actual publication date, which may require independent confirmation. DETAILED DESCRIPTION

[0090] Provided are engineered retrotransposons modified to enhance the production of multicopy single-stranded DNA (msDNA). In addition, also provided are vector systems encoding such engineered retrotransposons and methods of using engineered retrotransposons and vector systems encoding them in multiple applications such as CRISPR / Cas mediated genome editing, recombineering, cell barcoding, and molecular recording.

[0091] Engineered reverse transcriptase

[0092] The present disclosure provides an engineered retrotransposon that is modified to enhance the production of msDNA in a cell. The engineered retrotransposon comprises an msr pre-sequence, an msr gene encoding multiple copies of single-stranded RNA (msRNA); an msd gene encoding multiple copies of single-stranded DNA (msDNA); an msd post-sequence and a ret gene encoding a reverse transcriptase. Synthesizing DNA by the reverse transcriptase result encoded by the retrotransposon can provide a DNA / RNA chimeric product consisting of a single-stranded DNA encoded by the msd gene and a single-stranded RNA encoded by the msr gene. The retrotransposon msr RNA contains a conserved guanosine residue at the end of the stem-loop structure. The chain of the msr RNA is connected to the 5' end of the msd single-stranded DNA through a 2'-5' phosphodiester bond at the 2' position of the conserved guanosine residue.

[0093] In engineered retrotransposons, for example, the msd rear sequence is modified in its self-complementary region (it has sequence complementarity with the msr front sequence), wherein the length of the self-complementary region is lengthened relative to the corresponding region of the native retrotransposons. This modification results in an engineered retrotransposons that provide enhanced msDNA production. In certain embodiments, the length of the complementary region is at least 1, at least 2, at least 4, at least 6, at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, at least 30, at least 40 or at least 50 nucleotides longer than the wild-type self-complementary region. For example, the self-complementary region can have a length of 1 to 50 nucleotides longer than natural or wild-type complementary regions, including any length within the scope, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. In certain embodiments, the length of the self-complementary region is 1 to 16 nucleotides longer than the wild-type complementary region. The single-stranded DNA generated by the engineered reverse transcriptase can be used for a variety of applications.

[0094] For example, to create more abundant ssDNA, the ncRNA SEQ ID NO: 12 sequence shown below can be extended at positions 1 and 169, with the natural self-complementary 3' and 5' ends highlighted in bold (at positions 1 to 12 and 158 to 169).

[0095]

[0096] For example, as shown below, for the following engineered "extended ncRNA" (SEQ ID NO: 13), the additional nucleotides that extend the self-complementary region are shown in italics and underlined.

[0097]

[0098] In some cases, additional nucleotides may be added to any position in the self-complementary region, for example, anywhere within positions 1 to 12 and 158 to 169 of the SEQ ID NO:12 sequence.

[0099] In certain embodiments, the sequences of the msr gene, msd gene, and ret gene used in the engineered retromer can be derived from a bacterial retromer operon. Representative retrotransposons are available, such as retrotransposons from Gram-negative bacteria, including, but not limited to, myxobacterial retrotransposons, such as Myxococcus xanthus retrotransposons (e.g., Mx65, Mx162) and Stigmatella aurantiaca retrotransposons (e.g., Sa163); Escherichia coli retrotransposons (e.g., Ec48, E67, Ec73, Ec78, EC83, EC86, EC107, and Ec107); Salmonella enterica; Vibrio cholerae retrotransposons (e.g., Vc81, Vc95, Vc137); Vibrio parahaemolyticus (e.g., Vc96); and Nannocystis exedens retrotransposons (e.g., Ne144). Reverse transcriptor msr gene, msd gene and ret gene nucleotide sequence and reverse transcriptor reverse transcriptase protein sequence can be derived from any source.Representative reverse transcriptase sequence, it includes msr gene, msd gene, ret gene nucleotide sequence and reverse transcriptase protein sequence are all listed in the National Center for Biotechnology Information (National Center for Biotechnology Information, NCBI) database.For example, referring to NCBI entry: accession number EF428983, M55249, EU250030, X60206, X62583, AB299445, AB436696, AB436695, M86352, M30609, M24392, AF427793, AQ3354 and AB079134; All these sequences (as entered as of the date of submission of this application) are incorporated herein by reference in their entirety.Any of these reverse transcriptase sequences or variants thereof comprising sequences may include variant nucleotides, interpolated nucleotides or fewer nucleotides. For example, the retromer can have at least about 80% to 100% sequence identity thereto, including any percentage identity within that range, such as 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any retromer sequence described herein, including those defined by accession numbers, and can be used to construct an engineered retromer or a vector system comprising an engineered retromer, as described herein.

[0100] In some embodiments, the recombinant reverse transcriptase construct has a non-natural configuration with non-natural intervals between msr gene, msd gene and ret gene. The msr gene and msd gene can be separated in a trans arrangement, rather than provided in an endogenous cis arrangement. In addition, the ret gene can be provided in a trans arrangement relative to the msr gene or msd gene. In some embodiments, the ret gene is provided in a trans arrangement to eliminate the hidden termination signal for reverse transcriptase, which allows longer single-stranded DNA to be generated from the engineered reverse transcriptase construct.

[0101] In some embodiments, the retromer construct is modified to include a heterologous sequence of interest relative to a natural retromer. In this context, the retromer can be engineered with a heterologous sequence for a variety of applications. For example, a heterologous sequence can be added to the retromer construct to provide to the cell: the nucleic acid encoding the target protein or regulatory RNA, suitable for use in gene editing (e.g., by homology directed repair (homology directed repair, HDR) or recombinant mediated genetic engineering (recombination engineering)) donor polynucleotides, or for the CRISPR pre-spacer DNA sequence of molecular recording, as further discussed below. Such a heterologous sequence can be inserted into, for example, msr genes or msd genes, so that the heterologous sequence is transcribed as a part of msDNA product by the retromer reverse transcriptase.

[0102] In some cases, the heterologous sequence of interest can be inserted into the loop of the msd stem-loop.

[0103] For example, engineered retrotransposons can include unique barcodes to facilitate multiplexing. A barcode can include one or more nucleotide sequences that can be used to identify a nucleic acid or cell associated with the barcode. Such a barcode can be inserted into a loop region of, for example, a msd-encoded DNA. The barcode length can be 3 to 1000 or more nucleotides, preferably 10 to 250 nucleotides, more preferably 10 to 30 nucleotides, including any length within these ranges, such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 nucleotides. In some embodiments, the barcode can also be used to identify the location of the cell, colony or sample from which the retrotransposon originated (i.e., position barcode), such as the location of the colony in a cell array, the location of the hole in a multiwell plate, the location of the test tube in a support, or the location of the sample in a laboratory. In particular, barcodes can be used to identify the location of genetically modified cells containing retromers. The use of barcodes allows retromers from different cells to be pooled for sequencing in a single reaction mixture while still being able to trace a specific retromer back to its colony of origin.

[0104] In addition, adapter sequences can be added to the reverse transcriptase construct to promote high-throughput amplification or sequencing. For example, adapter sequences can be added to the 5' and 3' ends of the reverse transcriptase construct to allow amplification or sequencing of multiple reverse transcriptase constructs by the same group of primers simultaneously. For example, the amplification of the reverse transcriptase construct can be carried out before cell transfection or being connected to a carrier. Any method for amplifying the reverse transcriptase construct can be used, including but not limited to polymerase chain reaction (polymerase chain reaction, PCR), isothermal amplification, amplification based on nucleic acid sequence (nucleic acidsequence-based amplification, NASBA), transcription-mediated amplification (transcription mediated amplification, TMA), strand displacement amplification (strand displacement amplification, SDA) and ligase chain reaction (ligase chain reaction, LCR). In one embodiment, the reverse transcriptase construct comprises common 5' and 3' initiation sites, to allow amplification of the reverse transcriptase sequence in parallel with a group of universal primers. In another embodiment, a group of selective primers can be used for selectively amplifying the subset of the reverse transcriptase sequence from the mixture merged.

[0105] Delivery of engineered retrotransposons to cells is usually completed with or without the use of a vector. Engineered retrotransposons (or vectors containing them) can be introduced into any type of cell, including any cell from prokaryotes, eukaryotes or archaebacterial organisms (including bacteria, archaea, fungi, protists, plants (e.g., monocots and dicots); and animals (e.g., vertebrates and invertebrates)). Examples of animals that can be transfected with engineered retrotransposons include, but are not limited to, vertebrates such as fish, birds, mammals (e.g., humans and non-human primates, farm animals, pets and laboratory animals), reptiles and amphibians. Examples of plants that can be transfected with engineered retrotransposons include, but are not limited to, crops, including cereals such as wheat, oats and rice, beans such as soybeans and peas, corn, grasses such as alfalfa, and cotton. Engineered retrotransposons can be introduced into a single cell or a cell group of interest. Cells from tissues, organs and biopsies, as well as recombinant cells, genetically modified cells, cells from in vitro cultured cell lines and artificial cells (e.g., nanoparticles, liposomes, polymers or microcapsules that encapsulate nucleic acids) can all be transfected with engineered retrotransposons. The method is also applicable to cell fragments, cell components or organelles (e.g., mitochondria in animal and plant cells, plastids (e.g., chloroplasts) in plant cells and algae). Cells can be cultured or amplified after transfection with engineered retrotransposons constructs.

[0106] Methods for introducing nucleic acids into host cells are well known in the art. Commonly used methods include chemically induced transformation (usually using divalent cations (e.g., CaCl2)), dextran-mediated transfection, polybrene-mediated transfection, liposome- and LT-1-mediated transfection, electroporation, protoplast fusion, encapsulation of nucleic acids in liposomes, and direct microinjection of nucleic acids containing engineered retrotransposons into the nucleus. See, for example, Sambrook et al. (2001) Molecular Cloning, a laboratory manual, 3 rd edition, Cold Spring Harbor Laboratories, New York, Davis et al. (1995) Basic Methods in Molecular Biology, 2 nd edition, McGraw-Hill, and Chu et al. (1981) Gene 13:197; incorporated herein by reference in their entireties.

[0107] Vector system containing engineered retrotransposons

[0108] In certain embodiments, the retrotranscript msr gene, msd gene and ret gene are expressed in the cell by a vector. "Carrier" is a material structure that can be used to deliver the target nucleic acid to the inside of the cell. Retrotranscript msr gene, msd gene and ret gene can be introduced into the cell with a single vector or with multiple separate vectors to produce msDNA in the host object. The carrier generally includes a control element operably connected to the retrotranscript sequence, which allows the production of msDNA in vivo in the target species. For example, the retrotranscript msr gene, msd gene and ret gene can be operably connected to a promoter to allow the expression of the retrotranscript reverse transcriptase and msDNA product. In some embodiments, the heterologous sequence encoding the desired product of interest (for example, a polynucleotide encoding a polypeptide or a regulatory RNA, a donor polynucleotide for gene editing or a pre-spacer DNA for molecular recording) can be inserted into the msr gene or msd gene. Any eukaryotic cell, archaeal cell or prokaryotic cell that can be transfected with a vector comprising an engineered retrotranscript sequence can be used to produce msDNA. The ability of a construct to produce msDNA as well as other retrovirus-encoded products can be determined empirically.

[0109] In some embodiments, the engineered retrotransposons are produced by a vector system comprising one or more vectors. In the vector system, the msr gene, the msd gene and the ret gene can be provided by the same vector (i.e., the cis arrangement of all such retrotransposons), wherein the vector comprises a promoter operably connected to the msr gene and the msd gene. In some embodiments, the promoter is also operably connected to the ret gene. In other embodiments, the vector also comprises a second promoter operably connected to the ret gene. Alternatively, the ret gene can be provided by a second vector that does not include the msr gene and the msd gene (i.e., the trans arrangement of msr-msd and ret). In other embodiments, the msr gene, the msd gene and the ret gene are each provided by different vectors (i.e., the trans arrangement of all retrotransposons). Many vectors are available, including but not limited to linear polynucleotides, polynucleotides associated with ions or amphiphilic compounds, plasmids and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. Examples of viral vectors include but are not limited to adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, etc. The expression construct can be replicated in living cells, and it can also be prepared synthetically. For the purpose of this application, the terms "expression construct", "expression vector" and "vector" are used interchangeably to indicate the application of the present invention in a general, illustrative sense, and are not intended to limit the present invention.

[0110] In certain embodiments, the nucleic acid comprising the engineered reverse transcriptase sequence is under the transcriptional control of a promoter." promoter " refers to a DNA sequence identified by the synthetic mechanism of the cell or the synthetic mechanism introduced, which is required for the specific transcription of the promoter gene. The term promoter will be used here to refer to a group of transcription control modules gathered around the start site of RNA polymerase I, II or III. Typical promoters for mammalian cell expression include SV40 early promoter, CMV promoter such as CMV early promoter (see U.S. Patent No. 5,168,062 and 5,385,839, incorporated herein by reference in their entirety), mouse mammary tumor virus LTR promoter, adenovirus major late promoter (adenovirus major late promoter, AdMLP) and herpes simplex virus promoter, etc. Other non-viral promoters, such as promoters derived from mouse metallothionein genes, can also be used for mammalian expression. These and other promoters can be obtained from commercially available plasmids using technology known in the art. See, for example, Sambrook et al., the same. Enhancer elements can be used in conjunction with promoters to increase the expression level of a construct. Examples include: the SV40 early gene enhancer, as described in Dijkema et al., EMBO J. (1985) 4 :761, the enhancer / promoter derived from the long terminalrepeat(LTR) of the Rous Sarcoma Virus, as described in Gorman et al., Proc.Natl.Acad.Sci.USA (1982b) 79 :6777, and elements derived from human cytomegalovirus, such as Boshart et al., Cell (1985) 41 :521, for example, an element contained in the CMV intron A sequence.

[0111] In one embodiment, the expression vector for expressing an engineered retrotransposon comprising an msr gene, an msd gene, and a ret gene comprises a promoter "operably linked" to a polynucleotide encoding an msr gene, an msd gene, and a ret gene. As used herein, the phrase "operably linked" or "under transcriptional control" means that the promoter is in the correct position and orientation relative to the polynucleotide to control transcription initiation by RNA polymerase and expression of the msr gene, the msd gene, and the ret gene.

[0112] Generally speaking, a transcription terminator / polyadenylation signal will also be present in the expression construct. Examples of such sequences include, but are not limited to, sequences derived from SV40, such as Sambrook et al., as described above, and bovine growth hormone terminator sequences (see, e.g., U.S. Patent No. 5,122,458). In addition, a 5'-UTR sequence can be placed adjacent to the coding sequence to enhance its expression. Such sequences can include a UTR comprising an internal ribosome entry site (IRES).

[0113] Inclusion of an IRES allows translation of one or more open reading frames from the vector. The IRES element attracts the eukaryotic ribosomal translation initiation complex and promotes translation initiation. See, e.g., Kaufman et al., Nuc. Acids Res. (1991) 19 :4485-4490; Gurtu et al., Biochem. Biophys. Res. Comm. (1996) 229 :295-298; Rees et al., BioTechniques (1996) 20 :102-110; Kobayashi et al., BioTechniques (1996) 21 :399-402; and Mosser et al., BioTechniques (1997 22 150-161. Many IRES sequences are known and include sequences derived from a wide variety of viruses, such as the leader sequence from the UTR of picornaviruses such as encephalomyocarditis virus (EMCV) (Jang et al. J. Virol. (1989) 63 :1651-1660), polio virus leader sequence, hepatitis A virus leader sequence, hepatitis C virus IRES, human rhinovirus type 2 IRES (Dobrikova et al., Proc. Natl. Acad. Sci. (2003) 100 (25): 15125-15130), IRES element from foot-and-mouth disease virus (Ramesh et al., Nucl. Acid Res. (1996) 24 :2697-2700), Giardia virus IRES (Garlapati et al., J.Biol.Chem. (2004) 279(5): 3389-3397), etc. Various non-viral IRES sequences will also be used herein, including but not limited to IRES sequences from yeast, and human angiotensin II type 1 receptor IRES (Martin et al., Mol. Cell Endocrinol. (2003) 212: 51-61), fibroblast growth factor IRES (FGF-1 IRES and FGF-2 IRES, Martineau et al. (2004) Mol. Cell. Biol. 24 (17): 7622-7635), vascular endothelial growth factor IRES (Baranick et al. (2008) Proc. Natl. Acad. Sci. USA 105 (12): 4733-4738, Stein et al. (1998) Mol. Cell. Biol. 18 (6): 3112-3119, Bert et al. (2004) Mol. Cell. Biol. 19 (6): 3112-3119, al. (2006) RNA 12 (6): 1074-1083), and insulin-like growth factor 2 IRES (Pedersen et al. (2002) Biochem. J. 363 (Pt 1): 37-44). These elements are readily commercially available in plasmids sold, for example, by Clontech (Mountain View, CA), Invivogen (San Diego, CA), Addgene (Cambridge, MA), and GeneCopoeia (Rockville, MD). See also IRESite: A database of experimentally validated IRES structures (iresite.org). IRES sequences can be included in vectors, for example, to express multiple phage recombination proteins for recombineering or RNA-guided nucleases (e.g., Cas9) for HDR in combination with a reverse transcriptase from an expression cassette.

[0114] Alternatively, polynucleotides encoding viral T2A peptides can be used to allow multiple protein products (e.g., Cas9, phage recombinant proteins, retroviral reverse transcriptase) to be produced from a single vector. One or more 2A linker peptides can be inserted between the coding sequences of the polycistronic construct. Self-cleaving 2A peptides allow co-expressed proteins from polycistronic constructs to be produced at equimolar levels. 2A peptides from a variety of viruses can be used, including but not limited to 2A peptides derived from foot-and-mouth disease virus, equine rhinitis A virus, Thesa asigna virus, and porcine Teschovirus-1. See, e.g., Kim et al. (2011) PLoS One 6 (4): e18556, Trichas et al. (2008) BMC Biol. 6: 40, Provost et al. (2007) Genesis 45 (10): 625-629, Furler et al. (2001) Gene Ther. 8 (11): 864-873; the entirety of which is incorporated herein by reference.

[0115] In certain embodiments, the expression construct includes a plasmid suitable for transforming a bacterial host. Many bacterial expression vectors are known to those skilled in the art, and the selection of suitable vectors is a matter of choice. Bacterial expression vectors include, but are not limited to, pACYC177, pASK75, pBAD, pBADM, pBAT, pCal, pET, pETM, pGAT, pGEX, pHAT, pKK223, pMal, pProEx, pQE, and pZA31. Bacterial plasmids may include antibiotic selection markers (e.g., ampicillin, kanamycin, erythromycin, carbenicillin, streptomycin or tetracycline resistance), lacZ genes (β-galactosidase produces blue pigment from x-gal substrate), fluorescent markers (e.g., GFP.mCherry) or other markers for selecting transformed bacteria. See, e.g., Sambrook et al., supra.

[0116] In other embodiments, expression constructs include plasmids suitable for transforming yeast cells. Yeast expression plasmids typically contain yeast-specific origins of replication (origin of replication, ORI) and nutritional selection markers (e.g., HIS3, URA3, LYS2, LEU2, TRP1, MET15, ura4+, leu1+, ade6+), antibiotic selection markers (e.g., kanamycin resistance), fluorescent markers (e.g., mCherry) or other markers for selecting transformed yeast cells. Yeast plasmids may also include components that allow shuttling between bacterial hosts (e.g., Escherichia coli) and yeast cells. Many different types of yeast plasmids are available, including: yeast integrating plasmids (YIp), which lack an ORI and integrate into the host chromosome by homologous recombination; yeast replicating plasmids (YRp), which contain an autonomously replicating sequence (ARS) and can replicate independently; yeast centromere plasmids (YCp), which are low copy vectors containing part of the ARS and part of the centromere sequence (CEN); and yeast episomal plasmids (YEp), which are high copy number plasmids that contain fragments from a 2 micron circle (a native yeast plasmid) (allowing for stable propagation of 50 or more copies per cell).

[0117] In other embodiments, the expression construct comprises a virus or an engineered construct derived from a viral genome. Many virus-based systems have been developed for gene transfer into mammalian cells. These include adenovirus, retrovirus (γ-retrovirus and lentivirus), poxvirus, adeno-associated virus, baculovirus and herpes simplex virus (see, e.g., Warnock et al. (2011) Methods Mol. Biol. 737: 1-25; Walther et al. (2000) Drugs 60 (2): 249-271; and Lundstrom (2003) Trends Biotechnol. 21 (3): 117-122; which are incorporated herein by reference in their entirety). The ability of certain viruses to enter cells through receptor-mediated endocytosis, integrate into the host cell genome and stably and effectively express viral genes makes them attractive candidates for transferring foreign genes into mammalian cells.

[0118] For example, retroviruses provide a convenient platform for gene delivery systems. Selected sequences can be inserted into vectors and packaged into retroviral particles using techniques known in the art. The recombinant virus can then be isolated in vivo or in vitro and delivered to the cells of the subject. Many retroviral systems have been described (U.S. Pat. No. 5,219,740; Miller and Rosman (1989) BioTechniques 7:980-990; Miller, AD (1990) Human Gene Therapy 1:5-14; Scarpa et al. (1991) Virology 180:849-852; Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-8037; Boris-Lawrie and Temin (1993) Cur. Opin. Genet. Develop. 3:102-109; and Ferry et al. (2011) Curr. Pharm. Des. 17(24):2516-2527). Lentiviruses are a type of retrovirus that is particularly useful for delivering polynucleotides to mammalian cells because they are able to infect both dividing and non-dividing cells (see, e.g., Lois et al (2002) Science 295:868-872; Durand et al. (2011) Viruses 3(2):132-159; incorporated herein by reference).

[0119] Many adenoviral vectors have also been described. Unlike retroviruses that integrate into the host genome, adenoviruses persist extrachromosomally, thus minimizing the risk associated with insertional mutagenesis (Haj-Ahmad and Graham, J. Virol. (1986) 57:267-274; Bett et al., J. Virol. (1993) 67:5911-5921; Mittereder et al., Human Gene Therapy (1994) 5:717-729; Seth et al., J. Virol. (1994) 68:933-940; Barr et al., Gene Therapy (1994) 1:51-58; Berkner, KL BioTechniques (1988) 6:616-629; and Rich et al., Human Gene Therapy (1993) 4:461-476). In addition, a variety of adeno-associated virus (AAV) vector systems have been developed for gene delivery. AAV vectors can be easily constructed using techniques well known in the art. See, e.g., U.S. Pat. Nos. 5,173,414 and 5,139,941; International Publication Nos. WO 92 / 01070 (published Jan. 23, 1992) and WO 93 / 03769 (published Mar. 4, 1993); Lebkowski et al., Molec. Cell. Biol. (1988) 8:3988-3996; Vincent et al., Vaccines 90 (1990) (Cold Spring Harbor Laboratory Press); Carter, BJ Current Opinion in Biotechnology (1992) 3:533-539; Muzyczka, N. Current Topics in Microbiol. and Immunol. (1992) 158:97-129; Kotin, RM Human Gene Therapy (1994) 5:793-801; Shelling and Smith, Gene Therapy (1994) 1: 165-169; and Zhou et al., J. Exp. Med. (1994) 179: 1867-1875.

[0120] Another vector system that can be used to deliver nucleic acids encoding engineered retroviruses is the enterally administered recombinant poxvirus vaccine described by Small, Jr., PA et al. (US Pat. No. 5,676,950, issued Oct. 14, 1997, which is incorporated herein by reference).

[0121] Additional viral vectors that can be used to deliver the nucleic acid molecule of interest include those derived from the poxvirus family, including vaccinia virus and fowlpox virus. For example, a vaccinia virus recombinant expressing a nucleic acid molecule of interest (e.g., an engineered retrovirus) can be constructed as follows. First, DNA encoding a specific nucleic acid sequence is inserted into an appropriate vector so that it is adjacent to a vaccinia promoter and is flanked by a vaccinia DNA sequence (e.g., a sequence encoding thymidine kinase (TK)). The vector is then used to transfect cells simultaneously infected with vaccinia. Homologous recombination is used to insert the vaccinia promoter plus the gene encoding the sequence of interest into the viral genome. The resulting TK-recombinants can be selected by culturing the cells in the presence of 5-bromodeoxyuridine and selecting for plaques resistant to it.

[0122] Alternatively, avian pox viruses, such as fowlpox and canarypox viruses, can also be used to deliver nucleic acid molecules of interest. The use of avian pox vectors is particularly desirable in humans and other mammalian species because members of the genus Avipox can only replicate productively in susceptible avian species and are therefore not infective in mammalian cells. Methods for producing recombinant avian pox viruses are known in the art and employ genetic recombination, as described above for the production of vaccinia viruses. See, for example, WO91 / 12882; WO89 / 03429; and WO92 / 03545.

[0123] Molecular conjugate vectors, such as the adenovirus chimeric vectors described in Michael et al., J. Biol. Chem. (1993) 268:6866-6869 and Wagner et al., Proc. Natl. Acad. Sci. USA (1992) 89:6099-6103, can also be used for gene delivery.

[0124] Members of the genus Alphavirus, such as but not limited to vectors derived from Sindbis virus (SIN), Semliki Forest virus (SFV) and Venezuelan equine encephalitis virus (VEE), can also be used as viral vectors to deliver the polynucleotides of the present invention. For a description of vectors derived from Sindbis virus that can be used to practice the present method, see Dubensky et al. (1996) J. Virol. 70: 508-519; and International Publication Nos. WO95 / 07995, WO96 / 17072; and Dubensky, Jr., TW et al., issued December 1, 1998, U.S. Pat. No. 5,843,723 and Dubensky, Jr., TW, issued August 4, 1998, U.S. Pat. No. 5,789,245, both of which are incorporated herein by reference. Particularly preferred are chimeric alphavirus vectors composed of sequences derived from Sindbis virus and Venezuelan equine encephalitis virus. See, e.g., Perri et al. (2003) J. Virol. 77: 10394-10403 and International Publication Nos. WO02 / 099035, WO02 / 080982, WO01 / 81609 and WO00 / 61772; which are incorporated herein by reference in their entirety.

[0125] The vaccinia-based infection / transfection system can be conveniently used to provide inducible, transient expression of a target nucleic acid (e.g., an engineered retrovirus) in a host cell. In this system, cells are first infected in vitro with a vaccinia virus recombinant encoding bacteriophage T7 RNA polymerase. This polymerase exhibits strong specificity because it only transcribes templates with a T7 promoter. After infection, the cells are transfected with the target nucleic acid, driven by the T7 promoter. The polymerase expressed in the cytoplasm from the vaccinia virus recombinant transcribes the transfected DNA into RNA. This method provides high-level, transient, cytoplasmic production of large amounts of RNA. See, for example, Elroy-Stein and Moss, Proc. Natl. Acad. Sci. USA (1990) 87: 6743-6747; Fuerst et al., Proc. Natl. Acad. Sci. USA (1986) 83: 8122-8126.

[0126] As an alternative method for infecting with vaccinia virus or fowlpox virus recombinant or using other viral vectors to deliver nucleic acid, an amplification system can be used, which will cause high-level expression after being introduced into the host cell. Specifically, the T7 RNA polymerase promoter located before the T7 RNA polymerase coding region can be engineered. The translation of the RNA derived from the template will produce T7 RNA polymerase, which in turn will transcribe more templates. At the same time, there will be a cDNA whose expression is controlled by the T7 promoter. Therefore, some of the T7 RNA polymerase generated by the translation of the amplification template RNA will cause the transcription of the desired gene. Because some T7 RNA polymerases are needed to start amplification, T7 RNA polymerase can be introduced into the cell together with the template to trigger a transcription reaction. Polymerase can be introduced as a protein or on a plasmid encoding RNA polymerase. For further discussion of the T7 system and its use for transforming cells, see, e.g., International Publication No. WO 94 / 26911; Studier and Moffatt, J. Mol. Biol. (1986) 189: 113-130; Deng and Wolff, Gene (1994) 143: 245-249; Gao et al., Biochem. Biophys. Res. Commun. (1994) 200: 1201-1206; Gao and Huang, Nuc. Acids Res. (1993) 21: 2867-2872; Chen et al., Nuc. Acids Res. (1994) 22: 2114-2120; and U.S. Pat. No. 5,135,855.

[0127] Insect cell expression systems, such as baculovirus systems, may also be used and are known to those skilled in the art and are described, for example, in Baculovirus and Insect Cell Expression Protocols (Methods in Molecular Biology, DW Murhammer ed., Humana Press, 2 nd Edition, 2007) and L. King The Baculovirus Expression System: A laboratory guide (Springer, 1992). Materials and methods for baculovirus / insect cell expression systems are commercially available in kit form from interalia, Thermo Fisher Scientific (Waltham, MA) and Clontech (Mountain View, CA).

[0128] Plant expression systems can also be used to transform plant cells. Typically, such systems use virus-based vectors to transfect plant cells with heterologous genes. For a description of such systems, see, for example, Porta et al., Mol. Biotech. (1996) 5 :209-221; and Hackland et al., Arch. Virol. (1994) 139 :1-22.

[0129] In order to achieve expression of the engineered retrotransposons construct, the expression construct must be delivered to the cell. This delivery can be accomplished in vitro, such as in laboratory procedures to transform cell lines, or in vivo or ex vivo, such as in the treatment of certain disease states. One mechanism for delivery is through viral infection, in which case the expression construct is encapsulated in infectious viral particles.

[0130] Several non-viral methods for transferring expression constructs into cultured cells are also contemplated. These include the use of calcium phosphate precipitation, DEAE-dextran, electroporation, direct microinjection, DNA-loaded liposomes, lipofectamine-DNA complexes, cell sonication, gene bombardment using high-speed microprojectiles, and receptor-mediated transfection (see, e.g., Graham and Van Der Eb (1973) Virology 52:456-467; Chen and Okayama (1987) Mol. Cell Biol. 7:2745-2752; Rippe et al. (1990) Mol. Cell Biol. 10:689-695; Gopal (1985) Mol. Cell Biol. 5:1188-1190; Tur-Kaspa et al. (1986) Mol. Cell. Biol. 6:716-718; Potter et al. (1993) Mol. Cell Biol. 7:1190; Tur-Kaspa et al. (1986) Mol. Cell. Biol. 6:716-718; Potter et al. (1994) Mol. Cell Biol. 8:121-123; Potter et al. (1995) Mol. Cell Biol. 9:123-124; Potter et al. (1996) Mol. Cell Biol. 10:124-125; Potter et al. (1997) Mol. Cell Biol. 11:125-126; Potter et al. (1998) Mol. Cell Biol. 11:126-127; Potter et al. (1999) Mol. Cell Biol. 11:127-128; Potter et al. (1999) Mol. Cell Biol. 11:128-129; Potter et al. (1999) Mol. al. (1984) Proc. Natl. Acad. Sci. USA 81: 7161-7165); Harland and Weintraub (1985) J. Cell Biol. 101: 1094-1099); Nicolau & Sene (1982) Biochim. Biophys. Acta 721: 185-190; Fraleyet al. (1979) Proc.Natl.Acad.Sci.USA76:3348-3352; Fechheimer et al. (1987) ProcNatl.Acad.Sci.USA84:8463-8467; Yang et al. (1990) Proc.Natl.Acad.Sci.USA87:9568-9572; Wu and Wu (1987) J. Biol. Chem. 262:4429-4432; Wu and Wu (1988) Biochemistry 27:887-892; which are incorporated herein by reference). Some of these techniques can be successfully adapted for use in vivo or ex vivo.

[0131] Once the expression construct has been delivered in the cell, the nucleic acid comprising the engineered reverse transcriptase subsequence can be located and expressed at different sites.In certain embodiments, the nucleic acid comprising the engineered reverse transcriptase subsequence can be stably integrated into the genome of the cell.This integration can be carried out in homologous position and orientation by homologous recombination (gene replacement), or can be integrated in random non-specific position (gene enhancement).In other embodiments, nucleic acid can be stably maintained in the cell as an independent episomal DNA fragment.Such nucleic acid fragment or " episomal " encoding are enough to allow independent of the host cell cycle or with the host cell cycle synchronization maintenance and replication sequence.How the expression construct is delivered to the cell and the position that nucleic acid retains in the cell depends on the type of the expression construct used.

[0132] In another embodiment, the expression construct can be simply composed of naked recombinant DNA or plasmids comprising engineered retrotransposons. The transfer of the construct can be carried out by any of the above methods that physically or chemically permeabilize the cell membrane. This is particularly suitable for in vitro transfer, but can also be applied to in vivo use. Dubensky et al. (Proc. Natl. Acad. Sci. USA (1984) 81: 7529-7533) successfully injected polyomavirus DNA in the form of calcium phosphate precipitation into the liver and spleen of adult and newborn mice, which demonstrated activated viral replication and acute infection. Benvenisty & Neshif (Proc. Natl. Acad. Sci. USA (1986) 83: 9551-9555) also demonstrated that direct intraperitoneal injection of calcium phosphate precipitated plasmids led to the expression of transfected genes. It is envisioned that the DNA encoding the purpose engineered retrotransposons can also be transferred in vivo and express the retrotransposons product in a similar manner.

[0133] In another embodiment, naked DNA expression constructs can be transferred into cells by particle bombardment. This method relies on the ability to accelerate DNA-coated microprojectiles to high speeds so that they can pierce cell membranes and enter cells without killing them (Klein et al. (1987) Nature 327: 70-73). Several devices for accelerating small particles have been developed. One such device relies on high-voltage discharges to generate electric currents, which in turn provide power (Yang et al. (1990) Proc. Natl. Acad. Sci. USA 87: 9568-9572). Microprojectiles can be composed of biologically inert materials such as tungsten or gold beads.

[0134] In other embodiments, liposomes can be used to deliver expression constructs. Liposomes are vesicle structures characterized by phospholipid bilayer membranes and internal aqueous media. Multilamellar liposomes have multiple lipid layers separated by aqueous media. They are spontaneously formed when phospholipids are suspended in excess aqueous solution. The lipid components are self-rearranged before forming a closed structure, and water and dissolved solutes are trapped between lipid bilayers (Ghosh & Bachhawat (1991) Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors and Ligands, Wu et al. (Eds.), Marcel Dekker, NY, 87-104). It is also contemplated to use lipofectamine-DNA complexes.

[0135] In certain embodiments, liposomes can be compounded with hemagglutinating virus (HVJ). It has been shown that this promotes fusion with cell membranes and promotes liposome-encapsulated DNA to enter cells (Kaneda et al. (1989) Science 243: 375-378). In other embodiments, liposomes can be compounded with nuclear non-histone chromosomal proteins (HMG-I) or used in combination with them (Kato et al. (1991) J.Biol.Chem.266 (6): 3361-3364). In other embodiments, liposomes can be compounded with HVJ and HMG-I or used in combination with them. Because such expression constructs have been successfully used for nucleic acid transfer and expression in vitro and in vivo, they are suitable for the present invention. In the case of using bacterial promoters in DNA constructs, it is also desirable to include appropriate bacterial polymerases in liposomes.

[0136] Other expression constructs that can be used to deliver nucleic acids into cells are receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in nearly all eukaryotic cells. Due to the cell type-specific distribution of multiple receptors, delivery can be highly specific (Wu and Wu (1993) Adv. Drug Delivery Rev. 12: 159-167).

[0137] Receptor-mediated gene targeting vectors are usually composed of two components: a cell receptor-specific ligand and a DNA binding agent. Several ligands have been used for receptor-mediated gene transfer. The most widely characterized ligands are asialoorosomucoid (ASOR) and transferrin (see, e.g., Wu and Wu (1987), supra; Wagner et al. (1990) Proc. Natl. Acad. Sci. USA 87 (9): 3410-3414). A synthetic new glycoprotein that recognizes the same receptor as ASOR has been used as a gene delivery vehicle (Ferkol et al. (1993) FASEB J. 7: 1081-1091; Perales et al. (1994) Proc. Natl. Acad. Sci. USA 91(9): 4086-4090), and epidermal growth factor (EGF) has also been used to deliver genes to squamous carcinoma cells (Myers, EPO 0273085).

[0138] In other embodiments, the delivery vehicle may include a ligand and a liposome. For example, Nicolau et al. (Methods Enzymol. (1987) 149: 157-176) used lactosylceramide, galactose-terminal asialoganglioside, incorporated into liposomes and observed that hepatocytes increased the uptake of insulin genes. Therefore, it is feasible that the nucleic acid encoding a specific gene can also be specifically delivered to the cell by any number of receptor-ligand systems with or without liposomes. In addition, antibodies to cell surface antigens can also be used similarly as targeting moieties.

[0139] In a specific example, the recombinant polynucleotide comprising an engineered reverse transcriptase can be administered in combination with a cationic lipid. Some examples of cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPE, and DOTAP. The disclosure of WO / 0071096 (which is specifically incorporated by reference) describes different preparations, such as DOTAP: cholesterol or cholesterol derivative preparations, which can be effectively used for gene therapy. Other disclosures also discuss different lipid or liposome preparations (including nanoparticles) and methods of administration; these include, but are not limited to, U.S. Patent Publications 20030203865, 20020150626, 20030032615, and 20040048787, which are specifically incorporated by reference to the extent of other related aspects of the preparation of the disclosed nucleic acid and the administration and delivery of the nucleic acid. Methods for forming particles are also disclosed in U.S. Patent Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972,900, which are incorporated by reference for these purposes.

[0140] In certain embodiments, gene transfer can be more easily performed under ex vivo conditions. Ex vivo gene therapy refers to isolating cells from a subject, delivering nucleic acids into the cells in vitro, and then returning the modified cells to the subject. This may involve collecting a biological sample containing cells from the subject. For example, blood may be obtained by venipuncture, and solid tissue samples may be obtained by surgical techniques according to methods known in the art.

[0141] Typically, but not always, the object (i.e., recipient) receiving the cell is also the object from which the cell is harvested or obtained, which provides the advantage that the donated cell is an autologous cell. However, the cell can be obtained from another object (i.e., donor), from a cell culture of the donor, or from an established cell culture system. The cell can be obtained from the same or different species as the object to be treated, but is preferably the same species, and more preferably has the same immunological characteristics as the object. For example, such a cell can be obtained from a biological sample comprising cells from a close relative or matching donor, then transfected with a nucleic acid (e.g., comprising an engineered reverse transcriptase), and applied to an object requiring genome modification, e.g., for the treatment of a disease or illness.

[0142] Reagent test kit

[0143] Also provided is a kit comprising an engineered retromer construct as described herein. In some embodiments, the kit provides an engineered retromer construct or a vector system comprising such a retromer construct. In some embodiments, the engineered retromer construct included in the kit includes a heterologous sequence, which can provide a nucleic acid encoding a target protein or a regulatory RNA, a cell barcode, a donor polynucleotide suitable for gene editing, such as by homology directed repair (homology directed repair, HDR) or recombinant mediated genetic engineering (recombination engineering), or a CRISPR pre-spacer DNA sequence for molecular recording. Other reagents may also be included in the kit, such as a transfection agent, a host cell, a suitable culture medium for culturing cells, a buffer, etc.

[0144] In the context of test kit, reagent can be provided in liquid form or in the form of sale of any convenient packaging (e.g., stick packaging, dosage packaging, etc.). The reagent of the test kit can be present in the same or separate containers. Reagent can also be present in the same container. In addition to the above-mentioned components, the subject test kit can also include (in certain embodiments) instructions for implementing the subject method. These instructions can be present in the subject test kit in various forms, one or more of which can be present in the test kit. One form in which these instructions can exist is as printed information in a suitable medium or substrate (e.g., one or more sheets of paper on which information is printed), in the packaging of the test kit, in a package insert, etc. Another form of these instructions is a computer-readable medium in which information has been recorded, such as a disk, a compact disk (CD), a flash drive, etc. Another form in which these instructions can exist is a website address, which can be used to access information on a deleted site through the Internet.

[0145] utility

[0146] Heterologous sequences can be used to engineer the reverse transcripton for use in a variety of applications.For example, heterologous sequences can be added to the reverse transcripton construct to provide heterologous nucleic acids, cell barcodes, donor polynucleotides suitable for gene editing to cells encoding target proteins or regulatory RNAs, such as by homology-directed repair (HDR) or recombinant-mediated genetic engineering (recombination engineering), or for the CRISPR pre-spacer DNA sequence of molecular recording, as further discussed below.Such heterologous sequences can be inserted into, for example, msr genes or msd genes, so that the heterologous sequences are transcribed as a part of msDNA products by reverse transcripton reverse transcriptase.

[0147] Production of protein or RNA

[0148] For example, the single-stranded DNA generated by the engineered retromer can be used to produce a desired product of interest in a cell. In some embodiments, the retromer is engineered with a heterologous sequence encoding a polypeptide of interest to allow the production of a polypeptide from the retromer msDNA generated in the cell. The polypeptide of interest can be any type of protein / peptide, including but not limited to enzymes, extracellular matrix proteins, receptors, transporters, ion channels or other membrane proteins, hormones, neuropeptides, antibodies or cytoskeletal proteins; or fragments thereof, or a biologically active domain of interest. In some embodiments, the protein is a therapeutic protein or therapeutic antibody for the treatment of a disease.

[0149] In other embodiments, the retromer is engineered with a heterologous sequence encoding a target RNA to allow RNA to be produced from the retromer in the cell. The target RNA can be any type of RNA, including but not limited to RNA interference (RNAi) nucleic acids or regulatory RNAs, such as but not limited to microRNA (miRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), small nuclear RNA (snRNA), long non-coding RNA (lncRNA), antisense nucleic acids, etc.

[0150] Gene Editing

[0151] In some embodiments, the reverse transcriptase is engineered with a heterologous sequence encoding a donor polynucleotide suitable for use with a CRISPR / Cas genome editing system. The donor polynucleotide comprises a sequence containing the expected genome editing, and the sequence is flanked by a pair of homology arms responsible for targeting the donor polynucleotide to the target locus to be edited in the cell. The donor polynucleotide generally comprises a 5' homology arm hybridized with the 5' genomic target sequence and a 3' homology arm hybridized with the 3' genomic target sequence. The homology arms are referred to herein as 5' and 3' (i.e., upstream and downstream) homology arms, which are related to the relative position of the homology arms relative to the nucleotide sequence of the object of editing in the donor polynucleotide. The 5' and 3' homology arms hybridize with the region in the target locus in the genomic DNA to be modified, which are referred to herein as "5' target sequence" and "3' target sequence", respectively.

[0152] The homology arms must be sufficiently complementary to hybridize with the target sequence to mediate homologous recombination between the donor polynucleotide and the genomic DNA at the target locus. For example, the homology arms may comprise a nucleotide sequence having at least about 80 to 100% sequence identity (including any percentage identity within the range) with the corresponding genomic target sequence, for example, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity thereto, wherein the nucleotide sequence comprising the target edit can be integrated into the genomic DNA by HDR at the genomic target locus recognized by the 5' and 3' homology arms (i.e., having sufficient complementarity to hybridize).

[0153] In certain embodiments, the corresponding homologous nucleotide sequences in the genomic target sequence (ie, "5' target sequence" and "3' target sequence") are located on the flanks of a specific site for cutting and / or a specific site for introducing the target edit. The distance between a specific cutting site and a homologous nucleotide sequence (eg, each homology arm) can be hundreds of nucleotides. In some embodiments, the distance between the homology arm and the cutting site is 200 nucleotides or less (eg, 0, 10, 20, 30, 50, 75, 100, 125, 150, 175 and 200 nucleotides). In most cases, a smaller distance can result in a higher gene targeting rate. In a preferred embodiment, the donor polynucleotide is substantially identical to the target genomic sequence over its entire length, except for the sequence changes to be introduced into a portion of the genome (which covers both a specific cutting site and a portion of the genomic target sequence to be changed).

[0154] Homologous arms can be any length, for example 10 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 50 nucleotides or more, 100 nucleotides or more, 250 nucleotides or more, 300 nucleotides or more, 350 nucleotides or more, 400 nucleotides or more, 450 nucleotides or more, 500 nucleotides or more, 1000 nucleotides (1 kb) or more, 5000 nucleotides (5 kb) or more, 10000 nucleotides (10 kb) or more, etc. In some cases, the lengths of 5' and 3' homology arms are substantially equal to each other. However, in some cases, the lengths of 5' and 3' homology arms are not necessarily equal to each other. For example, a homology arm can be 30% or less shorter than another homology arm, 20% or less shorter than another homology arm, 10% or less shorter than another homology arm, 5% or less shorter than another homology arm, 2% or less shorter than another homology arm, or only a few nucleotides less than another homology arm. In other cases, the 5' and 3' homology arms differ significantly in length from each other, e.g., one may be 40% or more shorter, 50% or more shorter, sometimes 60% or more shorter, 70% or more shorter, 80% or more shorter, 90% or more shorter, or 95% or more shorter than the other homology arm.

[0155] Donor polynucleotides are used in combination with RNA-guided nucleases, which target specific genomic sequences (i.e., genomic target sequences to be modified) by guiding RNA. Targeting-specific guiding RNAs include nucleotide sequences complementary to genomic target sequences, and thus mediate the binding of nuclease-gRNA complexes by hybridization at the target site. For example, gRNA can be designed to be complementary to the sequence of the minor allele, so that the nuclease-gRNA complex is targeted to the mutation site. Mutation can include insertion, deletion or replacement. For example, mutation can include single nucleotide variation, gene fusion, translocation, inversion, repetition, frameshift, missense, nonsense or other mutations related to the target phenotype or disease. The minor allele of targeting can be a common genetic variant or a rare genetic variant. In certain embodiments, gRNA is designed to selectively bind to the minor allele with a single base pair distinction, for example, to allow the nuclease-gRNA complex to be combined with a single nucleotide polymorphism (single nucleotide polymorphism, SNP). In particular, gRNA can be designed to target disease-related mutations for the purpose of performing genome editing to remove mutations from genes. Alternatively, gRNA can be designed to be complementary to the sequence of the major or wild-type allele to target the nuclease-gRNA complex to the allele for the purpose of performing genome editing to introduce mutations (e.g., insertions, deletions, or substitutions) into genes in the genomic DNA of cells. For example, such genetically modified cells can be used to change phenotypes, confer new properties, or generate disease models for drug screening.

[0156] In certain embodiments, the RNA-guided nuclease for genome modification is a clustered regularly interspaced short palindromic repeat (CRISPR) system Cas nuclease. Any RNA-guided Cas nuclease that can catalyze site-directed DNA cutting to allow integration of donor polynucleotides by the HDR mechanism can be used for genome editing, including CRISPR system type I, type II or type III Cas nucleases. Some examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cs e3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and Cu1966, and homologs or modified versions thereof.

[0157] In certain embodiments, type II CRISPR system Cas9 endonucleases are used. Cas9 nucleases from any species or retaining Cas9 endonuclease activity (i.e., catalyzing the site-directed cutting of DNA to generate double-strand breaks) thereof biologically active fragments, variants, analogs or derivatives can be used to carry out genome modification as described herein. Cas9 does not need to be physically derived from an organism, but can be produced synthetically or recombinantly. Cas9 sequences from many bacterial species are well known in the art and are listed in the National Center for Biotechnology Information (NCBI) database. See, e.g., NCBI entries for Cas9 from: Streptococcus pyogenes (WP_002989955, WP_038434062, WP_011528583); Campylobacter jejuni (WP_022552435, YP_002344900), Campylobacter coli (WP_060786116); Campylobacter fetus (WP_059434633); Corynebacterium ulcerans (NC_015683, NC_017317); Corynebacterium diphtheria (NC_016782, NC_016786); Enterococcus faecalis (NC_016783, NC_016786); faecalis (WP_033919308); Spiroplasma syrphidicola (NC_021284); Prevotella intermedia (NC_017861); Spiroplasma taiwanense (NC_021846); Streptococcus iniae (NC_021314); Belliella baltica (NC_018010); PsychroflexustorquisI (NC_018721); Streptococcus thermophilus (YP_820832), Streptococcus mutans ... Streptococcus iniae (NC_021314); Belliella baltica (NC_018010); Streptococcus iniae (NC_021314); Belliella baltica (NC_018010); Streptococcus iniae (NC_021314); Streptococcus iniae (NC_021314); Belliella baltica (NC_018010); Streptococcus iniae ( mutans)(WP_061046374, WP_024786433); Listeria innocua(NP_472073);Listeria monocytogenes (WP_061665472); Legionella pneumophila (WP_062726656); Staphylococcus aureus (WP_001573634); Francisella tularensis (WP_032729892, WP_014548420), Enterococcus faecalis (WP_033919308); Lactobacillus rhamnosus (WP_048482595, WP_032965177); and Neisseria meningitidis (WP_001573634). meningitidis) (WP_061704949, YP_002342100); all of these sequences (as entered as of the date of filing this application) are incorporated herein by reference in their entirety. Any of these sequences or variants thereof, including sequences having at least about 70% to 100% sequence identity thereto (including any percentage identity within that range), such as 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto, can be used to perform genome editing as described herein. See also Fonfara et al. (2014) Nucleic Acids Res. 42(4):2577-90; Kapitonov et al. (2015) J. Bacteriol. 198(5):797-807, Shmakov et al. (2015) Mol. Cell. 60(3):385-397, and Chylinski et al. (2014) Nucleic Acids Res. 42(10):6091-6105); for sequence comparison and discussion of genetic diversity and phylogenetic analysis of Cas9. ;

[0158] CRISPR-Cas systems are naturally present in bacteria and archaea, where they play a role in RNA-mediated adaptive immunity against exogenous DNA. Bacterial type II CRISPR systems use the endonuclease Cas9, which forms a complex with a guide RNA (gRNA) that specifically hybridizes to a complementary genomic target sequence, where the Cas9 endonuclease catalyzes cleavage to produce double-strand breaks. Cas9 targeting is also generally dependent on the presence of a 5' protospacer sequence adjacent motif (PAM) at or near the gRNA binding site in DNA.

[0159] The genomic target site will generally include a nucleotide sequence complementary to the gRNA, and may further include a protospacer sequence adjacent motif (PAM). In certain embodiments, the target site also includes 20 to 30 base pairs in addition to the PAM of 3 base pairs. Typically, the first nucleotide of the PAM can be any nucleotide, and the other two nucleotides will depend on the selected specific Cas9 protein. Exemplary PAM sequences are known to those skilled in the art and include but are not limited to NNG, NGN, NAG and NGG, where N represents any nucleotide. In certain embodiments, the allele targeted by the gRNA includes a mutation that produces a PAM in the allele, wherein the PAM promotes the binding of the Cas9-gRNA complex to the allele.

[0160] In certain embodiments, the gRNA is 5 to 50 nucleotides, 10 to 30 nucleotides, 15 to 25 nucleotides, 18 to 22 nucleotides, or 19 to 21 nucleotides in length, or any length between the ranges, including, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides in length. The guide RNA can be a single guide RNA comprising crRNA and tracrRNA sequences in a single RNA molecule, or the guide RNA can comprise two RNA molecules, wherein the crRNA and tracrRNA sequences are located in separate RNA molecules.

[0161] In another embodiment, a CRISPR nuclease from Prevotella and Francisella 1 (Cpf1) is used. Cpf1 is another class II CRISPR / Cas system RNA-guided nuclease, which is similar to Cas9 and can be used similarly. Unlike Cas9, Cpf1 does not require tracrRNA and relies only on the crRNA in its guide RNA, which provides an advantage that a shorter guide RNA can be used with Cpf1 compared to Cas9 for targeting. Cpf1 can cut DNA or RNA. In contrast to the G-rich PAM sites recognized by Cas9, the PAM sites recognized by Cpf1 have the sequence 5'-YTN-3' (wherein "Y" is pyrimidine and "N" is any nucleobase) or 5'-TTN-3'. Cpf1 cutting of DNA produces a double-strand break with a sticky end containing 4 or 5 nucleotide overhangs. For discussion of Cpf1, see, e.g., Ledford et al. (2015) Nature. 526(7571):17-17, Zetsche et al. (2015) Cell. 163(3):759-771, Murovec et al. (2017) Plant Biotechnol. J. 15(8):917-926, Zhang et al. (2017) Front. Plant Sci. 8:177, Fernandes et al. (2016) Postepy Biochem. 62(3):315-326; which are incorporated herein by reference.

[0162] C2c1 is another class II CRISPR / Cas system RNA-guided nuclease that can be used. Similar to Cas9, C2c1 relies on both crRNA and tracrRNA for guidance to the target site. For a description of C2c1, see, e.g., Shmakov et al. (2015) Mol Cell. 60 (3): 385-397, Zhang et al. (2017) Front Plant Sci. 8: 177; which are incorporated herein by reference.

[0163] In another embodiment, an engineered RNA-guided FokI nuclease can be used. The RNA-guided FokI nuclease comprises a fusion of an inactive Cas9 (dCas9) and a FokI endonuclease (FokI-dCas9), wherein the dCas9 portion confers FokI with RNA-dependent targeting. For a description of engineered RNA-guided FokI nucleases, see, for example, Havlicek et al. (2017) Mol. Ther. 25 (2): 342-355, Pan et al. (2016) Sci Rep. 6: 35794, Tsai et al. (2014) Nat Biotechnol. 32 (6): 569-576; which are incorporated herein by reference.

[0164] The RNA-guided nuclease can be provided in the form of a protein, optionally wherein the nuclease is complexed with a gRNA, or provided by a nucleic acid encoding the RNA-guided nuclease (e.g., RNA (e.g., messenger RNA) or DNA (expression vector)). In some embodiments, both the RNA-guided nuclease and the gRNA are provided by a vector. Both can be expressed by a single vector, or expressed on different vectors. The vector encoding the RNA-guided nuclease and the gRNA can be included in a vector system comprising an engineered reverse transcriptase msr gene, msd gene, and ret gene sequence.

[0165] Codon usage can be optimized to improve the production of RNA-guided nucleases and / or reverse transcriptases in a particular cell or organism. For example, a nucleic acid encoding an RNA-guided nuclease or reverse transcriptase can be modified to replace codons that have a higher usage frequency compared to the naturally occurring polynucleotide sequence in yeast cells, bacterial cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest. When a nucleic acid encoding an RNA-guided nuclease or reverse transcriptase is introduced into a cell, the protein can be expressed transiently, conditionally, or constitutively in the cell.

[0166] Recombination Engineering

[0167] Recombination engineering (recombination-mediated genetic engineering) can be used to modify chromosomes and episomal replicons in cells, for example, to produce gene replacement, gene knockout, deletion, insertion, inversion or point mutation. Recombination engineering can also be used to modify plasmids or bacterial artificial chromosomes (BAC), for example, to clone genes or insert markers or tags. Engineered retrotransposons as described herein can be used for recombinant engineering applications to provide linear single-stranded or double-stranded DNA for recombination. Homologous recombination is mediated by phage proteins, such as RecE / RecT from Rac prophages or Red αβδ from phage λ. Linear DNA should have enough homology to allow recombination at 5' and 3' ends with the target DNA molecules (for example, plasmids, BACs or chromosomes) present in cells.

[0168] The linear double-stranded or single-stranded DNA molecule used in recombineering (i.e., the donor polynucleotide) contains a sequence with the desired edit to be inserted, which is flanked by two homology arms that target the linear DNA molecule to the target site for homologous recombination. 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 200 nucleotides in length. In some embodiments, the length of the homology arm is at least 15, at least 20, at least 30, at least 40, or at least 50 or more nucleotides. Homology arms with a length range of 40 to 50 nucleotides generally have sufficient targeting efficiency for recombination; however, longer homology arms of 150 to 200 bases or more can further improve targeting efficiency. In some embodiments, the lengths of the 5' homology arm and the 3' homology arm are different. For example, a linear DNA may have about 50 bases at the 5' end and about 20 bases at the 3' end, which have homology to the region to be targeted.

[0169] Phage homologous recombination protein can be provided to cells as protein or provided to cells by one or more vectors encoding recombinant proteins. In some embodiments, one or more vectors encoding phage recombinant proteins are included in a vector system comprising engineered reverse transcriptase msr gene, msd gene and ret gene sequences.

[0170] In addition, many bacterial strains containing prophage recombination systems can be used for recombineering, including but not limited to: DY380, which contains a defective lambda prophage with the recombination proteins exo, bet and gam; EL250, which is derived from DY380 and contains, in addition to the recombination genes found in DY380, a strictly regulated arabinose-inducible flpe gene (flpe mediates recombination between two identical frt sites); EL350, which is also derived from DY380 and contains, in addition to the recombination genes found in DY380, a strictly regulated SW102, which is derived from DY380, is designed for BAC recombineering using galK positive / negative selection; SW105, which is derived from EL250, can also be used for galK positive / negative selection, but like EL250, contains ara inducible Flpe gene; and SW106, which is derived from EL350, can be used for galK positive / negative selection, but like EL350, contains ara inducible Cre gene. Recombineering can be performed by transfecting bacterial cells of such strains with engineered retrotransposons, which contain heterologous sequences encoding linear DNA suitable for recombineering. For a discussion of recombineering systems and protocols, see, e.g., Sharan et al. (2009) Nat Protoc. 4(2):206–223, Zhang et al. (1998) Nature Genetics 20:123-–128, Muyrers et al. (1999) Nucleic Acids Res. 27:1555–-1557, Yu et al. (2000) Proc. Natl. Acad. Sci USA 97(11):5978-–5983; which are incorporated herein by reference.

[0171] Molecular Records

[0172] In some embodiments, the heterologous sequence in the engineered reverse transcriptase construct comprises a synthetic CRISPR pre-spacer DNA sequence to allow molecular recording. Endogenous CRISPR Cas1-Cas2 systems are typically used by bacteria and archaea to track exogenous DNA sequences derived from viral infections by storing short sequences (i.e., pre-spacers) that confer sequence-specific resistance to invasive viral nucleic acids within genome-based arrays. These arrays not only retain the spacer sequence, but also record the order in which the sequence was obtained, thereby generating a time record of the acquisition event.

[0173] The system can be applied to record arbitrary DNA sequences into genomic CRISPR arrays in the form of "synthetic protospacers", which are introduced into cells using engineered retrotransposons. Engineered retrotransposons carrying protospacer sequences can be used to integrate synthetic CRISPR protospacer sequences at specific genomic loci by utilizing the CRISPR system Cas1 to Cas2 complex. Molecular recording can be used to track certain biological events by generating stable genetic memory tracking codes. See, for example, Shipman et al. (2016) Science 353 (6298): aaf1175 and International Patent Application Publication No. WO / 2018 / 191525; which are incorporated herein by reference in their entirety.

[0174] In some embodiments, a specific and arbitrary DNA sequence is recorded into a bacterial genome using a CRISPR-Cas system. The DNA sequence can be produced by an engineered retrotransposons in a cell. For example, an engineered retrotransposons can be used to produce a front spacer in a cell, which is inserted into an intracellular CRISPR array. Cells can be modified to include one or more engineered retrotransposons (or vector systems encoding them), which can produce one or more synthetic front spacers in a cell, wherein the synthetic front spacer is added to the CRISPR array. Records of limited sequences can be generated, which have been recorded for many days and recorded in a variety of ways.

[0175] In some embodiments, the engineered reverse transcriptase comprises an msd protospacer nucleic acid region or an msr protospacer nucleic acid region. In the case of an msr protospacer nucleic acid region, the protospacer sequence is first incorporated into an msr RNA, which is reversely transcribed into a protospacer DNA. When two complementary protospacer DNA sequences with complementary sequences hybridize, or when a double-stranded structure (e.g., a hairpin) is formed in a single-stranded protospacer DNA (e.g., a single msDNA can form an appropriate hairpin structure to provide a double-stranded DNA protospacer), a double-stranded protospacer DNA is produced.

[0176] In some embodiments, the single-stranded DNA produced in vivo by the first engineered reverse transcripton can be hybridized with the complementary single-stranded DNA produced in vivo by the same reverse transcripton or the second engineered reverse transcripton, or a hairpin structure can be formed, which is then used as a pre-spacer sequence to be inserted into the CRISPR array as a spacer sequence. The engineered reverse transcripton should provide a sufficient level of pre-spacer sequence in the cell for incorporation into the CRISPR array. The pre-spacer generated in the cell extends the in vivo molecular recording system from only capturing information known to the user to capturing biological or environmental information that may not be known to the user before. For example, the msDNA pre-spacer sequence in the engineered reverse transcripton construct can be driven by a promoter located downstream of the sensor pathway of a biological phenomenon or environmental toxin. The capture and storage of the pre-spacer sequence in the CRISPR array records the event. If multiple msDNA pre-spacers are driven by different promoters, the activity of these promoters (together with any content that can be upstream of the promoter) and the relative order of promoter activity (based on the relative position of the spacer sequence in the CRISPR array) are recorded. At any time point after a record has occurred, the CRISPR array can be sequenced to determine whether a given biological or environmental event occurred and the order of multiple events, as given by the presence and relative position of msDNA-derived spacers in the CRISPR array.

[0177] In some embodiments, the synthetic protospacer further comprises an AAG PAM sequence at its 5' end. Protospacers comprising a 5' AAGPAM are obtained by the CRISPR array with higher efficiency than protospacers that do not comprise a PAM sequence.

[0178] In some embodiments, Cas1 and Cas2 are provided by vectors expressing Cas1 and Cas2 at levels sufficient to allow synthetic protospacer sequences produced by engineered retrotransposons to be acquired by the CRISPR array in a cell. Such vector systems can be used to allow molecular recording in cells lacking endogenous Cas proteins.

[0179] Exemplary Non-Limiting Aspects of the Disclosure

[0180] Some aspects (including embodiments) of the above-mentioned present themes, alone or in combination with one or more other aspects or embodiments, may be beneficial. Without limiting the previously described, some non-limiting aspects of the present disclosure numbered 1 to 60 are provided below. As will be apparent to those skilled in the art after reading the present disclosure, each of the separately numbered aspects may be used or combined with any of the previously or following separately numbered aspects. This is intended to provide support for all such combinations of aspects, and is not limited to the combinations of aspects explicitly provided below.

[0181] 1. An engineered reverse transcriptase comprising:

[0182] a)MSR pre-sequence;

[0183] b) msr genes encoding multiple copies of single-stranded RNA (msRNA);

[0184] c) msd gene encoding multiple copies of single-stranded DNA (msRNA);

[0185] d) a post-msd sequence comprising a self-complementary region having sequence complementarity with the pre-msr sequence, wherein the length of the self-complementary region is at least 1 to 50 nucleotides longer than the wild-type self-complementary region, so that the engineered reverse transcriptase can enhance the production of the msDNA; and

[0186] e) The ret gene encoding reverse transcriptase.

[0187] 2. An engineered retrotransposon wherein the length of the self-complementary region is at least 5, at least 10, at least 15, at least 20, at least 25, or at least 30 nucleotides longer than the wild-type self-complementary region.

[0188] 3. The engineered retromer of aspect 1 or 2, wherein the msr gene and the msd gene are provided in a trans arrangement or a cis arrangement.

[0189] 4. The engineered retromer of aspect 3, wherein the ret gene is provided in a trans arrangement relative to the msr gene and the msd gene.

[0190] 5. The engineered retrotransposon of any one of aspects 1 to 4, wherein the msr gene, msd gene and ret gene are derived from a myxobacterial retrotransposon, an Escherichia coli retrotransposon or a Vibrio cholerae retrotransposon.

[0191] 6. The engineered retrotransposon of aspect 5, wherein the E. coli retrotransposon is EC83 or EC86.

[0192] 7. The engineered reverse transcriptase of any one of aspects 1 to 6, further comprising a heterologous sequence of interest.

[0193] 8. The engineered retromer of aspect 7, wherein the heterologous sequence is inserted into the msr gene or the msd gene.

[0194] 9. The engineered retromer of aspects 1 to 7 or 8, wherein the heterologous nucleic acid fragment is inserted 9 to 20 bases away from the complementary region.

[0195] 10. The engineered retromer of aspects 7, 8 or 9, wherein the heterologous sequence is within the hairpin loop of the msd, after the msd or the msDNA.

[0196] 11. The engineered retromer of aspects 1 to 8 or 9, wherein a heterologous nucleic acid fragment is inserted at position 20 to 60 after the msd or the msd.

[0197] 12. The engineered retromer of aspects 7 to 10 or 11, wherein the heterologous sequence encodes a donor polynucleotide comprising a 5' homology arm that hybridizes to the 5' target sequence and a 3' homology arm that hybridizes to the 3' target sequence, the 5' homology arm and the 3' homology arm being located on either side of a nucleotide sequence comprising a target edit to be integrated into the target locus by homology directed repair (HDR) or recombineering.

[0198] 13. The engineered retromer of aspects 7 to 11 or 12, wherein the heterologous sequence comprises a CRISPR protospacer DNA sequence.

[0199] 14. The engineered retrotransposon of aspect 13, wherein the CRISPR protospacer DNA sequence comprises a modified AAG protospacer adjacent motif (PAM).

[0200] 15. The engineered retromer of any one of aspects 1 to 14, further comprising a barcode sequence.

[0201] 16. The engineered retromer of aspect 15, wherein the barcode sequence is located in the hairpin loop of the msDNA.

[0202] 17. A vector system comprising one or more vectors containing the engineered retrotransposons of any one of aspects 1 to 16.

[0203] 18. The vector system of aspect 17, wherein the msr gene and the msd gene are provided by the same vector or different vectors.

[0204] 19. The vector system of aspect 17 or 18, wherein the msr gene, the msd gene and the ret gene are provided by the same vector.

[0205] 20. The vector system of aspect 17, 18 or 19, wherein the vector comprises a promoter operably linked to the msr gene and the msd gene.

[0206] 21. The vector system of aspect 20, wherein the promoter is also operably linked to the ret gene.

[0207] 22. The vector system of aspect 20 or 21, further comprising a second promoter operably linked to the ret gene.

[0208] 23. The vector system of aspects 17 to 21 or 22, wherein the msr gene, the msd gene and the ret gene are provided by different vectors.

[0209] 24. The vector system of any one of aspects 17 to 22 or 23, wherein the one or more vectors are viral vectors or non-viral vectors.

[0210] 25. The vector system of aspect 24, wherein the non-viral vector is a plasmid.

[0211] 26. The vector system of any one of Aspects 17 to 25, wherein the engineered retromer comprises a donor polynucleotide comprising a 5' homology arm that hybridizes to a 5' target sequence and a 3' homology arm that hybridizes to a 3' target sequence, the 5' homology arm and the 3' homology arm being located on either side of a nucleotide sequence comprising a target edit to be integrated at the target locus by homology directed repair (HDR) or recombineering.

[0212] 27. The vector system of aspect 26, further comprising a vector encoding an RNA-guided nuclease.

[0213] 28. The vector system of aspect 27, wherein the RNA-guided nuclease is a Cas nuclease or an engineered RNA-guided FokI-nuclease.

[0214] 29. The method of aspect 28, wherein the Cas nuclease is Cas9 or Cpf1.

[0215] 30. The vector system of any one of aspects 17 to 29, wherein the engineered retromer comprises a CRISPR protospacer DNA sequence.

[0216] 31. The vector system of aspect 30, further comprising a vector encoding a Cas1 or Cas2 protein.

[0217] 32. The vector system of aspect 30 or 31, further comprising a vector comprising a CRISPR array sequence.

[0218] 33. The vector system of any one of aspects 29 to 31, further comprising a vector encoding a bacteriophage homologous recombination protein.

[0219] 34. The vector system of aspect 33, wherein the vector encoding the bacteriophage homologous recombination protein is a replication-deficient lambda prophage comprising exo, bet and gam genes.

[0220] 35. An isolated host cell comprising the engineered retrotranscripton of any one of aspects 1 to 16 or the vector system of any one of aspects 17 to 34.

[0221] 36. The host cell of aspect 35, wherein the host cell is a prokaryotic, archaeal or eukaryotic host cell.

[0222] 37. The host cell of aspect 36, wherein the eukaryotic host cell is a mammalian host cell.

[0223] 38. The host cell of aspect 37, wherein the mammalian host cell is a human host cell.

[0224] 39. The host cell of aspect 35, wherein the host cell is an artificial cell or a genetically modified cell.

[0225] 40. A kit comprising the engineered retrotranscriptor of any one of aspects 1 to 16, the vector system of any one of aspects 17 to 34, or the host cell of any one of aspects 35 to 39.

[0226] 41. The kit of aspect 40, further comprising instructions for using the engineered retrotransposons to genetically modify cells.

[0227] 42. A method for genetically modifying a cell, comprising:

[0228] a) transfecting a cell with the engineered retrotransposon of aspects 1 to 15 or 16 (eg, aspect 12);

[0229] b) introducing or expressing an RNA-guided nuclease and a guide RNA into the cell, wherein the RNA-guided nuclease forms a complex with the guide RNA, the guide RNA directs the complex to a genomic target locus, wherein the RNA-guided nuclease generates a double-stranded break in the genomic DNA at the genomic target locus, and the donor polynucleotide produced by the engineered retromer is integrated at the genomic target locus recognized by its 5' homology arm and 3' homology arm through homology directed repair (HDR) to produce a genetically modified cell.

[0230] 43. The method of aspect 42, wherein the RNA-guided nuclease is a Cas nuclease or an engineered RNA-guided FokI-nuclease.

[0231] 44. The method of aspect 43, wherein the Cas nuclease is Cas9 or Cpf1.

[0232] 45. The method of aspects 42 to 44, wherein the RNA-guided nuclease is provided by a vector or a recombinant polynucleotide that is integrated into the genome of the cell.

[0233] 46. ​​The method of aspects 42 to 45, wherein the engineered retromer is provided by a vector.

[0234] 47. The method of aspects 42 to 45 or 46, wherein the donor polynucleotide is used to produce a gene replacement, gene knockout, deletion, insertion, inversion or point mutation.

[0235] 48. A method for genetically modifying a cell by recombinant engineering, the method comprising:

[0236] a) transfecting the cell with the engineered retrotransposon of aspects 1 to 16 (eg, aspect 12); and

[0237] b) introducing a bacteriophage recombination protein into the cell, wherein the bacteriophage recombination protein mediates homologous recombination at the target locus, so that the donor polynucleotide produced by the engineered retrotransposon is integrated at the target locus recognized by its 5' homology arm and 3' homology arm to produce a genetically modified cell.

[0238] 49. The method of aspect 48, wherein the donor polynucleotide is used to modify a plasmid, a bacterial artificial chromosome (BAC), or a bacterial chromosome in a bacterial cell by recombineering.

[0239] 50. The method of aspect 48 or 49, wherein the donor polynucleotide is used to produce a gene replacement, gene knockout, deletion, insertion, inversion or point mutation.

[0240] 51. The method of any one of aspects 48 to 50, wherein the introducing the bacteriophage recombinant protein into the cell comprises inserting a replication-defective lambda prophage into the bacterial genome.

[0241] 52. The method of aspect 51, wherein the bacteriophage comprises exo, bet and gam genes.

[0242] 53. A method of barcoding a cell, comprising transfecting the cell with the engineered retrotranscripton of aspects 1 to 15 or 16 (eg, aspect 15 or 16).

[0243] 54. A method for producing an in vivo molecular recording system, comprising:

[0244] a) introducing the Cas1 protein or Cas2 protein of the CRISPR adaptation system into a host cell;

[0245] b) introducing a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence into the host cell, wherein the CRISPR array nucleic acid sequence is integrated into the genomic DNA or vector in the host cell; and

[0246] c) introducing a plurality of engineered retrotransposons according to aspects 1 to 16 (e.g., aspect 13 or 14) into the host cell, wherein each retrotransposon comprises a different protospacer DNA sequence that can be processed and inserted into the CRISPR array nucleic acid sequence.

[0247] 55. The method of aspect 54, wherein the Cas1 protein or the Cas2 protein is provided by a vector.

[0248] 56. The method of aspect 54 or 55, wherein the engineered retromer is provided by a vector.

[0249] 57. The method of any one of aspects 54 to 56, wherein a plurality of said engineered retrotransposons comprise at least three different protospacer DNA sequences.

[0250] 58. An engineered cell comprising an in vivo molecular recording system, comprising:

[0251] a) Cas1 protein or Cas2 protein of CRISPR editing system;

[0252] b) a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence into a host cell, wherein the CRISPR array nucleic acid sequence is integrated into genomic DNA or a vector in the engineered cell; and

[0253] c) a plurality of engineered retrotransposons according to aspects 1 to 16 (or aspects 13 or 14), wherein each retrotransposon comprises a different protospacer DNA sequence, which can be processed and inserted into the CRISPR array nucleic acid sequence.

[0254] 59. The engineered cell of aspect 58, wherein the Cas1 protein or the Cas2 protein is provided by a vector.

[0255] 60. The engineered cell of aspect 58 or 59, wherein the engineered retromer is provided by a vector.

[0256] 61. The engineered cell of any one of aspects 58 to 60, wherein a plurality of said engineered retrotransposons comprise at least three different protospacer DNA sequences.

[0257] 62. A kit comprising the engineered cell of any one of aspects 58 to 61 and instructions for in vivo molecular recording.

[0258] 60. A method for producing recombinant msDNA, comprising:

[0259] a) transfecting a host cell with the engineered reverse transcriptase of any one of aspects 1 to 16 or the vector system of any one of aspects 17 to 34; and

[0260] b) culturing the host cell under suitable conditions, wherein the msDNA is produced.

[0261] Example

[0262] The following examples are presented to provide one of ordinary skill in the art with a disclosure and description of how to make and use the disclosed subject matter, and are not intended to limit the scope of what the inventors believe to be their invention, nor are they intended to represent that the following experiments are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to the numbers used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be considered. Unless otherwise indicated, percents are percent by weight, molecular weights are weight average molecular weights, temperatures are degrees Celsius, and pressures are at or near atmospheric pressure. Standard abbreviations may be used, such as bp, base pairs; kb, kilobases; pl, picoliters; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acids; kb, kilobases; bp, base pairs; nt, nucleotides; im, intramuscular; ip, intraperitoneal; sc, subcutaneous; etc.

[0263] Example 1: Materials and Methods

[0264] This example illustrates some of the material methods used to develop the present invention.

[0265] Bacterial strains, plasmids and culture conditions

[0266] Experiments were performed in BL21-AI E. coli (Thermo Fisher), which contains an integrated arabinose-inducible T7 polymerase, an endogenous CRISPR array, an endogenous reverse transcriptase, but no endogenous Cas1+2 or bMS.346 (a variant of MG1655 that contains an integrated arabinose-inducible T7 polymerase but no endogenous reverse transcriptase).

[0267] exist Figure 3B , 3CIn the reverse transcriptase-based experiments described in , 4D, 7B, 7C-2, 8B, 9B and 10B to 10D, the reverse transcriptase was expressed from a plasmid with an erythromycin-inducible promoter (mphR-ec86RT) (see Rogers et al., Nucleic Acids Res. 2015 Sep 3; 43(15):7648-60. doi: 10.1093 / nar / gkv616. Epub 2015 Jul 7, which is hereby incorporated by reference in its entirety). The msd and msr elements were expressed together (DUET-T7-msr / msd) or separately (DUET-T7-msr-T7-msd) from an inducible T7 promoter.

[0268] For about Figures 11A to 11B The described retrotransposons generated the prospacer experiments, and the plasmids encoding Cas1+2 and modified ec86msr / msd (which were both expressed by the inducible (T7 / lac) promoter (DUET-msr / msd-Cas1+2)) were transformed into cells before each experiment. Cells containing plasmids were maintained as colonies on plates at 4°C for up to three weeks. Cells were grown in LB medium at 34°C and induced using IPTG, L-arabinose and / or erythromycin for the specified durations.

[0269] Electrophoresis analysis of MSD

[0270] In order to visualize the msd produced from the modified reverse transcriptase, bacteria were cultured 4 to 16 hours in LB with all the inducing agents necessary for expressing the transcript containing msr, msd and reverse transcriptase. The culture of 5 to 25 ml volume was precipitated at 4 ° C, and then prepared using Plasmid Plus Midi test kit (Qiagen) or Mini test kit. RNA was then digested using a combination of RNaseA and RNaseT1, and the msd obtained was purified using ssDNA / RNAClean & Concentrator test kit (ZymoResearch). MSD was visualized by running on Novex TBE-Urea gel (Thermo Fisher) and post-staining with SYBRGold (Thermo Fisher).

[0271] Variant library construction

[0272] The reverse transcriptase ncRNA variant library is synthesized as an oligo library by Agilent or Twist, wherein each synthesis run has multiple libraries. A single library is amplified from these oligo libraries, and NEB5a cells are used as cloning strains and cloned into expression vectors using the goldengate method. These clone libraries are purified from the cloning strains and transferred to expression strains (BL21-AI or bMS.346). All libraries are quantified by Illumina sequencing.

[0273] Sequencing and analysis

[0274] To quantify RT-DNA abundance in library experiments, reverse transcribed DNA was purified as described above after expression in cells containing the reverse transcriptase variant library. Cultures in volumes of 5 to 25 ml were precipitated at 4°C and then prepared using the PlasmidPlus Midi Kit (Qiagen) or the Mini Kit. RNA was then digested using a combination of RNaseA and RNaseT1, and the resulting msd was purified using the ssDNA / RNAClean&Concentrator Kit (Zymo Research). In variant libraries modified outside the reverse transcription element (e.g. Figure 7C-2 ), the barcoded region in the reverse transcription DNA circle is amplified after expression and prepared for Illumina sequencing. In a variant library where the modification is located within the reverse transcription element (e.g., Figure 8B ), the purified reverse transcribed DNA pool was extended with a single nucleotide at the 3' end using terminal deoxynucleotidyl transferase (TdT), where the length of the additional nucleotide was controlled by the TdT incubation time ( Figure 6B Next, a reverse primer consisting of an adapter sequence, a nucleotide segment complementary to the nucleotide used for extension, and an anchor nucleotide (each base is not complementary to the nucleotide used for extension) is used to create a second strand using a Klenow fragment (3'→5'exo-) which leaves an A overhang at the 5' end. This overhanging A is used for TA ligation to connect a double-stranded adapter ( Fig. 6A ). This nucleotide pool with adapters added to both ends is then indexed and prepared for Illumina sequencing. In all variant libraries, the plasmid pool present in the cell is quantified by amplifying the variable region and performing Illumina sequencing on the region. The relative abundance of different reverse transcribed DNAs is then calculated by comparing the ratio of variants in the reverse transcribed DNA to the ratio of variant plasmids (normalized relative to the co-expressed wild-type reverse transcript).

[0275] To analyze spacer acquisition, bacteria were lysed by heating to 95°C for 5 minutes and their genomic arrays were subjected to PCR using primers flanking the leader repeat junction and additionally containing Illumina-compatible adapters. Spacer sequences were bioinformatically extracted based on the presence of flanking repeat sequences and compared to pre-existing spacer sequences to determine the percentage of the array extended and the location and sequence of the newly acquired spacers. New spacers were blasted against genomic and plasmid sequences (NCBI) and additional comparisons were made against the expected protospacer sequence to determine the origin of the protospacer. This analysis was performed using custom written scripts in Python.

[0276] Example 2: Bacterial reverse transcription elements (retrotranscriptons) for enhancing DNA production in cells

[0277] Rewriting the genome of living cells requires new DNA. Currently, workers exogenously synthesize this DNA and deliver it to cells, where it serves as a template for genome engineering or as a barcode to mark cells or cell events. However, delivering sufficiently abundant exogenous DNA to overcome the low efficiency during homology-directed repair (HDR) and integration (especially in complex tissues) remains extremely challenging. In addition, there is no way to control (gate) delivery by cell type or cell state to enable targeting of cell subpopulations with specific DNA sequences.

[0278] If we can produce designed DNA sequences abundantly and on demand within the cells of our choice—just as we produce RNA and proteins—we can overcome the inefficiencies of HDR and unlock the ability to deliver different templates to different cells. We can use these locally produced DNA templates to move from editing the genome to writing it. DNA on demand will power a range of DNA modification proteins, including lambda Redβ to recode bacterial genomes, Cas9 to write therapeutic modifications into the human genome, and CRISPR integrase Cas1+2 to create molecular devices that record the timing of molecular events within living cells.

[0279] As described herein, reverse transcriptase is a solution to generate abundant DNA, including different DNA with different sequences. Not only can it generate abundant DNA, but its activity can be controlled over time and space in the same way that we currently control RNA and protein expression. Therefore, a widely delivered reverse transcriptase can generate abundant template DNA in a targeted cell subpopulation.

[0280] A particularly attractive class of reverse transcriptases is derived from bacteria and is referred to as retrotransposons (Inouye & Inouye, Annual review of microbiology 45, 163-186 (1991)) (see, e.g. Figure 1A ). It is compact, modular, orthogonal to eukaryotic cells, has been shown to produce DNA accessible to other proteins, and is used as template DNA for genome editing in both prokaryotes (Farzadfard & Lu Science 346, 1256272 (2014)) and eukaryotic cells (Sharon et al. Cell 175, 544-557 (2018)) ( Figure 1B , 1C). However, there is still much we do not understand about the biology of retrotransposons, and this knowledge gap has prevented us from using retrotransposons to generate fully designed DNA sequences in cells.

[0281] Here, we directly address the limitations of retrotransposons by further characterizing and engineering them to produce high abundance of CRISPR-compatible arbitrary DNA sequences in cells. Most of the engineering was performed in E. coli to achieve high throughput, but the modified retrotransposons and systems described here can be used in eukaryotic cells, including humans, to provide improvements in the context of genome writing.

[0282] For example, in some cases, the retromer-Eco1 is used as an exemplary retromer. The transcript is recognized by the reverse transcriptase and partially reverse transcribed into RT-DNA, such as Figure 2A The sequence of the reverse transcribed reverse transcriptase-Eco1 DNA (RT-DNA) is shown below as SEQ ID NO: 14.

[0283]

[0284] Example 3: Screening of engineered retrotransposons variants

[0285] The present inventors expressed Retroviron-Eco1 (also known as ec86 or Retroviron-Eco1 ncRNA) in E. coli. The sequence of this wild-type Retroviron-Eco1 ncRNA is shown below as SEQ ID NO: 15.

[0286]

[0287] Quantitative PCR (qPCR) showed that the expression of the expressed retrotransposon-Eco1 in E. coli produced approximately 800 to 1,000 ssDNA copies / cell ( Figure 3B ).like Figure 3CAs shown, the ssDNA so produced can be visualized, quantified and purified on a denaturing gel.

[0288] The inventors have also prepared constructs encoding various reverse transcriptase elements. For example, the reverse transcriptase is separated from the msr / msd (primer-template), thereby allowing the msr and msd to be provided to the reverse transcriptase in trans (rather than the typical cis arrangement) ( Figure 4A , 4B). This trans arrangement eliminates the cryptic termination signal of the reverse transcriptase. The sequence of the msr region of the reverse transcriptase-Eco1 is shown below as SEQ ID NO: 16.

[0289]

[0290] The sequence of the msd region only of retrotransposon-Eco1 is shown below as SEQ ID NO:17.

[0291]

[0292] Using low-throughput experiments, the reverse transcriptase-tolerant msd element was altered. For example, two variants were generated, reverse transcriptase-Eco1 v32 ncRNA and reverse transcriptase-Eco1 v35 ncRNA. The sequence of reverse transcriptase-Eco1 v32 ncRNA is shown below as SEQ ID NO: 18.

[0293]

[0294] The sequence of the retrotransposon-Eco1 v35 ncRNA is shown below as SEQ ID NO: 19.

[0295]

[0296] The key parts of the retrotranscripton-Eco1 v32 ncRNA and the retrotranscripton-Eco1 v35 ncRNA are shown in Figure 3D middle.

[0297] A large number of modifications have been made to the retroviral Eco1 ncRNA. However, not every attempted modification has been successful. In some cases, most of the modified versions did not produce ssDNA in cells.

[0298] To better understand the determinants of MSD generation from retromers, the inventors have employed a library-based approach. Tens of thousands of retromer variants have been synthesized to systematically test each structural parameter of the retromer ( Figure 5). A golden-gate based cloning strategy (Engler et al., PLOS One (Nov. 5, 2008)) was used to clone these variants and then express a large library of modified retrotransposons in multiple experiments with reverse transcriptase. The effects of retrotransposons specific parameters were quantified as they relate to the production of ssDNA by purifying all msd produced by these cells, sequencing them and comparing their abundance to the original abundance of their retrotransposons / plasmids in the expression strain. The ec86 retrotransposons were used as well as other retrotransposons, including the ec83 retrotransposons, which have an internal branching structure.

[0299] Retroviral reverse transcriptase is usually initiated in a non-standard manner to create a branched RNA-DNA hybrid that connects the msr RNA at the 2' position to the 5' end of the msd ssDNA through a phosphodiester bond (Inouye & Inouye, Annual review of microbiology 45, 163-186 (1991)). E. coli does not have an enzyme that cuts this bond. Therefore, when in E. coli, the ec86 retroviral remains branched. However, it has also been reported that ec83 is processed by an unknown mechanism that is intrinsic to the retroviral, which eliminates the 2'-5' bond and releases the ssDNA (Lim, Molecular microbiology 6, 3531-3542 (1992)). Such separation can be beneficial to a variety of applications in genome engineering.

[0300] Example 4: Sequencing of engineered retrotransposons variants

[0301] Sequencing retroviral-derived ssDNA as the readout of the experiment introduces significant complexity because the pool of purified ssDNA contains unknown parts (e.g., different ends) by design. These ssDNAs cannot be prepared for multiple sequencing using traditional processes. To address this challenge, the inventors have developed a customized sequencing process that involves purifying ssDNA, treating ssDNA with RNAase, and debranching the retroviral-derived ssDNA. The purified and debranched retroviral ssDNA is then tailed with a string of a single type of polynucleotide using a template-independent polymerase (TdT). The complementary strand of the ssDNA is then generated using a reverse anchor primer containing an adapter ( Fig. 6A , 6B). A second adaptor is ligated to the double-stranded DNA, and the adaptor-ligated double-stranded DNA is then indexed and multiplex sequenced.

[0302] The workflow was validated using synthetic oligonucleotides, wild-type and modified ec86, and wild-type ec83. The method reliably determined the correct sequence of the synthetic oligonucleotides.

[0303] Interestingly, using this multiplexed single-molecule approach, ssDNA derived from the ec86 retromer often terminates one base earlier than reported in the literature using older bulk methods (e.g., Maxam-Gilbert sequencing). Cleavage by ec83 and predicted endogenous exonuclease processing ( Figures 6C to 6F ). Since the ssDNA derived from the retromer is sequenced, modifications in the msd (template) portion of the retromer can be read directly.

[0304] The inventors also aimed to understand the parameters of non-reverse transcribed ncRNA. In order to read out these parameters, the variants of the non-reverse transcribed region were associated with the barcode inserted into the loop region of msd ( Fig. 7A ). Even without sequencing the variants, this approach elucidates the effects of sequence variation, for example, on the production of ssDNA.

[0305] Example 5: Modifications to increase DNA production in cells

[0306] This example demonstrates that separation of msr ​​and msd transcripts can allow for the production of longer RT-DNA, and that varying the length of the self-complementary noncoding RNA region of the retromer can increase the abundance of reverse transcribed DNA generated by the retromer.

[0307] As described in Example 3, expression of a trans construct encoding the retrotransposon-Eco1 msr and msd elements eliminates the cryptic termination signal of the reverse transcriptase and allows longer ssDNA to be generated ( Figure 4C , 4D).

[0308] An example of an extended retrotransposon-Eco1 msd sequence is referred to as retrotransposon-Eco1 msd+50 and is shown below as SEQ ID NO:20.

[0309]

[0310] like Figure 7C-2 As shown, the extension of the self-complementary regions of the Retrotranscripton-Eco1 ncRNA at the 5' and 3' ends leads to a significant increase in the abundance of RT-DNA produced by the Retrotranscripton in cells. An example of the extended Retrotranscripton-Eco1 ncRNA is shown below as SEQ ID NO: 21.

[0311]

[0312] An example of an extended retrotranscript-Eco1 v35 ncRNA with a slightly different sequence is shown below (SEQ ID NO: 22).

[0313]

[0314] like Figures 7B to 7C-2 As shown, the extension of the self-complementary regions of the retrotranscriptase-Eco1 ncRNA at the 5' and 3' ends leads to a significant increase in the abundance of RT-DNA produced by the retrotranscriptase in cells. For example, by increasing the length of the self-complementary region of the msd sequence, the relative amount of ssDNA can be increased by 10 times.

[0315] In contrast, the reduction of ncRNA self-complementary bases greatly weakened the production of RT-DNA. For example, a sequence of the retrotransposon-Eco1 ncRNA with a shorter self-complementary sequence is shown below as SEQ ID NO: 23.

[0316]

[0317] like Figure 7C-2 As shown, reduction in the number of these complementary bases greatly attenuated the production of RT-DNA.

[0318] Therefore, the extension of the self-complementary region before msr / after msd can increase the pool of ssDNA. Larger reverse transcribed ssDNA pools can be used for genetic modification and can improve the efficiency of genome editing in bacteria (recombineering), yeast (CRISPEY) and mammalian cells. In order to produce abundant DNA in living cells, these variants with extended self-complementary regions are preferred.

[0319] Example 6: The Msd stem region allows partial but not complete modification

[0320] The msd stem region of the retromer-Eco1 ncRNA region was modified to disrupt the stem secondary structure (double stranded bonding). This example illustrates where modifications can be made to the msd stem without adversely affecting the abundance of reverse transcribed ssDNA produced by the retromer.

[0321] The modified positions along the stem of msd are Figures 8A to 8B 9A to 9B.

[0322] Changes to the length of the msd stem structure can create shorter RT-DNA sequences. For example, a sequence of the Retroviron-Eco1 ncDNA with a short stem that still provides wild-type levels of ssDNA (Retroviron-Eco1 short stem OK, see Figure 8B ) is shown below as SEQ ID NO:24.

[0323]

[0324] However, as the MSD stem length was reduced to less than 14 bases, the abundance of the generated RT-DNA was negatively affected ( Figure 8B An example of a sequence retrotransposon-Eco1 ncDNA having a stem that is too short is shown below as SEQ ID NO: 25 ( Figure 8B , stems too short).

[0325]

[0326] In contrast, when the stem region of the retromer is disrupted and subsequently repaired, the amount of ssDNA generated is the same as or slightly higher than that of the wild type. "Disruption" means that the base pairing of the stem is disrupted, for example, by the introduction of non-complementary nucleotides. Fig. 9B As shown in Figure 2, when the bases of the ncRNA stem were disrupted by changing five bases in a row, the abundance of RT-DNA was significantly reduced. Fig. 9B ) is shown below as SEQ ID NO:26.

[0327]

[0328] However, if these bases are compensated by complementary changes on the other side of the stem to preserve the stem secondary structure, RT-DNA abundance is preserved (see, e.g., Fixed Stem, Fig. 9B ).like Fig. 9B The sequence of the "fixed stem" retrotransposon-Eco1 ncRNA is shown below as SEQ ID NO:27.

[0329]

[0330] Modifications to the stem in the region 9 to 20 bases from the stem base are tolerated even if they disrupt the stem structure ( Fig. 9B , see permissible broken stems). Such permissible broken stems modify (mismatch) the middle of the stem. Fig. 9B An example of the sequence of a stem-breakage tolerant retrotransposon-Eco1 ncRNA is shown below as SEQ ID NO:28.

[0331]

[0332] Therefore, for the purpose of producing DNA in living cells, the sequence of the ncRNA can be modified as long as the base of the stem structure is retained. Modifications to the middle of the msd stem (about 9 to 20 bases from the base of the stem) are tolerated and do not adversely affect the reverse transcription of the ssDNA.

[0333] Reality Example 7: The center of the ncRNA msd stem region is more permissive to modification

[0334] Small modifications were made to different positions within the reverse transcription (msd) region of the retroviral-Eco1 ncRNA region and the effects of these modifications on the amount of ssDNA reverse transcribed from the different ncRNA variants were measured.

[0335] like Figures 10A to 10E As shown, the tolerance for small modifications throughout the reverse transcriptase region of the ncRNA is variable. Fig. 10B The effect of deleting three bases from different positions along the MSD complementary (stem) region is shown. As shown, deleting three bases from the middle of the MSD stem had no adverse effect and still resulted in high levels of ssDNA production ( Fig. 10B However, when three base deletions were made near the base of the complementary (stem) region or in the flanking regions of the stem, lower levels of ssDNA production were observed ( Fig. 10B ). For the three base insertions in the middle and flanking parts of the msd region ( Fig. 10C ) and single base changes ( Fig. 10D ), similar effects were observed. While the middle of the msd stem region was tolerant to insertions and / or deletions of a few nucleotides (e.g., less than 5 nucleotides) such that no significant reduction in ssDNA production was observed, such modifications of the flanking sequences at the base of the msd stem were not tolerated. Modifications of the base and flanking regions of the msd stem resulted in reduced reverse transcription of ssDNA.

[0336] Fig. 10E The diagram shows the Figures 10B to 10D The modifiability scores of positions within the msd stem region were calculated using the data in . For the purpose of producing higher levels of DNA in living cells, the sequence of the ncRNA should be modified in regions with high modifiability scores, while modifications in regions with low modifiability scores should be avoided.

[0337] Example 8: Application of engineered retrotransposons

[0338] Creating DNA on demand in cells with engineered retrotransposons enables a shift from editing the genome in living cells to writing it. This shift would allow us to modify cells therapeutically without being limited by pre-existing sequences. Currently, new DNA HDR templates must be delivered as a bolus that decreases over time. The low efficiency of this bolus delivery means that it cannot be written in situ, but rather must be written in vitro and subsequently selected and extended. Not all experiments are compatible with this strategy, and few therapeutics are compatible with it.

[0339] To realize the full potential of CRISPR-based therapeutics, the inventors provide designed DNA sequences to rewrite the genome exactly when and where needed. Fig.11A The designed sequence is shown. The efficiency of modification is improved by extending self-complementary regions at the 5' and 3' ends of the ncRNA, and the retroviral reverse transcriptase can be called to produce a large amount of the desired ssDNA therefrom.

[0340] Generating DNA on demand also enables new applications of genome engineering, the purpose of which is not a direct therapeutic agent, but to understand the biology of the disease. This is the field of molecular recording, in which the modification of the cell genome is used to write data in a living system. For a description of the method of using CRISPR integrase Cas1+2 to capture short DNA sequences in CRISPR arrays (chronologically recorded to store event records), see, for example, Shipman et al. (2017) Nature 547 (7663): 345-349, and Shipman et al. (2016) Science 353 (6298): aaf1175; it is incorporated herein by reference as a whole. This method can be used as the back end of a data acquisition device in a cell. However, it requires the front end of a DNA barcode (driven by a biological event (such as transcription)) to be generated in a cell. DNA from the source of reverse transcriptases can realize these types of technologies and enable us to understand complex biological processes in unprecedented detail.

[0341] Ultimately, taming retrotransposons expands our repertoire of molecular biotechniques for genome engineering. Retrotransposons can be designed with modular components to make arbitrary DNA sequences on demand in living cells, with implications extending broadly to scientists interested in gene therapy, cell control, and cell engineering.

[0342] References

[0343] 1 Inouye,M.&Inouye,S.msDNA and bacterial reverse transcriptase.Annual review of microbiology45,163-186,doi:10.1146 / annurev.mi.45.100191.001115(1991).

[0344] 2 Farzadfard, F. & Lu, TKSynthetic biology. Genomically encoded analogmemory with precise in vivo DNA writing in living cell populations. Science346,1256272, doi:10.1126 / science.1256272(2014).

[0345] 3 Sharon,E.et al.Functional Genetic Variants Revealed by MassivelyParallel Precise Genome Editing.Cell 175,544-557.e516,doi:10.1016 / j.cell.2018.08.057(2018).

[0346] 4 Dhundale,A.R.,Furuichi,T.,Inouye,S.&Inouye,M.Distribution ofmulticopy single-stranded DNA among myxobacteria and related species.Jourrnalof bacteriology164,914-917(1985).

[0347] 5 Lampson,B.C.et al.Reverse transcriptase in a clinical strain ofEscherichia coli:production of branched RNA-linked msDNA.Science 243,1033-1038(1989).

[0348] 6 Inouye,K.,Tanimoto,S.,Kamimoto,M.,Shimamoto,T.&Shimamoto,T.Twonovel retron elements are replaced with retron-Vc95 in Vibriocholerae.Microbiology and immumology55,510-513,doi:10.1111 / j.1348-0421.2011.00342.x(2011).

[0349] 7 Lim, D. Structure and biosynthesis of unbranched multicopy single-stranded DNA by reverse transcriptase in a clinical Escherichia coliisolate. Molecular microbiology 6, 3531-3542 (1992).

[0350] 8 Shipman, SL Nivala, J., Macklis, JD & Church, G. CRISPR-Cas encoding of a digital movie into the genomes of a population of living bacteria. Nature, doi:10.1038 / nature23017 (2017).

[0351] 9 Shipman, SL, Nivala, J., Macklis, JD & Church, GMMolecular recordings by directed CRISPR spacer acquisition. Science, doi:10.1126 / science.aaf1175 (2016).

[0352] Although the disclosure has been described with reference to some specific embodiments of the disclosure, it will be appreciated by those skilled in the art that, without departing from the true spirit and scope of the disclosure, multiple changes may be made and may be replaced with equivalents. In addition, many modifications may be made to adapt specific circumstances, materials, composition of matter, processes, one or more process steps to the purpose, spirit and scope of the disclosure. All such modifications are intended to be within the scope of the appended claims.

[0353] The following content corresponds to the original claims in the parent application and is now incorporated herein as part of the specification:

[0354] 1. An engineered reverse transcriptase comprising:

[0355] a)MSR pre-sequence;

[0356] b) msr genes encoding multiple copies of single-stranded RNA (msRNA);

[0357] c) msd gene encoding multiple copies of single-stranded DNA (msRNA);

[0358] d) a post-msd sequence comprising a self-complementary region having sequence complementarity with the pre-msr sequence, wherein the self-complementary region is 1 to 50 nucleotides longer than the wild-type complementary region, so that the engineered reverse transcriptase can enhance the production of the msDNA; and

[0359] e) The ret gene encoding reverse transcriptase.

[0360] 2. The engineered reverse transcriptase of item 1, further comprising a heterologous sequence of interest.

[0361] 3. The engineered retromer of claim 2, wherein the heterologous sequence is inserted into the msr gene or the msd gene.

[0362] 4. The engineered retromer of claim 1 , wherein the single-stranded DNA (msDNA) encoded by the msd gene comprises an msd stem-loop, and wherein the loop comprises a heterologous sequence of interest.

[0363] 5. The engineered retromer of claim 2, wherein the heterologous sequence encodes a donor polynucleotide comprising a 5' homology arm that hybridizes to a 5' target sequence and a 3' homology arm that hybridizes to a 3' target sequence, wherein the 5' homology arm and the 3' homology arm are located on the flanks of a nucleotide sequence comprising a target edit to be integrated into the target locus by homology directed repair (HDR) or recombineering.

[0364] 6. The engineered retromer of claim 2, wherein the heterologous sequence comprises a CRISPR protospacer DNA sequence.

[0365] 7. The engineered retromer of claim 6, wherein the CRISPR pre-spacer DNA sequence comprises a modified AAG pre-spacer sequence adjacent motif (PAM).

[0366] 8. The engineered reverse transcriptase described in item 1 further comprises a barcode sequence.

[0367] 9. The engineered reverse transcriptase of claim 8, wherein the barcode sequence is located in the hairpin loop of the msDNA.

[0368] 10. The engineered retromer of claim 4, wherein the msd stem is at least 14 nucleotides (base pairs) in length.

[0369] 11. The engineered reverse transcriptase of claim 4, wherein the msd stem may contain one or more mismatched nucleotides.

[0370] 12. The engineered retromer of claim 4, wherein the msd stem has fewer than five or six consecutive mismatched nucleotides.

[0371] 13. The engineered retromer of claim 4, wherein the msd stem does not have any mismatches or insertions in the sequences flanking the base of the msd stem.

[0372] 14. The engineered retromer of claim 4, wherein any msd stem mismatches or sequence changes relative to the wild-type msd sequence are in the middle of the msd stem.

[0373] 15. The engineered retromer of claim 1 , wherein the msr gene and the msd gene are provided in a trans arrangement or a cis arrangement.

[0374] 16. The engineered retromer of claim 1 , wherein the ret gene is provided in a trans arrangement relative to the msr gene and the msd gene.

[0375] 17. The engineered retromer of item 1, wherein the msr gene, msd gene and ret gene are modified bacterial retromer msr gene, msd gene and ret gene.

[0376] 18. The engineered retrotransposon of claim 1, wherein the msr gene, msd gene, and ret gene are independently a modified myxobacterial retrotransposon, a modified Escherichia coli retrotransposon, a modified Salmonella enterica retrotransposon, or a modified Vibrio cholerae retrotransposon.

[0377] 19. The engineered retromer of claim 18, wherein the modified E. coli retromer is a modified EC83 or a modified EC86.

[0378] 20. A vector system comprising one or more vectors containing the engineered retrotransposons of item 1.

[0379] 21. The vector system of claim 20, wherein the msr gene and the msd gene are provided by the same vector or different vectors.

[0380] 22. The vector system of claim 20, wherein the msr gene, the msd gene and the ret gene are provided by the same vector.

[0381] 23. The vector system of claim 22, wherein the same vector comprises a promoter operably linked to the msr gene and the msd gene.

[0382] 24. The vector system of claim 23, wherein the promoter is also operably linked to the ret gene.

[0383] 25. The vector system of claim 23, further comprising a second promoter operably linked to the ret gene.

[0384] 26. The vector system of claim 20, wherein the msr gene, the msd gene and the ret gene are provided by different vectors.

[0385] 27. The vector system of claim 20, wherein the one or more vectors are viral vectors or non-viral vectors.

[0386] 28. The vector system of claim 27, wherein the non-viral vector is a plasmid.

[0387] 29. The vector system of claim 20, wherein the engineered retromer comprises a donor polynucleotide comprising a 5' homology arm that hybridizes to a 5' target sequence and a 3' homology arm that hybridizes to a 3' target sequence, wherein the 5' homology arm and the 3' homology arm are located on either side of a nucleotide sequence comprising a target edit to be integrated at the target locus by homology directed repair (HDR) or recombineering.

[0388] 30. The vector system of claim 29, further comprising a vector encoding an RNA-guided nuclease.

[0389] 31. The vector system of claim 30, wherein the RNA-guided nuclease is a Cas nuclease or an engineered RNA-guided FokI-nuclease.

[0390] 32. The vector system of claim 31 , wherein the Cas nuclease is Cas9 or Cpf1.

[0391] 33. The vector system of claim 20, wherein the engineered retromer comprises a CRISPR pre-spacer DNA sequence.

[0392] 34. The vector system of claim 33, further comprising a vector encoding Cas1 and / or Cas2 protein.

[0393] 35. The vector system of claim 34, further comprising a vector containing a CRISPR array sequence.

[0394] 36. The vector system of claim 20, further comprising a vector encoding a bacteriophage homologous recombination protein.

[0395] 37. The vector system of claim 36, wherein the vector encoding the bacteriophage homologous recombination protein is a replication-deficient λ prophage comprising exo, bet and gam genes.

[0396] 38. An isolated host cell comprising the engineered reverse transcriptase of item 1 or the vector system of any one of item 20.

[0397] 39. The host cell of claim 38, wherein the host cell is a prokaryotic, archaeal or eukaryotic host cell.

[0398] 40. The host cell of claim 39, wherein the eukaryotic host cell is a mammalian host cell.

[0399] 41. The host cell of claim 40, wherein the mammalian host cell is a human host cell.

[0400] 42. The host cell of claim 38, wherein the host cell is an artificial cell or a genetically modified cell.

[0401] 43. A kit comprising the engineered reverse transcriptase of item 1, the vector system of item 20 or the host cell of item 38.

[0402] 44. The kit of claim 43, further comprising instructions for using the engineered retrotransposons to genetically modify cells.

[0403] 45. A method for genetically modifying a cell, comprising:

[0404] a) transfecting cells with the engineered reverse transcriptase described in item 5;

[0405] b) introducing an RNA-guided nuclease and a guide RNA into the cell, wherein the RNA-guided nuclease forms a complex with the guide RNA, the guide RNA guides the complex to a genomic target locus, wherein the RNA-guided nuclease generates a double-stranded break in the genomic DNA at the genomic target locus, and the donor polynucleotide produced by the engineered retromer is integrated at the genomic target locus recognized by its 5' homology arm and 3' homology arm through homology directed repair (HDR) to produce a genetically modified cell.

[0406] 46. ​​The method of claim 45, wherein the RNA-guided nuclease is a Cas nuclease or an engineered RNA-guided FokI-nuclease.

[0407] 47. The method of claim 45, wherein the Cas nuclease is Cas9 or Cpf1.

[0408] 48. The method of claim 45, wherein the RNA-guided nuclease is provided by a vector or a recombinant polynucleotide integrated into the genome of the cell.

[0409] 49. The method of claim 45, wherein the engineered reverse transcriptase is provided by a vector.

[0410] 50. The method of claim 45, wherein the donor polynucleotide is used to produce gene replacement, gene knockout, deletion, insertion, inversion or point mutation.

[0411] 51. A method for genetically modifying a cell by recombinant engineering, the method comprising:

[0412] a) transfecting the cell with the engineered retrotransposon of item 5; and

[0413] b) introducing a bacteriophage recombination protein into the cell, wherein the bacteriophage recombination protein mediates homologous recombination at the target locus, so that the donor polynucleotide produced by the engineered retrotransposon is integrated at the target locus recognized by its 5' homology arm and 3' homology arm to produce a genetically modified cell.

[0414] 52. The method of claim 51, wherein the donor polynucleotide is used to modify a plasmid, a bacterial artificial chromosome (BAC) or a bacterial chromosome in a bacterial cell by recombineering.

[0415] 53. The method of claim 51, wherein the donor polynucleotide can produce gene replacement, gene knockout, deletion, insertion, inversion or point mutation.

[0416] 54. The method of claim 51, wherein the introduction of the bacteriophage recombinant protein into the cell comprises inserting a replication-defective lambda prophage into the bacterial genome.

[0417] 55. The method of claim 54, wherein the bacteriophage comprises exo, bet and gam genes.

[0418] 56. A method for barcoding a cell, comprising transfecting the cell with the engineered retrotransposon of item 8.

[0419] 57. A method for producing an in vivo molecular recording system, comprising:

[0420] a) introducing the Cas1 protein or Cas2 protein of the CRISPR adaptation system into a host cell;

[0421] b) introducing a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence into the host cell, wherein the CRISPR array nucleic acid sequence is integrated into the genomic DNA or vector in the host cell; and

[0422] c) introducing a plurality of engineered retrotransposons according to item 10 or 11 into the host cell, wherein each retrotransposon comprises a different protospacer DNA sequence, which can be processed and inserted into the CRISPR array nucleic acid sequence.

[0423] 58. The method described in item 57, wherein the Cas1 protein or the Cas2 protein is provided by a vector.

[0424] 59. The method of claim 57, wherein the engineered reverse transcriptase is provided by a vector.

[0425] 60. The method of claim 57, wherein a plurality of said engineered retrotransposons comprise at least three different protospacer DNA sequences.

[0426] 61. An engineered cell comprising an in vivo molecular recording system, comprising:

[0427] a) Cas1 protein or Cas2 protein of CRISPR editing system;

[0428] b) a CRISPR array nucleic acid sequence comprising a leader sequence and at least one repeat sequence into a host cell, wherein the CRISPR array nucleic acid sequence is integrated into genomic DNA or a vector in the engineered cell; and

[0429] c) a plurality of engineered retrotransposons according to item 6, wherein each retrotransposon comprises a different protospacer DNA sequence, which can be processed and inserted into the CRISPR array nucleic acid sequence.

[0430] 62. The engineered cell of claim 61 , wherein the Cas1 protein or the Cas2 protein is provided by a vector.

[0431] 63. The engineered cell of claim 61 , wherein the engineered reverse transcriptase is provided by a vector.

[0432] 64. An engineered cell as described in claim 61, wherein multiple of the engineered retrotransposons comprise at least three different protospacer DNA sequences.

[0433] 65. A kit comprising the engineered cells of item 61 and instructions for in vivo molecular recording.

[0434] 66. A method for producing recombinant msDNA, comprising:

[0435] a) transfecting a host cell with the engineered reverse transcriptase of item 1 or the vector system of item 20; and

[0436] b) culturing the host cell under suitable conditions, wherein the msDNA is produced.

Claims

1. An engineered reverse transcriptase comprising: a)MSR pre-sequence; b) msr genes encoding multiple copies of single-stranded RNA (msRNA); c) the msd gene encoding multiple copies of single-stranded DNA (msDNA); and d) a post-msd sequence comprising a self-complementary region having sequence complementarity with the pre-msr sequence, e) the ret gene encoding reverse transcriptase, wherein the msr gene and the msd gene are provided in a trans arrangement, or wherein the ret gene is provided in a trans arrangement relative to the msr gene or the msd gene, wherein the msd gene or the msr gene comprises a heterologous sequence, The heterologous sequence encodes a donor polynucleotide comprising a 5' homology arm that hybridizes to the 5' target sequence and a 3' homology arm that hybridizes to the 3' target sequence, wherein the 5' homology arm and the 3' homology arm are located on the flanks of a nucleotide sequence comprising a desired edit to be integrated into the target locus by homology directed repair (HDR) or recombineering.

2. The engineered retromer of claim 1, wherein the ret gene is in trans relative to the msr gene and the msd gene.

3. The engineered retromer of claim 1, wherein the msr gene and the msd gene are in cis with respect to each other and in trans with respect to the ret gene.

4. The engineered retrotransposon of claim 1, wherein a cryptic termination signal is removed from the ret gene.

5. A vector system comprising one or more vectors containing the engineered retrotransposons of claim 1.

6. The vector system of claim 5, wherein the msr gene and the msd gene are provided by the same vector or different vectors.

7. The vector system of claim 5, wherein the ret gene is provided by a vector different from that of the msr gene and the msd gene.

8. The vector system of claim 5, wherein the same vector comprises a promoter operably linked to the msr gene and the msd gene.

9. The vector system of claim 8, further comprising a second promoter operably linked to the ret gene.

10. The vector system of claim 5, wherein the one or more vectors are viral vectors or non-viral vectors.

11. The vector system of claim 5, wherein the non-viral vector is a plasmid.

12. The vector system of claim 5, further comprising a vector encoding an RNA-guided nuclease.

13. The vector system of claim 12, wherein the RNA-guided nuclease is a Cas nuclease or an engineered RNA-guided FokI-nuclease.

14. The vector system of claim 13, wherein the Cas nuclease is Cas9 or Cpf1.

15. An isolated host cell comprising the engineered retrotransposon of claim 1 or the vector system of any one of claim 5.

16. The host cell of claim 15, wherein the host cell is a prokaryotic, archaeal or eukaryotic host cell.

17. A kit comprising the engineered retromer of claim 1, the vector system of claim 5 or the host cell of claim 16.

18. A method for genetically modifying a cell, comprising: a) transfecting cells with the engineered reverse transcriptase of claim 1; b) introducing an RNA-guided nuclease and a guide RNA into the cell, wherein the RNA-guided nuclease forms a complex with the guide RNA, the guide RNA guides the complex to a genomic target locus, wherein the RNA-guided nuclease generates a double-stranded break in the genomic DNA at the genomic target locus, and the donor polynucleotide produced by the engineered retromer is integrated at the genomic target locus recognized by its 5' homology arm and 3' homology arm through homology directed repair (HDR) to produce a genetically modified cell.

19. A method for producing recombinant msDNA, comprising: a) transfecting a host cell with the engineered retrotransposon of claim 1 or the vector system of claim 5; as well as b) culturing the host cell under suitable conditions, wherein the msDNA is produced.

Images