Universal primer group for rapidly detecting nucleic acid of stenotrophomonas maltophilia, kit and application

Abstract

The invention discloses a universal primer group for rapidly detecting nucleic acid of stenotrophomonas maltophilia, a kit and application, belongs to the technical field of genetic engineering, and aims to solve the problem that qPCR (quantitative polymerase chain reaction) heating and cooling time needs at least 60 minutes when a sample is traditional stenotrophomonas maltophilia. The primer group comprises a primer group which is composed of nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 and aims at conserved region genes of stenotrophomonas maltophilia, detection of stenotrophomonas maltophilia is completed in the same tube system within 30 minutes based on an RPA / RAA constant-temperature amplification method, and a direct electrophoresis method is selected for judgment according to the position of a target band.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a universal primer set, a kit and an application for rapidly detecting nucleic acid of Stenotrophomonas maltophilia. Background Art

[0002] Stenotrophomonas maltophilia (SMA) is a non-fermenting, aerobic, non-spore-forming Gram-negative bacillus belonging to the Xanthomonadales and Xanthomonadaceae families. The virus particle is about 0.5 μm × 1.5 μm, has 1-8 extreme flagella, is motile, and has no spores.

[0003] Stenotrophomonas maltophilia has become an important opportunistic pathogen. It can cause respiratory tract infections, acute exacerbation of chronic obstructive pulmonary disease, bacteremia, bile sepsis, bone and joint infections, urinary tract infections, soft tissue infections, endophthalmitis, eye infections (keratitis, scleritis and dacryocystitis), endocarditis and meningitis, and can promote the occurrence and development of certain cancers, such as obstructive lung cancer. Stenotrophomonas maltophilia is prone to occur in people with low immunity, and its infection rate is increasing year by year, with a mortality rate as high as 69%.

[0004] Existing pathogen detection methods mainly include conventional pathology techniques, which use pathological sections combined with transmission electron microscopy and other technologies to test samples. This type of technology is time-consuming, has high requirements for technical personnel, and requires high-cost supporting instruments and research platforms. It is usually suitable for research-type experiments at the scientific research level.

[0005] Rapid on-site detection schemes based on immunology and molecular biology methods are currently the mainstream on-site detection technologies for pathogen detection. Immunology-based technologies include colloidal gold test strips, enzyme-linked immunosorbent assay (ELISA), and other technologies. Detection schemes based on nucleic acid amplification, such as quantitative PCR, PCR, LAMP, and RPA, can all quickly carry out pathogen detection. Among them, colloidal gold test strip detection technology, LAMP, and RPA technologies do not require thermal cycling for amplification reactions, have low requirements for heating equipment, and do not require variable temperature amplification instruments (such as PCR instruments, quantitative PCR instruments). At the same time, color reactions or constant temperature amplification instruments (such as ordinary water baths, special constant temperature amplification instruments, etc.) can be used to complete the heating reaction, which is more suitable for relatively simple grassroots conditions and home rapid testing to complete preliminary screening work.

[0006] The recombinase-mediated strand replacement nucleic acid amplification (RAA) method mainly uses three enzymes: recombinase, single-stranded DNA binding protein and DNA polymerase. The recombinase binds to the primer to form a complex. With the assistance of the single-stranded DNA binding protein, the template DNA is unzipped and the primer is paired with the template. Then, under the action of the DNA polymerase, a new DNA chain is generated. After dozens of cycles, the number of new DNA chains increases exponentially. The RAA method uses the action of enzymes to unzip double-stranded DNA. Therefore, the reaction conditions are mild and high temperature is not required to denature the template DNA. The RAA reaction time is also short, and detectable amplified fragments can be obtained in 15 to 30 minutes. The technical improvement of recombinase-mediated amplification (RAA technology) compared to recombinase polymerase amplification (RPA technology) is that the RAA amplification method uses a recombinase obtained from bacteria or fungi. At a constant temperature of 37-39°C, the recombinase can bind tightly to the primer DNA to form an enzyme and primer polymer; the recombinase used in RPA is T4 UVSX, which comes from a virus. Experiments have shown that recombinases from bacteria and fungi can bind tightly to DNA, allowing the in vitro nucleic acid amplification reaction to proceed smoothly.

[0007] Based on the RPA / RAA isothermal amplification reaction, only one pair of primers is needed to complete the amplification. After screening multiple pairs of primers in multiple conserved regions, the sensitivity and specificity can reach the same level as qPCR. After the primers with low mutations in different subtypes of the conserved region are degenerately modified with mixed bases, compatibility with different subtypes of epidemic strains is achieved, thereby completing the primer matching in the amplification and improving the amplification rate. The product of the RPA / RAA isothermal amplification reaction can be displayed in combination with common electrophoresis, fluorescence, and test paper methods to make a qualitative judgment of the results. The result judgment method can be selected according to laboratory conditions or on-site testing needs, which is extremely flexible.

[0008] Therefore, a universal nucleic acid primer set and kit for detecting Stenotrophomonas maltophilia is constructed, which is easy to operate, has sensitivity and specificity equivalent to qPCR, has a fast reaction, does not rely on large equipment, is suitable for grassroots field development, and helps to meet the needs of rapid and effective on-site nucleic acid testing. Summary of the invention

[0009] In view of the above problems, the present application designs a universal primer set for rapid detection of Stenotrophomonas maltophilia nucleic acid. The kit formed by the primer set can be used in the detection of Stenotrophomonas maltophilia nucleic acid, and the detection time is saved by about 30 minutes.

[0010] In a first aspect, the present invention provides a universal primer set for rapid detection of Stenotrophomonas maltophilia nucleic acid, comprising an amplification primer F and an amplification primer R, wherein the nucleotide sequence of amplification primer F is shown in SEQ ID NO.1, and the nucleotide sequence of amplification primer R is shown in SEQ ID NO.2.

[0011] Specifically, SEQ ID No. 1: ATTCCTGGTGTAGCAGTGAAATGCGTAGA;

[0012] SEQ ID No. 2: TTCCTTTGAGTTTCAGTCTTGCGACCGTA.

[0013] In a second aspect, the present invention further provides a kit for rapid detection of Stenotrophomonas maltophilia nucleic acid, comprising a detection solution, wherein the detection solution at least includes the amplification primer F and the amplification primer R described above.

[0014] In some embodiments, the nucleic acid molecule composition or kit described above can be used for detecting Stenotrophomonas maltophilia using the RPA method.

[0015] In some embodiments, the concentrations of amplification primer F and amplification primer R in the kit are both 20 μM.

[0016] In some embodiments, the kit further comprises: a Buffer containing a dNTP Mix, magnesium acetate, and a recombinase polymerase mixture, wherein the magnesium acetate is 280 mM.

[0017] In some embodiments, the reaction solution containing dNTP Mix Buffer includes: 50 mM Tris-HCl buffer, 60 mM potassium acetate, 2 mM dithiothreitol, 270 uM dNTPs Mix, 3 mM ATP, and 5% PEG35K.

[0018] In some embodiments, the recombinase polymerase mixture comprises: Bsu polymerase at a concentration of 50U, Uvs X or RecA recombinase at a concentration of 360ng / ul, Uvs Y at a concentration of 120ng / ul, and SSB protein at 600ng / ul. The difference between RPA and RAA is the source of the recombinase. RPA uses a recombinase derived from T4 phage, while RAA uses a recombinase derived from bacteria or fungi. The concentrations of various enzyme components in the reaction system are the same.

[0019] In a third aspect, the present invention also provides a method for rapid detection of Stenotrophomonas maltophilia, comprising the following steps:

[0020] Step 1: Extract DNA from the sample to be tested;

[0021] Step 2: Perform a constant temperature amplification reaction using amplification primer F and amplification primer R to obtain an amplification product;

[0022] Step 3: Identify the amplified product by gel electrophoresis, and determine the presence of Stenotrophomonas maltophilia in the sample when a band appears at the position of 130 bp of the target band.

[0023] In some embodiments, the temperature of the isothermal amplification reaction in step 2 is 39° C. and the reaction time is 30 min.

[0024] In some embodiments, the isothermal amplification reaction system in step 2 is 30 μL, and the reaction system includes: 1 μL of magnesium acetate, 1 μL of 20 μM amplification primer F, 1 μL of 20 μM amplification primer R, 20 μL of polymerase recombinase mixture, 1 μL of template, and 6 μL of buffer. The negative control is replaced by the same volume of RNase-free water.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] The method of the present invention can reduce the detection time to 30 minutes. When the sample is a traditional Stenotrophomonas maltophilia, qPCR plus the time for heating and cooling also requires at least 60 minutes of reaction time. In the rapid constant temperature amplification of the present invention, the polymerase recombinase used for amplification reacts at the same temperature without heating and cooling time, reducing the total time required for reverse transcriptase and amplification reaction to 30 minutes, shortening the detection cycle, which is of great significance to the development of new constant temperature amplification technology and on-site detection of microorganisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of the electrophoresis results of sample detection.

[0028] Figure 2 This is the electrophoresis diagram for primer specificity detection. DETAILED DESCRIPTION

[0029] The preferred embodiments of the present invention are described in detail below in conjunction with the accompanying drawings so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more definite definition of the protection scope of the present invention.

[0030] This embodiment discloses primers, a kit and applications for rapid detection of Stenotrophomonas maltophilia nucleic acid.

[0031] A universal primer set designed for detecting nucleic acid of Stenotrophomonas maltophilia includes amplification primer F and amplification primer R. The nucleotide sequence of amplification primer F is shown in SEQ ID NO.1, and the nucleotide sequence of amplification primer R is shown in SEQ ID NO.2. SEQ ID No.1:

[0032] ATTCCTGGTGTAGCAGTGAAATGCGTAGA; SEQ ID No.2:

[0033] TTCCTTTGAGTTTCAGTCTTGCGACCGTA.

[0034] The above-mentioned Stenotrophomonas maltophilia genome is a conservative sequence of the β-lactamase gene of Stenotrophomonas maltophilia downloaded from NCBI, compared with Blast and Genbank, and then designed and selected one of the primer pairs with the best parameters using Primer Explorer V5 software. The primer length is controlled at 30-35 bp, and there is less possibility of dimer between the upstream primer and the downstream primer. The primer sequence should completely match the target sequence, and the length of the amplified fragment should be controlled at 100-200 bp.

[0035] The above primer set is used to design a kit for rapid detection of Stenotrophomonas maltophilia nucleic acid, the kit contains a detection solution, the detection solution includes at least the amplification primer F and the amplification primer R, and the concentration of the amplification primer F and the amplification primer R are both 20 μM.

[0036] The kit also includes: a buffer containing dNTP Mix, magnesium acetate and a recombinase polymerase mixture. The reaction solution of the buffer containing dNTP Mix includes: a Tris-HCl buffer with a concentration of 50mM, a potassium acetate with a concentration of 60mM, a dithiothreitol with a concentration of 2mM, a dNTPs Mix with a concentration of 270uM, an ATP with a concentration of 3mM, and a PEG35K with a concentration of 5%.

[0037] The recombinase polymerase mixture contains: 50U of Bsu polymerase, 360ng / ul of Uvs X or RecA recombinase, 120ng / ul of Uvs Y, and 600ng / uL of SSB protein. The difference between RPA and RAA is the source of the recombinase. RPA uses a recombinase derived from T4 phage, while RAA uses a recombinase derived from bacteria or fungi. The concentrations of various enzyme components in the reaction system are the same.

[0038] The method for rapidly detecting Stenotrophomonas maltophilia using the above-mentioned amplification primer set or kit is detected by RPA method, comprising the following steps:

[0039] Step 1: Use conventional nucleic acid extraction methods to extract the DNA of the sample to be tested as a template, and detect the concentration, purity and integrity of the nucleic acid;

[0040] Step 2: Amplify with the amplification primer pair in the above nucleic acid molecule composition, and perform a constant temperature amplification reaction at 39°C for 30 minutes on a heating device, and the heating device can be a water bath, a metal bath or a PCR instrument to obtain an amplification product; wherein, the RPA / RAA constant temperature amplification reaction system is a 30μL reaction system: 1μL of 280mM magnesium acetate, 1μL of 20μM amplification primer F, 1μL of 20μM amplification primer R, 20μL of polymerase recombinase mixture, 1μL of template, and 6μL of buffer. The negative control is replaced by the same volume of RNase-free water.

[0041] Step 3: Select the direct electrophoresis method and use 1-2% agarose gel for electrophoresis. The position of the 245bp target band can be used for determination. If a band appears at the 245bp position of the target band, it indicates that the sample to be tested is positive for Stenotrophomonas maltophilia. If no band appears or the primers form primer dimers due to no amplification, it indicates that the sample to be tested is negative for Stenotrophomonas maltophilia. Figure 1 shown.

[0042] Example 1

[0043] In this example, clinical samples of Candida albicans, Stenotrophomonas maltophilia, Streptococcus pyogenes, Klebsiella pneumoniae, Enterococcus faecalis and Staphylococcus aureus were selected as amplification templates, and the detection method in step 3 was implemented to verify the specificity of the primer pair and the detection method. The results are shown in Figure 2 .

[0044] The above are only a few embodiments of the present application and do not constitute any form of limitation to the present application. Although the present application is disclosed as above with preferred embodiments, it is not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the technical content disclosed above to make slight changes or modifications are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

Claims

1. A universal primer set for rapid detection of Stenotrophomonas maltophilia nucleic acid, characterized in that: It comprises an amplification primer F and an amplification primer R, wherein the nucleotide sequence of the amplification primer F is shown as SEQ ID NO.1, and the nucleotide sequence of the amplification primer R is shown as SEQ ID NO.

2.

2. A kit for rapid detection of Stenotrophomonas maltophilia nucleic acid, characterized in that: Contains a detection solution, wherein the detection solution at least includes the amplification primer F and the amplification primer R according to claim 1.

3. A kit for rapid detection of Stenotrophomonas maltophilia nucleic acid according to claim 2, characterized in that: The concentrations of the amplification primer F and the amplification primer R in the kit are both 20 μM.

4. A kit for rapid detection of Stenotrophomonas maltophilia nucleic acid according to claim 3, characterized in that: The kit also includes: a Buffer containing a dNTP Mix, magnesium acetate and a recombinase polymerase mixture.

5. A method for rapid detection of Stenotrophomonas maltophilia, characterized in that: The RPA method is used for detection, including the following steps: Step 1: Extract DNA from the sample to be tested; Step 2: using the amplification primer F and the amplification primer R described in claim 1 to perform a constant temperature amplification reaction to obtain an amplification product; Step 3: Identify the amplified product by gel electrophoresis, and determine that Stenotrophomonas maltophilia exists in the sample when a band appears at the position of 245 bp of the target band.

6. A method for rapid detection of Stenotrophomonas maltophilia according to claim 5, characterized in that: The temperature of the isothermal amplification reaction in step 2 is 39° C. and the reaction time is 30 min.

7. A method for rapid detection of Stenotrophomonas maltophilia according to claim 5, characterized in that: In step 2, the isothermal amplification reaction system is 30 μL, and the reaction system includes: 1 μL of magnesium acetate, 1 μL of 20 μM amplification primer F, 1 μL of 20 μM amplification primer R, 20 μL of polymerase recombinase mixture, 1 μL of template, and 6 μL of buffer.

8. Use of the primer set according to claim 1, the kit according to claim 2, or the method according to claim 5 in detecting Stenotrophomonas maltophilia and / or whether a sample contains Stenotrophomonas maltophilia.

Images