SgRNA targeting human tRNA-iMet gene and application thereof

Abstract

The invention relates to the technical field of biotechnology and gene editing, in particular to sgRNA of a targeted human tRNA-iMet gene and application of the sgRNA. The sgRNA sequence is a nucleotide sequence as shown in any one of SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO. 7. The nucleic acid composition provided by the invention can cut the human tRNA-iMet gene in a targeted manner, so that the proliferation, migration and invasion abilities of various cancer cells are inhibited.

Description

Technical Field

[0001] The present application relates to the technical fields of biotechnology and gene editing, and in particular to a sgRNA targeting the human tRNA-iMet gene and its application. Background Art

[0002] The CRISPR / Cas system is a natural immune system of prokaryotes, present in most bacteria and archaea. When viruses or other foreign species invade prokaryotes, they will intercept a DNA sequence of the invading organism and store it in their own genes. The next time a species with the same DNA sequence invades the prokaryote, the prokaryote will produce a corresponding single-stranded guide RNA (sgRNA) that binds to the cas9 protein, targets the DNA sequence released by the invading organism, cuts it, and prevents it from further invading, thereby protecting itself. Summary of the invention

[0003] The present application provides a nucleic acid composition for inhibiting tRNA-iMet and its application. The nucleic acid composition can target and cleave the human tRNA-iMet gene, thereby inhibiting the proliferation, migration and invasion of various cancer cells.

[0004] The CRISPR / Cas gene editing system involved in the present application can guide the cas9 protein to bind to the tRNA-iMet gene using the sgRNA of the present application, and cut the 3' of the gene, resulting in incompleteness of the gene, thereby inhibiting the life activities of various cancer cells, including but not limited to: cell growth, migration and invasion.

[0005] In the first aspect, the present application provides a sgRNA targeting the human tRNA-iMet gene, using the following technical solution:

[0006] A sgRNA targeting the human tRNA-iMet gene, wherein the sgRNA sequence is the nucleic acid sequence shown in any one of SEQ ID NO.3, SEQ ID NO.5, and SEQ ID NO.7.

[0007] In a second aspect, the present application provides a composition targeting the human tRNA-iMet gene, using the following technical solution:

[0008] A composition targeting the human tRNA-iMet gene, the composition comprising any one or more of the above-mentioned sgRNAs.

[0009] Optionally, CRISPR-cas9 protein is also included.

[0010] Optionally, CRISPR-cas9 mRNA is also included.

[0011] Optionally, a CRISPR-cas9 gene is also included.

[0012] sgRNA is a single-stranded RNA that can bind to the cas9 protein and guide the cas9 protein to bind to the tRNA-iMet gene. The composition can inhibit the migration activity of various cancer cells in cells by targeted cutting of the 3' end of the human tRNA-iMet gene. At the same time, the composition can also inhibit the invasion activity of various cancer cells in cells by targeted cutting of the 3' end of the human tRNA-iMet gene. In addition, the composition can also inhibit the proliferation activity of various cancer cells in cells by targeted cutting of the 3' end of the human tRNA-iMet gene.

[0013] In a third aspect, the present application provides a use of the above-mentioned sgRNA or composition in the preparation of an anti-tumor drug.

[0014] In summary, the present application includes at least one of the following beneficial technical effects:

[0015] The nucleic acid composition provided in the present application can inhibit the transcription of the human tRNA-iMet start codon, thereby targeting the 3' end of the human tRNA-iMet gene, thereby inhibiting the proliferation, migration and invasion ability of various cancer cells.

[0016] The CRISPR / Cas gene editing system involved in the present application can guide the cas9 protein to bind to the tRNA-iMet gene using the sgRNA of the present application, and cut the 3' of the gene, resulting in incompleteness of the gene, thereby inhibiting the life activities of various cancer cells, including but not limited to: cell growth, migration and invasion.

[0017] The sgRNA in the nucleic acid composition of the present application can guide the cas9 protein to specifically bind to the tRNA-iMet start codon gene, and in various cancer cells, the cas9 protein can be guided to cut the 3' end of the tRNA-iMet start codon gene and cut it, thereby affecting the transcription level of the gene and inhibiting cell proliferation, migration and invasion activities. The anti-tumor drug prepared using the nucleic acid composition disclosed in the present application can effectively treat various tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The test results of migration ability.

[0019] Figure 2 The test results of invasive ability.

[0020] Figure 3 The results of the cloning ability test. DETAILED DESCRIPTION

[0021] Before describing the embodiments of the present application in detail, it should be understood that the terms used herein are only used for the purpose of describing specific embodiments. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by ordinary technicians in the field to which the terms belong.

[0022] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of this application, unless otherwise specified, the meaning of "plurality" is two or more.

[0023] The endpoints and any values ​​of the ranges disclosed in this application are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0024] In the present application, the terms "comprise" or "include" are open expressions, that is, including the contents specified in the present application but not excluding other contents.

[0025] A sgRNA targeting the human tRNA-iMet gene, wherein the sgRNA sequence is the nucleic acid sequence shown in any one of SEQ ID NO.3, SEQ ID NO.5, and SEQ ID NO.7.

[0026] The present application provides a nucleic acid composition for inhibiting tRNA-iMet. The nucleic acid composition comprises sgRNA targeting the human tRNA-iMet gene.

[0027] Among them, sgRNA includes four different sgRNA sequences, specifically:

[0028] The sgRNA-NC sense strand nucleic acid sequence of the blank control is the nucleic acid sequence shown in SEQ ID NO.1, specifically: GGTTCTCCGAACGTGTCACGT;

[0029] The sgRNA-NC antisense strand nucleic acid sequence of the blank control is the nucleic acid sequence shown in SEQ ID NO.2, specifically: CCAAGAGGCTTGCACAGTGCA;

[0030] The sgRNA-5' sense strand nucleic acid sequence is the nucleic acid sequence shown in SEQ ID NO.3, specifically: GTGGCGCAGCGGAAGCGTGC;

[0031] The sgRNA-5' antisense strand nucleic acid sequence is the nucleic acid sequence shown in SEQ ID NO.4, specifically: CACCGCGTCGCCTTCGCACG;

[0032] The sgRNA-3' sense strand nucleic acid sequence is the nucleic acid sequence shown in SEQ ID NO.5, specifically: GCCCATAACCCAGAGGTCGA;

[0033] The nucleic acid sequence of the sgRNA-3' antisense strand is the nucleic acid sequence shown in SEQ ID NO.6, specifically: CGGGTATTGGGTCTCCAGCT;

[0034] The sgRNA-center positive strand nucleic acid sequence is the nucleic acid sequence shown in SEQ ID NO.7, specifically: AAGCGTGCTGGGCCCATAACCCAG;

[0035] The sgRNA-center antisense strand nucleic acid sequence is the nucleic acid sequence shown in SEQ ID NO.8, specifically: TTCGCACGACCCGGGTATTGGGTC.

[0036] The above-mentioned sgRNA nucleotides can all be modified by cholesterol to enable sgRNA to pass through the cell membrane and obtain higher transfection efficiency, or by thio and methoxy modifications to enable sgRNA to obtain higher stability and be less likely to be bound and degraded by RNase.

[0037] The above-mentioned sgRNA nucleic acid sequence and cas9 protein CDS sequence are integrated into the same lentiviral expression vector plasmid (lentiCRISPR v2) and carry a drug resistance (including: hygromycin B, G418 and puromycin), which is used to screen cells after virus infection to obtain a successfully infected cell population.

[0038] In order to make the purpose, technical scheme and advantages of the present application clearer, the technical scheme in the embodiments of the present application will be clearly and completely described below. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without making creative work belong to the scope of protection of the present application. The embodiments described below are exemplary and are only used to explain the present application, and cannot be interpreted as limiting the present application.

[0039] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0040] The present application is further described in detail below in conjunction with the embodiments and test results.

[0041] Example

[0042] In this example, the nucleic acid composition for inhibiting human tRNA-iMet provided in the present application is used to infect cells and perform drug screening.

[0043] The above-mentioned process of infected cells and drug screening is as follows:

[0044] (1) Plasmids carrying different sgRNA sequences and drug resistance sequences were synthesized by Qingke Biotechnology and transformed into Escherichia coli (Stbl3); the plasmid used was a lentiviral plasmid vector, including co-expression of sgRNA, cas9 and drug resistance gene;

[0045] (2) Extract the plasmid in step (1) using the plasmid extraction kit (D3146-03) of Meiji Biotechnology;

[0046] (3) packaging the plasmid extracted in step (2) into viral particles using the Lentiviral Packaging Kit (41102ES20) of Yisheng Biotechnology;

[0047] (4) adding the packaged virus particles into the lung cancer cells H1299 to be infected by the virus;

[0048] (5) Cells and viruses were co-cultured for 3 days;

[0049] (6) After 3 days, the corresponding drugs were added to treat the cells, wherein the drug corresponding to sgRNA-5' and its concentration range were G418, 200-400 μg / ml; the drug corresponding to sgRNA-3' and its concentration were hygromycin B, 12.5-50 μg / ml; the drug corresponding to sgRNA-center and its concentration were puromycin, 1-3 μg / ml; in this embodiment, the G418 used was 300 μg / ml; the hygromycin B used was 30 μg / ml; and the puromycin used was 2 μg / ml.

[0050] (7) After the cells are cultured in the corresponding drug-containing culture medium for 1 month, a cell population that is successfully infected with the virus is screened and used for subsequent migration, invasion, and cloning experiments.

[0051] Detection test

[0052] The cell populations obtained above were used to perform migration experiments, invasion experiments and cloning experiments.

[0053] (I) Migration experiment

[0054] The specific steps of the migration experiment are as follows:

[0055] (1) Removing cell culture medium;

[0056] (2) Rinse with PBS three times;

[0057] (3) Digestion of cells using trypsin;

[0058] (4) Terminate the digestion with DMEM medium containing 10% fetal bovine serum (FBS) and resuspend the cells by pipetting;

[0059] (5) Remove the culture medium by centrifugation, resuspend the cells in DMEM and count them;

[0060] (6) Add 600 μl of DMEM medium containing 10% FBS to a 24-well plate, place the chamber into the well, and add 100 μl of DMEM;

[0061] (7) Based on the counting results of step (5), the cell suspension was diluted to 5×10 5 cells / ml, add the diluted cell suspension into the chamber according to 100,000 cells / chamber, and culture for 12h;

[0062] (8) Remove the chamber and rinse once with PBS;

[0063] (9) Fix with anhydrous methanol for 15 min;

[0064] (10) Use 0.2% crystal violet to stain for 15 min;

[0065] (11) Rinse the chamber with tap water and remove the cells on the inner surface of the chamber, leaving only the cells on the outer surface of the chamber, which are the cells that have successfully migrated;

[0066] (12) Use a dissecting microscope to photograph the chamber after processing in step (11).

[0067] Test results such as Figure 1 shown.

[0068] Depend on Figure 1 It can be seen that only the migration ability of H1299 infected with the sgRNA-3' virus was greatly inhibited, while the other two showed no obvious changes.

[0069] (II) Invasion assay

[0070] (1) Removing cell culture medium;

[0071] (2) Rinse with PBS three times;

[0072] (3) Digestion of cells using trypsin;

[0073] (4) Terminate the digestion with DMEM medium containing 10% fetal bovine serum (FBS) and resuspend the cells by pipetting;

[0074] (5) Remove the culture medium by centrifugation, resuspend the cells in DMEM and count them;

[0075] (6) Add 600 μl of DMEM medium containing 10% FBS to a 24-well plate, place the chamber into the well, and add 100 μl of DMEM containing 5% Matrigel component;

[0076] (7) Based on the counting results of step (5), the cell suspension was diluted to 5×10 5 cells / ml, according to 100,000 cells / chamber, the diluted cell suspension was added into the chamber and cultured for 12h;

[0077] (8) Remove the chamber and rinse once with PBS;

[0078] (9) Fix with anhydrous methanol for 15 min;

[0079] (10) Use 0.2% crystal violet to stain for 15 min;

[0080] (11) Rinse the chamber with tap water and remove the cells on the inner surface of the chamber, leaving only the cells on the outer surface of the chamber, which are the cells that have successfully invaded;

[0081] (12) Use a dissecting microscope to photograph the chamber after processing in step (11).

[0082] Test results such as Figure 2 shown.

[0083] Depend on Figure 2 It can be seen that only the invasive ability of H1299 infected with the sgRNA-3' virus was greatly inhibited, while the other two showed no obvious changes.

[0084] (III) Cloning experiment

[0085] Colony formation assay

[0086] (1) Removing cell culture medium;

[0087] (2) Rinse with PBS three times;

[0088] (3) Digestion of cells using trypsin;

[0089] (4) Terminate the digestion with DMEM medium containing 10% fetal bovine serum (FBS) and resuspend the cells by pipetting;

[0090] (5) diluting the cell suspension in step (4) to obtain a cell suspension with a cell concentration of 250 cells / ml;

[0091] (6) Inoculate the cell suspension from step (5) into a six-well plate at a volume of 2 ml / well;

[0092] (7) After 7 days of culture, change the medium;

[0093] (8) After another 7 days of culture, remove the culture medium and rinse once with 2 ml of PBS;

[0094] (9) Fix with 2 ml of anhydrous methanol for 15 min;

[0095] (10) Stain with 2 ml of 0.2% crystal violet for 15 min;

[0096] (11) Rinse twice with 2 ml of tap water;

[0097] (12) Use a scanning device to scan the growth status of the cells in the wells.

[0098] Test results such as Figure 3 shown.

[0099] Depend on Figure 3 It can be seen that the three different knockout positions can inhibit the formation of cell clones.

[0100] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example" or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0101] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A sgRNA targeting human tRNA-iMet gene, characterized in that: The sgRNA sequence is a nucleic acid sequence shown in any one of SEQ ID NO.3, SEQ ID NO.5, and SEQ ID NO.

7.

2. A composition targeting human tRNA-iMet gene, characterized in that: The composition comprises any one or more of the sgRNAs described in claim 1.

3. The composition according to claim 2, characterized in that: Also included is the CRISPR-cas9 protein.

4. The composition according to claim 3, characterized in that: CRISPR-cas9 mRNA is also included.

5. The composition according to claim 3, characterized in that: Also included is the CRISPR-cas9 gene.

6. Use of the sgRNA according to claim 1 or the composition according to any one of claims 2 to 5 in the preparation of an anti-tumor drug.

Images