Dicotyledonous plant gene editing expression vector based on CRISPR / Cas system

Abstract

The invention relates to a dicotyledon gene editing expression vector based on a CRISPR / Cas system. The dicotyledonous plant gene editing expression vector comprises a dicotyledonous plant gene editing The Cas9 nuclease expression cassette and the sgRNA expression cassette are independent; the sgRNA expression cassette contains the sgRNA sequence disclosed by the invention; and the Cas9 nuclease is a variant MiCas9. The vector disclosed by the invention can reduce the harmful influence of insertion of an exogenous gene on a plant, quickly and intuitively eliminate interference, and improve the transgenosis efficiency.

Description

Technical Field

[0001] The present disclosure relates to the technical field of plant genetic engineering, and in particular to a dicotyledonous plant gene editing expression vector based on the CRISPR / Cas system. Background Art

[0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a double-stranded DNA endonuclease tool mediated by RNA sequences, widely present in the genomes of bacteria and archaea, and is an integral part of their immune system. CRISPR functions as a prokaryotic immune system, conferring resistance to foreign genetic elements such as plasmids and bacteriophages. The CRISPR system provides a form of acquired immunity. Short fragments of foreign DNA (called spacers) are integrated into the genome between CRISPR repeats as a memory of past exposure. The CRISPR spacers are then used to recognize and silence foreign genetic elements in a manner similar to RNAi in eukaryotes. It is mainly composed of two parts, one of which is a sgRNA of about 100bp, which is used to target and recognize the double-stranded DNA of the target, and the other part is a Cas9 protein of 1369 amino acids, which can bind to the sgRNA and has DNA enzyme activity. The artificially designed sgRNA and Cas9 protein form a complex that can specifically cut the target DNA. When the cutting causes mismatch repair, it causes gene frameshift and achieves the purpose of knockout. When a repair DNA sequence is added, a purposeful editing will be performed. Common delivery vectors for CRISPR-Cas9 gene knockout include: plasmids, lentiviruses, mRNA, RNP, AAV, etc., but various delivery vectors have many limitations, such as plasmids and lentiviruses will be expressed for a long time, increasing the probability of off-target; AAV packaging is complex and inefficient. Among them, the problem of high toxicity and inability to achieve degradability in the body is particularly prominent. Summary of the invention

[0003] The following is a summary of the subject matter described in detail herein. This summary is not intended to limit the scope of the claims.

[0004] At present, most of the research is on monocotyledonous plants such as rice and wheat. Due to the low efficiency of genetic transformation, dicotyledonous plants have relatively few studies and are more difficult. As an important food crop in my country, soybeans have great significance for studying gene functions and improving agronomic traits through the emerging gene editing technology CRISPR / Cas9 in recent years.

[0005] The present disclosure provides a dicotyledonous plant gene editing expression vector based on the CRISPR / Cas system. The vector provided by the present disclosure can solve the problem of difficulty in gene function research and agronomic trait improvement caused by low genetic transformation efficiency and low editing efficiency in soybean.

[0006] The disclosed embodiments provide a dicotyledonous plant gene editing sgRNA site based on the CRISPR / Cas system, wherein the sgRNA site is located in the phytoene dehydrogenase PDS gene on the dicotyledonous plant genome; the sgRNA site comprises a dicotyledonous plant genome sequence complementary to the sgRNA sequence; wherein the sgRNA sequence comprises a sequence having at least 70% identity with the sequence shown in SEQ ID No.1 or SEQ ID No.2.

[0007] The disclosed embodiment provides a dicotyledonous plant gene editing expression vector based on the CRISPR / Cas system, comprising: an independent Cas9 nuclease expression cassette and an sgRNA expression cassette; the sgRNA expression cassette comprises the sgRNA sequence of claim 1.

[0008] In some exemplary embodiments, the Cas9 nuclease is a variant MiCas9.

[0009] The variant MiCas9 was designed based on Linyuan Ma et al., “MiCas9 increases large size gene knock-in rates and reduces undesirable on-target and off-target indeledits”, NATURE COMMUNICATION, (2020) 11: 6082, and synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0010] In some exemplary embodiments, the Cas9 nuclease and the sgRNA are expressed separately and simultaneously.

[0011] In some exemplary embodiments, the number of the sgRNA expression cassettes is 1 to 10; preferably 1 to 9; preferably 1 to 8; preferably 1 to 7; preferably 1 to 6; preferably 1 to 5; preferably 1 to 4; preferably 1 to 3; preferably 1 to 2; preferably 1.

[0012] In some exemplary embodiments, the vector further comprises a GUS element located upstream of the Cas9 nuclease.

[0013] In some exemplary embodiments, the vector has the following structure: first promoter-enhancer-GUS-MiCas9-3×NLS-tHSP-second promoter-tRNA1-sgRNA-sgRNAscaffold-tRNA2-2×35S-ZsGreen-HYG-tNOS.

[0014] 3×NLS means 3 NLS sequences.

[0015] In some exemplary embodiments, the first promoter comprises pRBCS; the enhancer comprises an endogenous enhancer of soybean; and the second promoter comprises AtU6.

[0016] In some exemplary embodiments, the sequence of the first promoter is shown in SEQ ID No.3; the sequence of the enhancer is shown in SEQ ID No.4; the sequence of the GUS is shown in SEQ ID No.5; the sequence of the MiCas9 is shown in SEQ ID No.6; the sequence of the 3×NLS-tHSP is shown in SEQ ID No.7; the sequence of the AtU6 is shown in SEQ ID No.8; the tRNA1 sequence is shown in SEQ ID No.9; the sequence of the sgRNA is shown in SEQ ID No.1 or SEQ ID No.2; the sequence of the sgRNAscaffold is shown in SEQ ID No.10; the sequence of the tRNA2 is shown in SEQ ID No.11; the sequence of the 2×35S is shown in SEQ ID No.12; the sequence of the ZsGreen is shown in SEQ ID No.13; the sequence of the HYG-tNOS is shown in SEQ ID No.14.

[0017] In some exemplary embodiments, the sequence of the sgRNA comprises a sequence that is at least 70% identical to the sequence shown in SEQ ID No. 1 or SEQ ID No. 2; preferably at least 71% identical to the sequence; preferably at least 72% identical to the sequence; preferably at least 73% identical to the sequence; preferably at least 74% identical to the sequence; preferably at least 75% identical to the sequence; preferably at least 76% identical to the sequence; preferably at least 77% identical to the sequence; preferably at least 78% identical to the sequence; preferably at least 79% identical to the sequence; preferably at least 80% identical to the sequence; preferably at least 81% identical to the sequence; preferably at least 82% identical to the sequence; preferably at least 83% identical to the sequence; preferably at least 84% identical to the sequence; preferably At least 85% identical sequences; preferably at least 86% identical sequences; preferably at least 87% identical sequences; preferably at least 88% identical sequences; preferably at least 89% identical sequences; preferably at least 90% identical sequences; preferably at least 91% identical sequences; preferably at least 92% identical sequences; preferably at least 93% identical sequences; preferably at least 94% identical sequences; preferably at least 95% identical sequences; preferably at least 96% identical sequences; preferably at least 97% identical sequences; preferably at least 98% identical sequences; preferably at least 99% identical sequences; preferably 100% identical sequences.

[0018] "Percent identity" and "% identity" refer to the extent to which two sequences (nucleotides or amino acids) have identical residues at identical positions in an alignment. For example, "an amino acid sequence is X% identical to SEQ ID NO: Y" refers to the % identity of an amino acid sequence to SEQ ID NO: Y and is specified as X% of the residues in the amino acid sequence being identical to the residues in the sequence disclosed in SEQ ID NO: Y. Typically, such calculations are performed using computer programs. Exemplary programs for comparing and aligning sequence pairs include ALIGN (Myers and Miller, Comput Appl Biosci. 1988 Mar; 4(1): 11-7), FASTA (Pearson and Lipman, Proc Natl Acad Sci USA. 1988 Apr; 85(8): 2444-8; Pearson, Methods Enzymol. 1990; 183: 63-98), and Gapped BLAST (Altschul et al., Nucleic Acids Res. 1997 Sep 1; 25(17): 3389-40), BLASTP, BLASTN, or GCG (Devereux et al., Nucleic Acids Res. 1984 Jan 11; 12(1 Pt 1): 387-95).

[0019] The disclosed embodiments provide a dicotyledonous plant gene editing method based on the CRISPR / Cas system, wherein the dicotyledonous plant gene editing method includes using the above-mentioned dicotyledonous plant gene editing expression vector.

[0020] In some exemplary embodiments, the dicotyledonous plant gene editing method comprises the following steps: using rhizogenes containing the above-mentioned dicotyledonous plant gene editing expression vector to infect the plant's vegetative body, and then culturing until the vegetative body sprouts transgenic hairy roots, and the CRISPR / Cas system of the dicotyledonous plant gene editing expression vector edits the dicotyledonous plant genome.

[0021] In some exemplary embodiments, the dicotyledonous plant includes soybean.

[0022] Compared with the prior art, this application has the following advantages:

[0023] 1. The vector disclosed in the present invention adopts a dual-unit construction strategy, that is, the Cas9 nuclease and sgRNA are expressed separately using different promoters, thereby achieving an increase in the expression levels of the two elements;

[0024] 2. Wild-type spCas9 has some limiting factors, such as a single PAM site and high off-target effects. The present disclosure uses a variant of wild-type spCas9, MiCas9, which can effectively improve the efficiency of large-fragment knock-in and reduce off-target efficiency;

[0025] 3. The present invention introduces an endogenous enhancer of soybean into the expression module of MiCas9, which can further improve the expression level of MiCas9 and thus improve the efficiency of transgenic engineering;

[0026] 4. The vector disclosed in the present invention drives Cas9 with the tissue-specific expression promoter RBCS and drives sgRNA with the type III promoter. The two are expressed separately and simultaneously, which can reduce the harmful effects of the insertion of exogenous genes on the plant itself and facilitate the analysis of experimental results;

[0027] 5. The vector disclosed in the present invention can directly screen tissues or plants carrying the selection marker using the selection marker HYG, which can quickly and intuitively eliminate interference and improve transgenic efficiency;

[0028] 6. The vector structure disclosed in the present invention can achieve simultaneous knockout of up to 10 different gene loci, and can be expected to achieve a multiplex knockout effect.

[0029] Other aspects will be apparent upon reading and understanding the drawings and detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings are used to provide a further understanding of the technical solution of the present disclosure and constitute a part of the specification. Together with the embodiments of the present disclosure, they are used to explain the technical solution of the present disclosure and do not constitute a limitation on the technical solution of the present disclosure. The shape and size of one or more modules in the accompanying drawings do not reflect the actual proportions and are only intended to illustrate the contents of the present disclosure.

[0031] Figure 1 An exemplary carrier structure of the present disclosure is shown.

[0032] Figure 2 Protoplast transformation results and hairy root results for exemplary vectors of the present disclosure and controls are shown.

[0033] Figure 3 Stable transformation results for exemplary vectors of the present disclosure are shown.

[0034] Figure 4 The transformation positive rate results of exemplary vectors of the present disclosure and controls are shown.

[0035] Figure 5 The hairy root mutant sequence analysis and the stable plant mutant sequence analysis of the first editing site of the exemplary vector of the present disclosure are shown.

[0036] Figure 6 The hairy root mutant sequence analysis and the stable plant mutant sequence analysis of the second editing site of the exemplary vector of the present disclosure are shown. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical solution and advantages of the present disclosure more clear, the embodiments of the present disclosure will be described in detail below. It should be noted that the embodiments and features in the embodiments of the present disclosure can be combined with each other arbitrarily without conflict.

[0038] The embodiments of the present disclosure will be described in detail below in conjunction with the accompanying drawings. The embodiments can be implemented in a plurality of different forms. A person skilled in the art can easily understand the fact that the method and content can be transformed into one or more forms without departing from the purpose and scope of the present disclosure. Therefore, the present disclosure should not be interpreted as being limited to the contents described in the following embodiments. In the absence of conflict, the embodiments in the present disclosure and the features in the embodiments can be combined with each other arbitrarily.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those of ordinary skill in the art to which the present disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used to practice or test the present disclosure, preferred methods and materials are described. For purposes of the present disclosure, the following terms are defined hereinafter.

[0040] In this application, the use of the singular includes the plural unless expressly stated otherwise. It must be noted that, as used in this specification, the singular forms "a", "an", and "the" include plural references unless the context clearly indicates otherwise. In this application, the use of "or" means "and / or" unless otherwise stated.

[0041] The term "about" or "approximately" means within an acceptable error range of a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation according to the practice in the art. Alternatively, "about" can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a particular value. In other examples, an amount of "about 10" includes 10 and any amount from 9 to 11.

[0042] In yet other examples, the term "about" in reference to a reference value may also include a range of values ​​that are plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of that value. Alternatively, particularly with respect to biological systems or processes, the term "about" may mean within an order of magnitude of a value. When describing a particular value in the application and claims, unless otherwise indicated, the term "about" should be assumed to mean within an acceptable error range for the particular value.

[0043] As used in this specification and in one or more claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of "containing", such as "contains" and "contain") are inclusive or open-ended, and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with reference to any method or combination of the present disclosure, and vice versa. In addition, combinations of the present disclosure can be used to implement methods of the present disclosure.

[0044] "Genome" when applied to eukaryotic cells encompasses not only the chromosomal DNA present in the nucleus, but also the organellar DNA present in subcellular components of the cell (eg, mitochondria, plastids).

[0045] "Exogenous" with respect to a sequence refers to a sequence that is from a foreign species, or, if from the same species, a sequence that has been significantly altered in composition and / or locus from its native form through deliberate human intervention.

[0046] "Polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers that optionally may contain synthetic, non-natural or altered nucleotide bases. Nucleotides are referred to by their single letter names as follows: "A" is adenosine or deoxyadenosine (RNA or DNA, respectively), "C" represents cytidine or deoxycytidine, "G" represents guanosine or deoxyguanosine, "U" represents uridine, "T" represents deoxythymidine, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "I" represents inosine, and "N" represents any nucleotide.

[0047] "Gene editing", also known as genome editing, uses engineered nucleases or "molecular scissors" to insert, delete or replace DNA in the genome of an organism. Gene editing causes site-specific double-strand breaks (DSBs) at the desired location in the genome, and then introduces the desired DNA insertion, deletion or substitution during the repair of DSBs. Gene editing typically uses meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR systems.

[0048] "Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)" are prokaryotic DNA segments containing short, repetitive sequences. The CRISPR system is a prokaryotic immune system that confers resistance to foreign genetic elements, such as those present in plasmids and bacteriophages, which provides acquired immunity. In this system, Cas proteins or similar proteins cut foreign nucleic acids under the guidance of RNA.

[0049] As used herein, the term "CRISPR nuclease" generally refers to a nuclease present in a naturally occurring CRISPR system, as well as a modified form thereof, a variant thereof (including a nickase mutant), or a catalytically active fragment thereof. CRISPR nucleases can interact with guide RNAs (e.g., crRNA and optional tracrRNA or artificial gRNAs (e.g., sgRNA)) to recognize and / or cut target nucleic acid structures. The term encompasses any nuclease that can achieve gene editing in cells based on a CRISPR system.

[0050] CRISPR-Cas9: Clustered Regularly Interspaced Short PalindromicRepeats-CRISPR-associated9, referred to as CRISPR-Cas9, is widely present in the genomes of bacteria and archaea and is part of their immune system. The system consists of the CRISPR array and the Cas gene family, in which the CRISPR array is composed of highly conserved repeat sequences and spacer sequences arranged at intervals, with a leader sequence responsible for its transcription upstream; the Cas gene family is the CRISPR-associated protein gene, which is highly conserved and encodes Cas proteins with domains that can cut double-stranded DNA. In the CRISPR array, the palindromic structure contained in the repeat sequence can form a conserved RNA secondary structure, which can bind to the Cas protein to form a complex and work together.

[0051] "Guide RNA" and "gRNA" are used interchangeably herein, and are generally composed of crRNA and tracrRNA molecules that are partially complementary to form a complex, wherein the crRNA comprises a sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the CRISPR complex (Cas9+crRNA+tracrRNA) to bind to the target sequence in a sequence-specific manner. However, it is known in the art that a single guide RNA (sgRNA) can be designed that contains features of both crRNA and tracrRNA.

[0052] Details

[0053] CRISPR / Cas system

[0054] The CRISPR / Cas system is a nuclease system composed of clustered regularly spaced short palindromic repeats (CRISPR) and CRISPR binding proteins (i.e., Cas proteins), which can cut almost all genomic sequences adjacent to the protospacer-adjacent motif (PAM) in eukaryotic cells (Cong et al. Science 2013.339: 819-823). "CRISPR / Cas system" is used to collectively refer to transcripts related to CRISPR-related ("Cas") genes, as well as other elements related to their expression or instructing their activity. In general, the CRISPR system is characterized by elements that promote the formation of CRISPR complexes at the site of the target sequence (also known as the protospacer in the endogenous CRISPR system).

[0055] Formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs of) the target sequence. The tracr sequence (which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence)) can also form part of a CRISPR complex, such as by hybridizing along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence operably linked to the guide sequence.

[0056] Non-limiting examples of Cas proteins include: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cas12a (also known as Cpf1), Cas12b, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa 5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified forms thereof. In some embodiments, the Cas protein is a Cas12a protein.

[0057] Guide RNA

[0058] In one aspect, the RNA component contained in CRISPR is sometimes referred to as a guide RNA (gRNA). The guide RNA generally comprises a guide sequence and a backbone sequence, and these two sequences can be in the same molecule or in different molecules.

[0059] This application discloses a CRISPR / Cas9 editing vector for dicotyledonous plants. The genetic transformation efficiency of dicotyledonous plants such as soybean is low, which makes its editing efficiency low, making it difficult to study its gene function and improve its traits. The CRISPR / Cas9 editing vector established in this application adopts a dual-unit construction strategy, that is, the Cas9 nuclease and sgRNA are expressed separately using different promoters (see Figure 1The specific structure is the first promoter-enhancer-GUS-MiCas9-3×NLS-tHSP-second promoter-tRNA1-sgRNA-sgRNAscaffold-tRNA2-2×35S-ZsGreen-HYG-tNOS), thereby achieving the improvement of the expression level of the two elements; the wild-type spCas9 has some limiting factors, such as a single PAM site and high off-target effect. This application uses a variant of the wild-type spCas9, MiCas9, which can effectively improve the efficiency of large fragment knock-in and reduce off-target effects. Efficiency; the present application introduces an endogenous enhancer of soybean into the expression module of MiCas9, which can further improve the expression level of MiCas9, thereby improving the efficiency of transgenic engineering; the tissue-specific expression promoter RBCS drives MiCas9, and the type III promoter (AtU6) drives sgRNA, and both are expressed separately at the same time, which can reduce the harmful effects of the insertion of exogenous genes on the plant itself and facilitate the analysis of experimental results; the screening marker HYG can be used to directly screen tissues or plants carrying the selection marker, which can quickly and intuitively eliminate interference and improve the efficiency of transgenic engineering.

[0060] abbreviation

[0061] NLS: Nuclear localization sequence, nuclear localization sequence

[0062] tHSP:heat shock protein terminator

[0063] AtU6: Arabidopsis thaliana U6, Arabidopsis U6 promoter

[0064] HYG: Hygromycin, a selection marker

[0065] tNOS: nopaline synthase terminator

[0066] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples, but it should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, the modification or replacement of the method, steps or conditions of the present invention all belong to the scope of the present invention. The experimental methods and reagents without specifying the specific conditions in the examples are all in accordance with the conventional conditions in the art.

[0067] Embodiment 1

[0068] 1. Construction of gene editing vector and transformation of Agrobacterium rhizogenes

[0069] 1.1 Target gene sgRNA design

[0070] For the phytoene dehydrogenase (PDS) gene, SnapGene software was used to pull out qualified primer sequences in the first third of the exon according to primer design rules.

[0071] Table 1 sgRNA sequences

[0072] Target gene sgRNA sequence PDS (first point) AGAACAACGAAATGCTTACT(SEQ ID No.1) PDS (second site) GTGCATTTCTACCGGGCACGA(SEQ ID No.2)

[0073] 1.2 Construction of dual-unit CRISPR / Cas9 gene editing vector

[0074] After designing the various elements of the vector, the corresponding sequences were sent to Shanghai Sangon Biotechnology Co., Ltd. for synthesis.

[0075] The double-unit CRISPR / Cas9 editing vector structure of this application is as follows:

[0076] pRBCS-Enhancer-GUS-MiCas9-tHSP-AtU6-tRNA1-sgRNA-sgRNAscaffold-tRNA2-2×35S-ZsGreen-HYG-tNOS (see Figure 1 ). The enhancer in this structure is the soybean endogenous enhancer. The tHSP is 3×NLS-tHSP.

[0077] The first promoter pRBCS sequence is shown in SEQ ID No.3.

[0078] The enhancer sequence is shown in SEQ ID No.4.

[0079] The GUS sequence is shown in SEQ ID No.5.

[0080] The GUS gene is the β-glucuronidase gene (β-glucuronidase). The gene product is β-glucuronidase, which belongs to the hydrolase class, is quite stable and not easily degraded. Because its determination method is simple and convenient, Gus staining is a commonly used method to detect gene expression in different time and tissue regions. It can detect gene expression in various tissue parts in the early stage of plant development and is used to evaluate the expression of transgenic plants.

[0081] The MiCas9 sequence is shown in SEQ ID No.6.

[0082] The 3×NLS-tHSP sequence is shown in SEQ ID No.7.

[0083] The sequence of the second promoter AtU6 is shown in SEQ ID No.8.

[0084] The tRNA1 sequence is shown in SEQ ID No.9.

[0085] tRNA can connect multiple sgRNAs to form a polycistronic gene, which can then be combined with the CRISPR / Cas9 expression vector to form a polycistronic tRNA-sgRNA / Cas9 (PTG / Cas9) system to perform gene editing on multiple targets.

[0086] The sgRNA sequence is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0087] The sgRNA scaffold sequence is shown in SEQ ID No.10.

[0088] The tRNA2 sequence is shown in SEQ ID No.11.

[0089] The 2×35S sequence is shown in SEQ ID No.12.

[0090] The ZsGreen sequence is shown in SEQ ID No.13.

[0091] The HYG-tNOS sequence is shown in SEQ ID No.14.

[0092] 1.3 Seed sterilization and germination

[0093] Seeds should be disinfected before germination to reduce contamination by foreign bacteria. Select smooth, plump and unscathed soybean seeds and transfer them to a 50mL sterile centrifuge tube (no more than 1 / 2 volume). Add hydrogen peroxide / ethanol solution to the centrifuge tube to the 40mL position, and gently invert the centrifuge tube repeatedly to disinfect. After 2 minutes, pour out the hydrogen peroxide / ethanol solution and add sterile water to wash 5-6 times. Transfer the disinfected seeds to a culture dish containing 3 sterilized filter papers and absorb the moisture.

[0094] Inoculate the sterilized seeds on solid GM culture medium (GM formula is shown in Table 2) with the hilum facing downward and inserting 1 / 2 of the culture medium. Too deep will affect the time it takes for the soybeans to turn green. Place them in the tissue culture room (light / dark = 16h / 8h) and culture for 3 to 5 days.

[0095] Table 2 Preparation of GM medium

[0096] Reagents Dosage B-5(Solebo B8830) 3.21g Sucrose (Solebo S8271) 20g Agar (Solabo A8190) 5g Final volume 1L

[0097] Adjust the pH to 5.8 with 1M NaOH and sterilize at 121°C for 20 min. When the temperature drops to about 60°C, add 1 mg / L plant cytokinin (6-Benzyl-aminopurine, 6-BA, Solebol A8170) to the culture medium in a clean bench.

[0098] Hydrogen peroxide / ethanol solution: Add 10 mL of 30% (w / w) hydrogen peroxide to 75 mL of 95% (v / v) ethanol and adjust the total volume to 100 mL with ddH2O.

[0099] 1.4 Preparation of resuspension

[0100] The dual-unit CRISPR / Cas9 editing vector of the present application (a plasmid synthesized by Shanghai Biotech) was dissolved in 1 mL of K599 strain, and the strain was added to 50 mL of liquid YEP medium (Qingdao Haibo Biotechnology HB8474), and then 50 μL of kanamycin and 50 μL of streptomycin (from Solebao K1030 and S8290, respectively) were added, and cultured overnight at 28°C with shaking at 220 rpm. When the bacterial solution became turbid, 200 μL of L bacterial liquid was added to the above culture conditions (50mL liquid YEP, 50μL kanamycin, 50μL streptomycin), and cultured at 28°C with shaking at 220rpm for 8-12h. When the OD value was 0.8, it was transferred to a sterile centrifuge tube and centrifuged at 5000rpm for 10min. The supernatant was discarded to collect the bacteria, and a small amount of co-culture solution CCM (Table 3) was added to resuspend the bacteria. The bacteria were centrifuged again and 50mL of co-culture solution CCM was added to resuspend the bacteria for subsequent explant infection.

[0101] Table 3 Preparation of CCM co-culture medium

[0102] Reagents Dosage B-5 0.443g sucrose 20g MES(Solebo M8010) 3.9g Agar (added to solid culture medium, not to liquid medium) 5g Final volume 1L

[0103] Adjust pH to 5.4 with 1M NaOH, sterilize at 121°C for 20 min, cool to about 60°C after the pressure drops, add 0.04 g / L acetosyringone (Acetosyringone, AS) DMSO solution and 0.143 g / L dithiothreitol (DTT) aqueous solution in a sterile operating table.

[0104] 2. Induction of Hairy Roots

[0105] After 5 days of culture, select the soybean explants that have completely turned green and stretched vertically on the culture medium, cut them with a sterile tissue culture knife at a distance of 0.5 cm from the hypocotyl, divide the cotyledons from the middle into two monocotyledons, and use a blade to make wounds at the attachment point of the hypocotyl. One cotyledon can be cut 5 to 7 times. The wound should not be cut too deep, which will cause a defense reaction. The cut explants are mixed with the prepared resuspension, placed on a 28°C shaker, and infected at 150rpm for 30 minutes. Take out the explants, absorb the infection liquid with sterile absorbent paper, and turn them upside down on a solid CCM co-culture medium covered with a layer of filter paper (when preparing solid CCM, add 5g / L agar before sterilization, and the rest is the same as liquid CCM), and culture in the dark for 3-5 days.

[0106] 3. Sterilization culture

[0107] The cotyledonary nodes induced with hairy roots were washed 3-5 times with sterile water to remove excess Agrobacterium, and then dried with sterile paper towels. The wound side of the cotyledonary node was inserted upside down on the solid culture medium SIM (Table 4) with sterilized tweezers. Hairy roots began to grow after 7 days (see Figure 2 ).

[0108] Table 4 SIM sterilization medium

[0109] Reagents Dosage B-5 1.605g sucrose 20g MES 0.59g Agar 7g Final volume 1L

[0110] Adjust pH to 5.6 with 1 mol / L NaOH, sterilize at 120°C for 20 min, cool to about 60°C, and add 250 mg / L cephalosporin (Cef) and 250 mg / L carbenicillin (Carbenicillin) (from Solebold C8240 and IC0090, respectively), or 500 mg / L cephalosporin (Cef) in a sterile operating table.

[0111] 4. Stable transformation:

[0112] Soybean seeds were sterilized with chlorine for 12 hours and then soaked in sterile water for 12 hours. After the imbibition, the soybeans were peeled, the two cotyledons were separated, and a wound was lightly made near the cotyledon node with a blade, and the seeds were placed in the Agrobacterium resuspension containing the target vector for 30 minutes. After the resuspension was absorbed with filter paper, the explants were placed on a solid culture medium and cultured in the dark at 25°C for 4 days. The co-cultured explants were transferred to the cluster bud induction medium and cultured at 25°C and 16h light for 28 days (see Figure 3 ). The induced cluster buds were cut from the cotyledons and transferred to cluster bud elongation medium. When the cluster buds elongated to 2 cm, the cluster buds were cut from the base and transferred to rooting medium. Rooting culture was carried out for 15 days.

[0113] Table 5 Main culture medium:

[0114]

[0115]

[0116] 4.1 Plant Growth

[0117] Soybean (Williams 82) seeds were sown in 13 cm diameter pots in a greenhouse under long-day conditions (16 h light, 1,500 μmol m -2 S -1 ), sown on a customized soybean soil mix (1:1:1 ratio of soil, perlite and torpedo sand).

[0118] 4.2 Preparation of plasmid DNA

[0119] The bacterial solution in 2. Preparation of the resuspension in the above Example 2 was used to prepare plasmids according to the Tiangen DP103-02 plasmid extraction kit.

[0120] 4.3 Protoplast isolation

[0121] a. Newly expanded single leaves were cut from 10-day-old soybean seedlings.

[0122] b. Remove the midrib of the leaf and cut the remaining leaf into strips of 0.5 to 1 mm

[0123] c. Use forceps to immediately transfer the leaf strips to 10 ml of freshly prepared enzyme solution (MES 20 mM, Cellulase 2%, Pectolyase 0.1%, Mannitol 0.75 M, CaCl 2 0.2mM, BSA.1%, DTT 0.5mM; from Solebol M8010, C8270, P8220, SM8120, C7250, PC0001, D8220, respectively), placed in a 15 ml test tube. Vacuum infiltrate the leaf strips at room temperature for 15 minutes.

[0124] d. Enzymatically hydrolyze the leaves at room temperature for 4 to 6 hours.

[0125] e. Pour 10 ml of enzyme / protoplast solution into a 50 ml test tube, pour gently, and add 10 ml of W5 solution (NaCl 154 mM, CaCl 2 The enzyme / protoplast solution was gently poured onto a clean 75 micron nylon mesh (Falcon 352350) placed on top of a 50 ml test tube to remove undigested leaf tissue.

[0126] f. Centrifuge the 50 ml tube for 1-2 minutes and remove the supernatant.

[0127] g. Resuspend and freeze the protoplasts for 30 minutes.

[0128] h. Centrifuge the suspension at 100 g for 1-2 minutes at room temperature and use a 1 ml pipette to gently remove the W5 solution without disturbing the protoplast pellet. 5 mL -1 Resuspend in MMG solution at a concentration of 1.

[0129] 4.4 Protoplast transformation

[0130] A. Add the vector plasmid into the protoplasts.

[0131] B. Add polyethylene glycol aqueous solution and mix well.

[0132] C. Incubate at room temperature for 15 minutes.

[0133] D. Add W5 solution, mix well, centrifuge and remove the supernatant.

[0134] E. Add W1 solution (MES 5.74mM, Mannitol 0.5M, KCl 20mM) to resuspend, add 5% calf serum to a 6-well plate, and after a few seconds, aspirate and discard. Transfer the protoplasts to the well plate and culture in the dark.

[0135] 4.5 Collection of protozoa

[0136] After 1-2 days, the cells were collected by centrifugation and observed under a fluorescence microscope.

[0137] Embodiment 2

[0138] Using the method steps shown in Example 1, the carrier ( Figure 4 No. 2) and the control vector (Tang X, et al., Plant Prime Editors Enable Precise Gene Editing in Rice Cells. Mol Plant. 2020 May 4; 13(5): 667-670. doi: 10.1016 / j.molp.2020.03.010. Epub 2020 Mar 25. PMID: 32222487, synthesized by Shanghai Biotech Biotechnology, Figure 4 No. 1) to conduct parallel experiments (see the results in Figure 4 ).

[0139] Embodiment 3

[0140] Using the method steps shown in Example 1, the vector of the present application was used to perform parallel experiments using sgRNA sequences targeting different sites (first site SEQ ID No. 1; second site SEQ ID No. 2) (for results, see Figure 5-6 ).

[0141] result:

[0142] exist Figure 2 In the experiment, because the vector contains the GUS gene, GUS staining can be used to verify the expression of the vector in the hairy roots. As shown in the figure: compared with the control group, the vector-transformed cells appear blue, indicating that the vector can be expressed in the hairy roots. Use Solebow's GUS staining solution, put the hairy roots in it, wrap them with tin foil, and place them at 37°C for 12-16 hours before observation.

[0143] exist Figure 3 Because the vector contains ZsGreen, all positive buds can emit green fluorescence visible to the naked eye under the irradiation of excitation light. As can be seen from the figure: the regenerated buds have green fluorescence. Therefore, it shows that the vector is expressed in stable transformation.

[0144] exist Figure 4 Compared with the control vector, the genetic transformation rate of the vector of the present application was 70% and 76%; the positive rate was 76% and 81%. The genetic transformation rate of the control vector was 43% and 50%; the positive rate was 54% and 60%. In addition, the number of budding leaf discs of the plants using the vector of the present application was 21 and 23; the number of budding leaf discs of the plants using the control vector was 13 and 15. The number of fluorescent buds of the plants using the vector of the present application was 36 and 13; the number of fluorescent buds of the plants using the control vector was 15 and 19.

[0145] Figure 5 This is the mutation efficiency result of the vector claimed in this application using the sgRNA targeting the first site. The blue font is sgRNA and the red font is PAM site. Figure 5 The left side of the figure) and sequence analysis of stable plant mutants showed that the mutation efficiency ( Figure 5 On the right side of the figure) are 46% and 40% respectively.

[0146] Figure 6 This is the mutation efficiency result of using the vector claimed in this application and using sgRNA targeting the second site. The blue font is sgRNA and the red font is PAM site. Figure 6 left side of the figure) and sequence analysis of stable plant mutants ( Figure 6 The right side of the figure shows that the mutation efficiencies are 15.4% and 15.4%, respectively.

[0147] Table 6 shows the sequences used in the present disclosure

[0148]

[0149]

[0150]

[0151]

[0152] The sequences of the various elements included in the vector of the present disclosure are shown above.

Claims

1. A CRISPR / Cas system-based dicotyledonous plant gene editing sgRNA site, wherein: The sgRNA site is located in the phytoene dehydrogenase PDS gene on the dicot genome; the sgRNA site includes a dicot genome sequence that is complementary to the sgRNA sequence; wherein the sgRNA sequence includes a sequence that has at least 70% identity with the sequence shown in SEQ ID No. 1 or SEQ ID No.

2.

2. A dicotyledonous plant gene editing expression vector based on the CRISPR / Cas system, comprising an independent Cas9 nuclease expression cassette and a sgRNA expression cassette; in, The sgRNA expression cassette comprises the sgRNA sequence of claim 1.

3. The dicotyledonous plant gene editing expression vector according to claim 2, wherein the Cas9 nuclease is a variant MiCas9.

4. The dicotyledonous plant gene editing expression vector according to claim 3, wherein: The number of the sgRNA expression cassettes is 1 to 10.

5. The dicotyledonous plant gene editing expression vector according to any one of claims 2 to 4, wherein: The dicotyledonous plant gene editing expression vector includes the following structure: first promoter-enhancer-GUS-MiCas9-3×NLS-tHSP-second promoter-tRNA1-sgRNA-sgRNAscaffold-tRNA2-2×35S-ZsGreen-HYG-tNOS.

6. The dicotyledonous plant gene editing expression vector according to claim 5, wherein: The first promoter includes pRBCS; the enhancer includes an endogenous enhancer of soybean; and the second promoter includes AtU6.

7. The dicotyledonous plant gene editing expression vector according to claim 6, wherein: The sequence of the first promoter is shown in SEQ ID No. 3; The sequence of the enhancer is shown in SEQ ID No. 4; The sequence of the GUS is shown in SEQ ID No. 5; The sequence of MiCas9 is shown in SEQ ID No.6; The sequence of the 3×NLS-tHSP is shown in SEQ ID No. 7; The sequence of AtU6 is shown in SEQ ID No. 8; The sequence of the tRNA1 is shown in SEQ ID No. 9; The sequence of the sgRNA is shown in SEQ ID No. 1 or SEQ ID No. 2; The sequence of the sgRNA scaffold is shown in SEQ ID No. 10; The sequence of the tRNA2 is shown in SEQ ID No. 11; The sequence of the 2×35S is shown in SEQ ID No. 12; The sequence of the ZsGreen is shown in SEQ ID No. 13; The sequence of HYG-tNOS is shown in SEQ ID No.

14.

8. A dicotyledon gene editing method based on the CRISPR / Cas system, the dicotyledon gene editing method comprising using the dicotyledon gene editing expression vector described in any one of claims 2 to 7.

9. The method for editing genes in dicotyledonous plants according to claim 8, comprising the following steps: The plant's vegetative body is infected with Agrobacterium rhizogenes containing the dicotyledonous plant gene editing expression vector described in any one of claims 2 to 7, and then cultured until the vegetative body sprouts transgenic hairy roots, and the CRISPR / Cas system of the dicotyledonous plant gene editing expression vector edits the dicotyledonous plant genome.

10. The dicotyledonous plant gene editing method according to any one of claims 8 to 9, wherein: The dicotyledonous plants include soybean.

Images