Use of a reagent for detecting SNP locus rs2246690 in the preparation of a screening product for AMS-susceptible populations

Abstract

The present invention provides an application of a reagent for detecting the SNP locus rs2246690 in the preparation of a screening product for AMS susceptible populations, which relates to the field of biomedical technologies. Through genome-wide association studies, it has been found that the genotype AA of the SNP locus rs2246690 at 9p24.1 is the susceptible genotype for AMS. By detecting the SNP locus rs2246690, it is possible to effectively achieve the auxiliary screening of AMS susceptible populations and conduct scientific interventions to specifically reduce the risk of AMS occurrence in these susceptible populations.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to the application of a reagent for detecting SNP locus rs2246690 in the preparation of a screening product for AMS susceptible populations. Background Art

[0002] Acute mountain sickness (AMS) is the most common disease in high-altitude areas and usually occurs shortly after a rapid ascent to a hypoxic environment. The incidence of AMS increases with the increase in altitude. At an altitude of 2,850 meters, the incidence is 5.8%; at an altitude of 3,050 meters, the incidence is 2.1%; at an altitude of 3,650 meters, the incidence is 14.8%; at an altitude of 4,559 meters, the incidence is 21.9%. The main symptoms of this disease include headache, loss of appetite, nausea, dizziness, fatigue, and insomnia. Although altitude sickness itself is not life-threatening, it may develop into more serious conditions such as high-altitude pulmonary edema (HAPE) and high-altitude cerebral edema (HACE), which can be fatal if not treated promptly. With more and more people traveling, working, and exercising in high-altitude areas, altitude sickness has become an important public health problem. However, people still know very little about the exact pathophysiology of AMS.

[0003] Studies have shown that genetic factors play an important role in the susceptibility to AMS, and certain genotypes are beneficial for rapid adaptation to high-altitude environments. Association studies based on candidate genes have identified several single nucleotide polymorphisms (SNPs) loci that are significantly associated with the risk of AMS. The genes associated with these SNPs are mainly divided into the following four categories: (a) Hypoxia-inducible factor (HIF) pathway genes, such as EPAS1 (index SNPs, rs6756667, rs4953348) and EGLN1 (rs12097901, rs2790859); (b) Genes involved in angiogenesis, vascular permeability, and vascular smooth muscle relaxation, such as VEGFA (rs3025039), eNOS3 (rs1799983), and EDN1 (rs2070699); (c) Heat shock protein (HSP) genes, such as HSPA1A (rs1008438), HSPA1B (rs10661581), and HSPA1L (rs2227956); (d) Genes in the renin-angiotensin system, such as ACE (rs4340) and AGT (rs699). However, due to the limited understanding of the physiological mechanism of AMS susceptibility, the selection of candidate genes is restricted. In addition, this method cannot fully explain the overall heritability of AMS.

[0004] Currently, there are no studies reporting a correlation between polymorphisms in the genomic region 9p24.1 (UHRF2) and susceptibility to AMS.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The first object of the present invention is to provide a reagent for detecting the SNP site rs2246690 for use in preparing an AMS susceptible population screening product to solve the above technical problems.

[0007] The second object of the present invention is to provide a reagent for screening AMS susceptible populations.

[0008] The third object of the present invention is to provide a kit for screening AMS susceptible populations.

[0009] The fourth object of the present invention is to provide a device for screening AMS-susceptible populations.

[0010] In order to achieve the above objectives, the following technical solutions are adopted:

[0011] In a first aspect, the present invention provides the use of a reagent for detecting the SNP site rs2246690 in the preparation of a product for screening AMS susceptible populations.

[0012] As a further technical solution, if the genotype of the SNP site rs2246690 is AA, the population is susceptible to AMS.

[0013] As a further technical solution, the product includes a reagent or a kit.

[0014] In a second aspect, the present invention provides a reagent for screening AMS-susceptible populations, comprising primers and / or probes for detecting the SNP site rs2246690.

[0015] As a further technical solution, the nucleic acid sequences of the primers are shown as SEQ ID NO.1 and SEQ ID NO.2.

[0016] As a further technical solution, the nucleic acid sequence of the probe is shown as SEQ ID NO.3 or SEQ ID NO.4.

[0017] As a further technical solution, the 5' end of the probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group;

[0018] The fluorescent reporter group includes FAM or HEX;

[0019] The fluorescence quenching group includes TAMRA, BHQ1 or BHQ2.

[0020] In a third aspect, the present invention provides a kit for screening AMS-susceptible populations, including the above reagents.

[0021] As a further technical solution, it further includes nucleic acid extraction reagents.

[0022] In a fourth aspect, the present invention provides a device for screening AMS-susceptible populations, including a sequencing device, a comparison device, and an analysis device;

[0023] The sequencing device is used for sequencing the rs2246690 region of the sample to be tested;

[0024] The comparison device is used to determine the genotype of rs2246690 according to the results of the sequencing device;

[0025] The analysis device is used to judge the AMS susceptibility risk according to the results of the comparison device.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] Through genome-wide association studies, it has been found that the genotype AA of the SNP locus rs2246690 at 9p24.1 is the susceptible genotype for AMS. By detecting the SNP locus rs2246690, it is possible to effectively achieve the auxiliary screening of AMS-susceptible populations and carry out scientific interventions to specifically reduce the risk of AMS in these susceptible populations. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0029] Figure 1 : Manhattan plot and quantile plot of genome-wide association study of population cohorts. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] Below in conjunction with embodiment and example, embodiment of the present invention is described in detail, but those skilled in the art will appreciate that the following embodiment and example are only used to illustrate the present invention, and should not be considered as limiting the scope of the present invention. Based on the embodiment in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work premise all fall within the scope of protection of the present invention. Unspecified conditions are carried out according to the conditions of normal conditions or manufacturer's recommendations. Reagents used or instruments not specified by the manufacturer are conventional products that can be purchased commercially.

[0031] In a first aspect, the present invention provides the use of a reagent for detecting the SNP site rs2246690 in the preparation of a product for screening AMS susceptible populations.

[0032] A genome-wide association study found that the AA genotype of the rs2246690 SNP at 9p24.1 is a susceptible genotype for AMS. When an individual's rs2246690 genotype is AA, it indicates a higher likelihood of developing AMS. Furthermore, analysis of the expression quantitative trait loci (eQTLs) revealed that the protective allele G of rs2246690 is significantly associated with elevated expression of the UHRF2 gene in the prefrontal cortex (P = 5.83 × 10 -5 ). These results indicate that UHRF2 is a major AMS susceptibility candidate gene on chromosome 9p24.1.

[0033] Accordingly, by detecting the SNP site rs2246690, it is possible to effectively screen AMS susceptible populations. For example, since the present invention confirms that the rs2246690 genotype AA is associated with susceptibility to AMS, in the prevention and control of AMS populations, it is necessary to carry out rs2246690 genotype testing on the consulted subjects to determine whether the subjects carry the AMS susceptible genotype rs2246690AA. For individuals with the genotype rs2246690AA, scientific interventions can be carried out, such as recommending early therapeutic prevention, etc., so that the risk of AMS in these susceptible populations can be targeted and reduced.

[0034] In some optional embodiments, the product comprises a reagent or a kit.

[0035] In a second aspect, the present invention provides a reagent for screening AMS-susceptible populations, comprising primers and / or probes for detecting the SNP site rs2246690.

[0036] This reagent can assist in predicting AMS individuals in a short time, at low cost, and with high accuracy by detecting the SNP locus rs2246690, providing a theoretical basis for clinical treatment and prognosis evaluation, etc.

[0037] In some alternative embodiments, the nucleic acid sequences of the primers are as shown in SEQ ID NO.1 and SEQ ID NO.2:

[0038] Forward primer: AGCTGGGCTTTTCCTCCATC (SEQ ID NO.1);

[0039] Reverse primer: AAATCCCAGCTGTCCTTGCA (SEQ ID NO.2).

[0040] In some alternative embodiments, the nucleic acid sequences of the probes are as shown in SEQ ID NO.3 or SEQ ID NO.4:

[0041] TTCTCAGTTGATGTCTAAGAATAAGA (SEQ ID NO.3);

[0042] TTCTCAGTTGATGTCTAGGAATAAGA (SEQ ID NO.4).

[0043] In some alternative embodiments, the 5' end of the probe is linked with a fluorescent reporter group, and the 3' end is linked with a fluorescent quenching group;

[0044] The fluorescent reporter group includes but is not limited to FAM or HEX;

[0045] The fluorescent quenching group includes but is not limited to TAMRA, BHQ1 or BHQ2.

[0046] In a third aspect, the present invention provides a kit for screening AMS susceptible populations, including the above-mentioned reagent.

[0047] This kit can screen AMS susceptible populations by detecting the SNP locus rs2246690.

[0048] In some alternative embodiments, it further includes a nucleic acid extraction reagent. The DNA of the sample to be tested can be obtained through the nucleic acid extraction reagent.

[0049] In a fourth aspect, the present invention provides a device for screening AMS susceptible populations, including a sequencing device, a comparison device and an analysis device;

[0050] The sequencing device is used for sequencing the region including rs2246690 of the sample to be tested;

[0051] The comparison device is used to determine the gene type of rs2246690 according to the results of the sequencing device;

[0052] The analysis device is used to judge the AMS susceptibility risk according to the results of the comparison device.

[0053] In some alternative embodiments, the sequencing device is used to sequence a predetermined region in the whole genome of an individual to obtain sequencing results; wherein, the predetermined region is 1Kb upstream and downstream of rs2246690. Thus, sequencing can be carried out more effectively.

[0054] The present invention will be further described below through specific embodiments. However, it should be understood that these embodiments are only for more detailed description and should not be construed as limiting the present invention in any form.

[0055] Example 1 Genome-wide association study of AMS susceptibility

[0056] 1. Materials and methods

[0057] 1.1 Research subjects

[0058] Population cohort 1: Population cohort 1 took a train from a low-altitude area to a high-altitude area (altitude 4,600 meters) in May 2022, with a total of 226 participants. After all participants received a comprehensive introduction to the research details, they all gave written informed consent. The sociodemographic information of all participants was collected, and about 2 mL of fasting venous blood was drawn from each participant before they ascended to the plateau and stored in an environment of minus 80 degrees Celsius. On the night of arrival, each participant filled out the Lake Louise questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 were classified into the case group, while participants without obvious symptoms were classified into the control group.

[0059] 1.2 Genotyping, quality control and imputation analysis

[0060] Genomic DNA was extracted from 1 mL of blood using the QIAamp DNA Blood Kit. The purified DNA was eluted in 100 μL of elution buffer (pH 8.0). The DNA quality was evaluated by two methods: (1) evaluating DNA degradation and contamination on a 1% agarose gel; (2) measuring the DNA concentration using the Qubit DNA Assay Kit with a Qubit 2.0 fluorometer. The samples were genotyped using the Illumina Infinium Global Screening Array-24v1.0 BeadChip.

[0061] Subsequently, strict quality control was performed on the samples and SNPs to ensure the robustness of the association tests. Samples with low call rates (<90%), undetermined gender, close relatives (PI_HAT value greater than 0.2 in PLINK v.1.9), high heterozygosity rates (more than 3 standard deviations above the mean), or identified as outliers using principal component analysis were excluded. For SNPs, this study excluded those with genotype call rates below 90%, deviation from Hardy-Weinberg equilibrium (control HWE deviation P < 1e-6, case HWE deviation P < 1e-10), minor allele frequencies below 5%, and SNPs located on the XY chromosomes.

[0062] To improve genome region coverage, the human genome hg19 was used, and the 1000 Genomes Project data was used as a reference. SHAPEIT (v.4.1.2) and IMPUTE5 (v.1.1.5) were used to impute the genotyping data. Finally, SNPs with information scores below 0.6 or minor allele frequencies below 0.01 were excluded.

[0063] 1.3 Association studies

[0064] Genome-wide association analysis was performed using the logistic regression model in PLINK v.1.9, with gender, age, and the top 10 principal components as covariates. Quantile-quantile plots (Q-Q plots) were generated in R (4.3.1) to evaluate the distribution of P-values, and the lambda (λ) inflation factor (genomic inflation factor) was evaluated to detect the presence of systematic biases. In this study, SNPs with P < 0.05 in population cohort 1 were considered significantly different AMS-susceptible SNPs.

[0065] Subsequently, fine mapping analysis was performed using CAVIAR (v.2.2) and FINEMAP (v.1.3.1). A set of credible SNPs was determined for each locus, defined as the smallest set of variants that includes all causal variants and has a certainty greater than 0.95. Subsequently, we used RegulomeDB (V2) and Haploreg to identify potential functional SNPs.

[0066] 2. Results

[0067] 2.1 Results of genome-wide SNP data quality control

[0068] To explore the AMS-susceptible regions in the Chinese population, the inventors genotyped the SNPs in population cohort 1. After strict quality control (Table 1), 74 cases and 145 controls, as well as 7,010,527 SNPs, were retained in population cohort 1.

[0069] Table 1 Quality control process of the population (a) Quality control of the population sample:

[0070]

[0071] (b) SNP quality control process:

[0072]

[0073] 2.2 Association analysis results

[0074] The inventors performed association analysis on population cohort 1, thereby identifying a locus 9p24.1 significantly associated with AMS (P < 0.05). In population cohort 1, chromosome 9p24.1 (index SNP rs2246690; odds ratio OR of the A allele = 1.652; 95% confidence interval CI = 1.045 - 2.614; P = 3.18×10 -2 ). There were significant differences in the allele frequencies of the above - mentioned locus between the case group and the control group ( Figure 1 , where (a) a Manhattan plot was drawn based on the association results of population cohort 1 of the present invention, depicting the genome - wide association statistics of population cohort 1, which were from a logistic regression model considering gender, age, and the top 10 principal components; (b) a quantile - quantile plot was drawn based on the association results of population cohort 1 of the present invention; the inflation factor λ was 1.053; the slanted line represented the null hypothesis of no true association).

[0075] Example 2 Susceptibility gene mapping analysis

[0076] To identify potential susceptibility genes on SNPs, this study performed eQTL analysis using 5 publicly available datasets: (1) QTLbase collected genome-wide QTL statistical summaries of many human molecular traits under over 95 tissue / cell types and various biological conditions. This database includes tens of millions of important genotype-molecular trait associations under different conditions. (2) Genotype-Tissue Expression database (GTEx, version 8), covering 48 tissues (including blood and lung), detecting SNPs using whole-genome sequencing and measuring mRNA expression levels using RNA sequencing. (3) ImmuNexUT, covering 9852 immune cell samples from 416 donors, including 10 different immune-mediated diseases and 28 immune cell types from healthy donors. (4) FIVEx, including eQTL and sQTL data from 16 different studies in the EBI eQTL catalogue. (5) scQTLbase is a comprehensive portal for human single-cell eQTLs, which includes 304 datasets of 57 cell types and 95 cell states. It includes approximately 16 million SNPs related to gene expression in specific cells, and approximately 690,000 disease-related sc-eQTLs from 3333 traits / diseases. This study only focused on protein-coding genes within 1 Mb regions upstream and downstream of SNPs, and considered P<0.001 as statistically significant. The gene UHRF2 is included within 1 Mb upstream and downstream of the index SNP rs2246690 locus. According to the results of QTLbase2, the protective allele G of rs2246690 was significantly associated with high expression of the UHRF2 gene in the prefrontal cortex of the brain (P = 5.83×10 -5 ). These results indicate that UHRF2 is a major candidate gene on chromosome 9p24.1.

[0077] UHRF2 is widely expressed in neural tissues, the intestine, and common lymphoid progenitors. Studies have shown that gene knockout of UHRF2 in mice results in altered neural gene expression and impaired hippocampus-dependent learning and memory, indicating that UHRF2 plays a crucial role in regulating the learning and memory processes at the cellular and systemic levels. Combining with previous studies, we have reason to believe that the genotype AA of rs2246690 may cause the cognitive impairment commonly seen at high altitudes. In summary, both the association study and functional study of the inventors suggest that the AMS susceptibility gene in the region (9p24.1) where rs2246690 is located includes the UHRF2 gene. This invention confirms the association between the genotype AA of rs2246690 and AMS susceptibility. In the prevention and control of AMS in the population, the genotype of rs2246690 should be detected in the counseling objects for scientific intervention to specifically reduce the risk of AMS in these susceptible populations.

[0078] Example 3

[0079] To verify the accuracy of predicting AMS-susceptible populations using the rs2246690 genotype AA, the inventors verified it in population cohort 2.

[0080] Population cohort 2: Population cohort 2 took a bus from a low-altitude area to a high-altitude area (altitude 4,600 meters) in May 2023, and a total of 367 participants were recruited. After all participants received a comprehensive introduction to the research details, they all gave written informed consent. The sociodemographic information of all participants was collected, and about 2 ml of fasting venous blood was drawn for each participant before they ascended to the plateau and stored in an environment of minus 80 degrees Celsius. On the night of arrival, each participant filled out the Lake Louise questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 were classified into the case group, while participants without obvious symptoms were classified into the control group. After strict quality control (the quality control method refers to 1.2 of Example 1), 84 cases and 176 controls were retained in population cohort 2.

[0081] According to the manufacturer's instructions, peripheral whole blood samples of all participants were collected, and the genotypes of the rs2246690 locus of the subjects were detected. The results are statistically shown in Table 2:

[0082] Table 2

[0083]

[0084]

[0085] Based on the results in Table 2, the sensitivity, specificity, and accuracy of predicting AMS-susceptible populations using the rs2246690 genotype AA were calculated, and the results are as follows:

[0086] Sensitivity: 0.23, Specificity: 0.86, Accuracy: 0.65.

[0087] It is proved that the present invention has good diagnostic value and can be used for the auxiliary diagnosis of AMS-susceptible populations.

[0088] Example 4

[0089] Design primers and probes for the rs2246690 locus:

[0090] Forward primer: AGCTGGGCTTTTCCTCCATC (SEQ ID NO.1);

[0091] Reverse primer: AAATCCCAGCTGTCCTTGCA (SEQ ID NO.2);

[0092] Probe 1: (FAM)TTCTCAGTTGATGTCTAAGAATAAGA(BHQ1)(SEQ ID NO.3);

[0093] Probe 2: (HEX)TTCTCAGTTGATGTCTAGGAATAAGA(BHQ1)(SEQ ID NO.4).

[0094] The DNA of the subjects with the genotypes GG and AA of the SNP locus rs2246690 was extracted respectively, and then using this DNA as a template, fluorescence quantitative PCR detection was carried out with an amplification system containing the above primers and probes (upstream primer, downstream primer, Probe 1 and Probe 2). The results showed that only a single fluorescence was detected after the amplification of the two nucleic acids, indicating that the primers and probes of the present invention can be used for the detection of the rs2246690 locus.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a reagent for detecting SNP locus rs2246690 in the preparation of a screening product for acute mountain sickness susceptible populations.

2. The application according to claim 1, wherein If the genotype of SNP locus rs2246690 is AA, it is an acute mountain sickness susceptible population.

3. The application according to claim 1, characterized in that, The product includes a kit.

4. An apparatus for screening susceptible populations to acute mountain sickness, characterized in that, It includes a sequencing device, an alignment device and an analysis device; The sequencing device is used for sequencing the region including rs2246690 of the sample to be tested; The alignment device is used for determining the gene type of rs2246690 according to the result of the sequencing device; The analysis device is used for judging the acute mountain sickness susceptibility risk according to the result of the alignment device.

Images