Nucleic acid sequence for detecting UHT corn plant DBN9641 and detection method thereof

Abstract

The invention relates to a nucleic acid molecule for detecting a transgenic maize event DBN9641 containing a universal hybrid seed production (UHT) and a detection method of the nucleic acid molecule, and the nucleic acid molecule comprises SEQ ID NO: 1 or a complementary sequence of the SEQ ID NO: 1, and SEQ ID NO: 2 or a complementary sequence of the SEQ ID NO: 2. The corn plant DBN9641 is endowed with a function of keeping sterility of a sterile line in a hybrid seed production technology, so that a castration step in a hybrid seed production process is omitted, manpower and material resources are saved, the operation is simple, and the detection method can accurately and quickly identify whether a biological sample contains DNA molecules of the transgenic corn event DBN9641 or not.

Description

Technical Field

[0001] The present invention relates to the field of plant molecular biology, in particular to the field of transgenic crop breeding in agricultural biotechnology research, and specifically to a transgenic corn event DBN9641 containing universal hybridization technology (UHT), a nucleic acid molecule for detecting whether a biological sample contains a specific transgenic corn event DBN9641, and a detection method. Background Art

[0002] The development of plant hybrid breeding technology has improved the quality and quantity of crops to a considerable extent. Due to the application of hybridization technology, various combinations of increased crop yields and expected characteristics (such as disease resistance, insect resistance, heat tolerance, drought tolerance and changes in plant composition) have become possible. Generally, the application of hybridization technology depends on the male parent providing pollen to the female parent, thereby obtaining hybrids. Therefore, methods for controlling plant fertility are very important for the improvement of plant breeding, especially for the development of corn hybrids, which rely on a certain male sterility system.

[0003] The heritable male sterility system is a reliable way to introduce a hemizygous construct into a male sterile plant in a homozygous recessive state, which contains a gene that kills the formation or function of fertile male gametes in the plant when expressed, which is connected to a promoter that prefers to direct the expression of male gametes, and the construct contains a gene that restores the male fertility of the plant. When hybridized with a homozygous recessive male sterile plant, the offspring retains the homozygous recessive state. When the maintainer plant is self-pollinated, 50% homozygous recessive male sterile plants and 50% maintainer plants are produced. In order to easily separate the maintainer plants, the construct can also contain a gene that inhibits or neutralizes the herbicide when expressed, and the maintainer plants can be easily identified by spraying the herbicide.

[0004] It is known that the expression of foreign genes in plants is affected by their chromosomal location, which may be due to chromatin structure (such as heterochromatin) or the proximity of transcriptional regulatory elements (such as enhancers) to the integration site. For this reason, it is usually necessary to screen a large number of events before it is possible to identify events that can be commercialized (i.e., events in which the introduced target gene is optimally expressed). For example, it has been observed in plants and other organisms that the expression level of the introduced gene can vary greatly between events; there may also be differences in the spatial or temporal pattern of expression, such as differences in the relative expression of the transgene between different plant tissues, which is manifested in the fact that the actual expression pattern may not be consistent with the expression pattern expected based on the transcriptional regulatory elements in the introduced gene construct. Therefore, it is usually necessary to generate hundreds or thousands of different events and screen these events for a single event with the expected transgene expression level and expression pattern for commercialization purposes. Events with the expected transgene expression level and expression pattern can be used to introgress the transgene into other genetic backgrounds through sexual outcrossing using conventional breeding methods. The offspring produced by this hybridization method retain the transgene expression characteristics of the original transformant. Applying this strategy model can ensure reliable gene expression in many varieties that are well adapted to local growing conditions.

[0005] It will be useful to be able to detect the presence of a specific event to determine whether the offspring of a sexual hybridization contains the target gene. In addition, methods for detecting specific events will also help to comply with relevant regulations, such as food derived from recombinant crops needs to be formally approved and marked before being put on the market. It is possible to detect the presence of transgenics by any well-known polynucleotide detection method, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These detection methods usually focus on commonly used genetic elements, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA ("flanking DNA") adjacent to the inserted transgenic DNA is known, this method above cannot be used to distinguish different events, particularly those events produced with the same DNA construct. Therefore, a pair of primers that often utilize the junction site of the inserted transgenic and flanking DNA to identify transgenic specific events by PCR, specifically a first primer contained in the flanking sequence and a second primer contained in the inserted sequence. Summary of the invention

[0006] The purpose of the present invention is to provide a corn plant DBN9641 containing Universal Hybridization Technology (UHT) and a nucleic acid sequence and a detection method for detecting the corn plant. The transgenic corn event DBN9641 is endowed with a heritable function of maintaining the sterility of a sterile line in the hybrid seed production technology, and the detection method can accurately and quickly identify whether a biological sample contains a DNA molecule of a specific transgenic corn event DBN9641.

[0007] To achieve the above object, the present invention provides a transgenic corn event DBN9641, the seeds of which have been deposited in the General Microbiological Center of China Microorganism Culture Collection Committee (referred to as CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, zip code 100101) on November 25, 2015, classified as: corn (Zea mays), and the deposit number is CGMCC No. 11678. The deposit will be preserved at the deposit for 30 years.

[0008] To achieve the above objectives, the present invention provides a nucleic acid molecule, whose nucleic acid sequence has at least 11 consecutive nucleotides from positions 1 to 1673 of SEQ ID NO: 3 or its complementary sequence and at least 11 consecutive nucleotides from positions 1674 to 2232 of SEQ ID NO: 3 or its complementary sequence, and / or at least 11 consecutive nucleotides from positions 1 to 447 of SEQ ID NO: 4 or its complementary sequence and at least 11 consecutive nucleotides from positions 448 to 1345 of SEQ ID NO: 4 or its complementary sequence.

[0009] Preferably, the nucleic acid sequence comprises 22-25 consecutive nucleotides in positions 1-1673 of SEQ ID NO: 3 or its complementary sequence and 22-25 consecutive nucleotides in positions 1674-2232 of SEQ ID NO: 3 or its complementary sequence, and / or 22-25 consecutive nucleotides in positions 1-447 of SEQ ID NO: 4 or its complementary sequence and 22-25 consecutive nucleotides in positions 448-1345 of SEQ ID NO: 4 or its complementary sequence.

[0010] Preferably, the nucleic acid sequence comprises SEQ ID NO: 1 or its complementary sequence, and / or SEQ ID NO: 2 or its complementary sequence.

[0011] The SEQ ID NO: 1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5' end of the insertion sequence in the transgenic corn event DBN9641. The SEQ ID NO: 1 or its complementary sequence spans the flanking genomic DNA sequence of the corn insertion site and the DNA sequence at the 5' end of the insertion sequence. The presence of the transgenic corn event DBN9641 can be identified by including the SEQ ID NO: 1 or its complementary sequence. The SEQ ID NO: 2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3' end of the insertion sequence in the transgenic corn event DBN9641. The SEQ ID NO: 2 or its complementary sequence spans the DNA sequence at the 3' end of the insertion sequence and the flanking genomic DNA sequence of the corn insertion site. The presence of the transgenic corn event DBN9641 can be identified by including the SEQ ID NO: 2 or its complementary sequence.

[0012] Preferably, the nucleic acid sequence comprises SEQ ID NO: 3 or its complementary sequence, and / or SEQ ID NO: 4 or its complementary sequence.

[0013] In the present invention, the nucleic acid sequence may be at least 11 or more continuous polynucleotides of any part of the transgenic insertion sequence in the SEQ ID NO: 3 or its complementary sequence (first nucleic acid sequence), or at least 11 or more continuous polynucleotides of any part of the 5' flanking corn genomic DNA region in the SEQ ID NO: 3 or its complementary sequence (second nucleic acid sequence). The nucleic acid sequence may further be homologous to or complementary to a part of the SEQ ID NO: 3 that includes the entire SEQ ID NO: 1. When the first nucleic acid sequence and the second nucleic acid sequence are used together, these nucleic acid sequences comprise a DNA primer set in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO: 1, the presence of the transgenic corn event DBN9641 or its progeny can be diagnosed. The SEQ ID NO: 3 or its complementary sequence is a sequence with a length of 2232 nucleotides located near the insertion junction site at the 5' end of the insertion sequence in the transgenic corn event DBN9641. The SEQ ID NO: 3 or its complementary sequence consists of a 1673-nucleotide corn flanking genomic DNA sequence (nucleotides 1-1673 of SEQ ID NO: 3), a 472-nucleotide DBN10242 construct DNA sequence (nucleotides 1674-2145 of SEQ ID NO: 3) and an 87-nucleotide 5' end DNA sequence of the prZm5126 promoter sequence (nucleotides 2146-2232 of SEQ ID NO: 3). The presence of the transgenic corn event DBN9641 can be identified by containing the SEQ ID NO: 3 or its complementary sequence.

[0014] The nucleic acid sequence may be at least 11 or more consecutive polynucleotides of any part of the transgenic insertion sequence in the SEQ ID NO: 4 or its complementary sequence (third nucleic acid sequence), or at least 11 or more consecutive polynucleotides of any part of the 3' flanking corn genomic DNA region in the SEQ ID NO: 4 or its complementary sequence (fourth nucleic acid sequence). The nucleic acid sequence may further be homologous to or complementary to a portion of the SEQ ID NO: 4 that includes the entire SEQ ID NO: 2. When the third nucleic acid sequence and the fourth nucleic acid sequence are used together, these nucleic acid sequences comprise a DNA primer set in a DNA amplification method for producing an amplification product. When the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product comprising SEQ ID NO: 2, the presence of the transgenic corn event DBN9641 or its progeny can be diagnosed. The SEQ ID NO: 4 or its complementary sequence is a sequence with a length of 1345 nucleotides located near the insertion junction site at the 3' end of the insertion sequence in the transgenic corn event DBN9641. The SEQ ID NO: 4 or its complementary sequence consists of a 253-nucleotide tNos terminator sequence (nucleotides 1-253 of SEQ ID NO: 4), a 194-nucleotide DBN10242 construct DNA sequence (nucleotides 254-447 of SEQ ID NO: 4) and an 898-nucleotide corn integration site flanking genomic DNA sequence (nucleotides 448-1345 of SEQ ID NO: 4). The presence of the transgenic corn event DBN9641 can be identified by containing the SEQ ID NO: 4 or its complementary sequence.

[0015] Furthermore, the nucleic acid sequence comprises SEQ ID NO: 5 or its complementary sequence

[0016] The SEQ ID NO: 5 or its complementary sequence is a sequence of 13528 nucleotides characterizing the transgenic corn event DBN9641, and its specific genome and genetic elements are shown in Table 1. The presence of the transgenic corn event DBN9641 can be identified by the presence of the SEQ ID NO: 5 or its complementary sequence.

[0017] Table 1. Genome and genetic elements contained in SEQ ID NO: 5

[0018]

[0019] As is well known to those skilled in the art, the first, second, third and fourth nucleic acid sequences need not consist of only DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA or other nucleotides or their analogs that do not serve as templates for one or more polymerases. In addition, the probe or primer of the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides in length, which can be selected from the nucleotides set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. When selected from the nucleotides set forth in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the probe and primer can be at least about 21 to about 50 or more consecutive nucleotides in length.

[0020] The nucleic acid sequence or its complementary sequence can be used in a DNA amplification method to produce an amplicon, and the detection of the amplicon is used to diagnose the presence of the transgenic corn event DBN9641 or its progeny in a biological sample; the nucleic acid sequence or its complementary sequence can be used in a nucleotide detection method to detect the presence of the transgenic corn event DBN9641 or its progeny in a biological sample.

[0021] To achieve the above object, the present invention also provides a method for detecting the presence of DNA of transgenic corn event DBN9641 in a sample, comprising:

[0022] contacting the sample to be tested with at least two primers for amplifying a target amplification product in a nucleic acid amplification reaction;

[0023] performing nucleic acid amplification reactions;

[0024] detecting the presence of a target amplification product;

[0025] The target amplification product comprises the nucleic acid sequence.

[0026] Preferably, the amplification product comprises SEQ ID NO: 1 or a complementary sequence thereof, SEQ ID NO: 2 or a complementary sequence thereof, SEQ ID NO: 6 or a complementary sequence thereof, and / or SEQ ID NO: 7 or a complementary sequence thereof.

[0027] Specifically, the two primers include complementary sequences of SEQ ID NO: 1 and SEQ ID NO: 9, SEQ ID NO: 8 and SEQ ID NO: 9, SEQ ID NO: 2 and SEQ ID NO: 11, SEQ ID NO: 10 and SEQ ID NO: 11, or SEQ ID NO: 1 and SEQ ID NO: 2.

[0028] To achieve the above object, the present invention also provides a method for detecting the presence of DNA of transgenic corn event DBN9641 in a sample, comprising:

[0029] contacting a sample to be tested with a probe, wherein the probe comprises the nucleic acid sequence;

[0030] Hybridizing the sample to be detected and the probe under stringent hybridization conditions;

[0031] Detect the hybridization between the sample to be detected and the probe.

[0032] The stringent conditions may be hybridization at 65°C in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution, followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0033] Preferably, the probe has SEQ ID NO: 1 or a complementary sequence thereof, SEQ ID NO: 2 or a complementary sequence thereof, SEQ ID NO: 6 or a complementary sequence thereof, and / or SEQ ID NO: 7 or a complementary sequence thereof.

[0034] Optionally, at least one of said probes is labeled with at least one fluorescent group.

[0035] To achieve the above object, the present invention also provides a method for detecting the presence of DNA of transgenic corn event DBN9641 in a sample, comprising:

[0036] contacting the sample to be tested with a marker nucleic acid molecule, wherein the marker nucleic acid molecule comprises the nucleic acid sequence;

[0037] Hybridizing the sample to be detected and the marker nucleic acid molecule under stringent hybridization conditions;

[0038] The hybridization between the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is performed to determine whether glufosinate tolerance is genetically linked to the marker nucleic acid molecule.

[0039] Preferably, the marker nucleic acid molecule comprises at least one selected from the group consisting of: SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, and / or SEQ ID NO: 6-11 or its complementary sequence.

[0040] To achieve the above object, the present invention also provides a DNA detection kit, comprising at least one DNA molecule, wherein the DNA molecule comprises the nucleic acid sequence, which can be used as one of the DNA primers or probes specific to the transgenic corn event DBN9641 or its progeny.

[0041] Preferably, the DNA molecule has a homologous sequence of SEQ ID NO: 1 or a complementary sequence thereof, a homologous sequence of SEQ ID NO: 2 or a complementary sequence thereof, a homologous sequence of SEQ ID NO: 6 or a complementary sequence thereof, and / or a homologous sequence of SEQ ID NO: 7 or a complementary sequence thereof.

[0042] To achieve the above objectives, the present invention also provides a plant or plant part, whose genome contains a nucleic acid sequence encoding an MS45 protein for restoring male fertility, a nucleic acid sequence encoding an α-amylase, a nucleic acid sequence encoding a glufosinate-tolerant PAT protein, and a nucleic acid sequence in a specific region, wherein the nucleic acid sequence in the specific region contains at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7.

[0043] Preferably, the plant or plant part comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence in its genome.

[0044] Preferably, the plant or plant part comprises the sequence shown in SEQ ID NO: 5 in its genome.

[0045] Preferably, the plant or plant part comprises transgenic maize event DBN9641.

[0046] To achieve the above objectives, the present invention also provides a method for restoring male fertility of corn plants, comprising introducing a nucleic acid sequence encoding an MS45 protein for restoring male fertility and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0047] Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO: 5.

[0048] To achieve the above objectives, the present invention also provides a method for inhibiting the formation or function of fertile male gametes in a corn plant, comprising introducing a nucleic acid sequence encoding α-amylase and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0049] Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO: 5.

[0050] To achieve the above objectives, the present invention also provides a method for disrupting pollen development of corn plants, comprising introducing a nucleic acid sequence encoding α-amylase and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0051] Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO: 5.

[0052] To achieve the above objectives, the present invention also provides a method for degrading starch in corn plant pollen, comprising introducing a nucleic acid sequence encoding α-amylase and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0053] Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO: 5.

[0054] To achieve the above objectives, the present invention also provides a method for reducing the spread of exogenous genes in corn plant pollen, comprising introducing a nucleic acid sequence encoding α-amylase and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0055] Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO: 5.

[0056] To achieve the above objectives, the present invention also provides a method for producing a corn plant tolerant to glufosinate herbicides, comprising introducing a nucleic acid sequence encoding a glufosinate-tolerant PAT protein and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0057] Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO: 5.

[0058] Specifically, the method for producing corn plants tolerant to glufosinate herbicides comprises:

[0059] sexually crossing a first parent corn plant of transgenic corn event DBN9641 that is tolerant to glufosinate herbicide with a second parent corn plant that lacks glufosinate tolerance, thereby producing a plurality of progeny plants;

[0060] treating the progeny plants with a glufosinate-ammonium herbicide;

[0061] The progeny plants are selected to be tolerant to glufosinate-ammonium.

[0062] To achieve the above object, the present invention also provides a method for cultivating corn plants tolerant to glufosinate-ammonium herbicides, comprising:

[0063] Planting at least one corn seed, wherein the genome of the corn seed includes a nucleic acid sequence encoding a glufosinate-tolerant PAT protein and a nucleic acid sequence of a specific region;

[0064] allowing the corn seeds to grow into corn plants;

[0065] Spraying the corn plants with an effective amount of glufosinate-ammonium herbicide, and harvesting the plants having reduced plant damage compared to other plants not having the nucleic acid sequence of the specific region;

[0066] The nucleic acid sequence of the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

[0067] Preferably, the genome of the corn seed comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence.

[0068] Preferably, the genome of the corn seed comprises the sequence shown in SEQ ID NO: 5.

[0069] Further preferably, the corn seeds are (or contain) transgenic corn event DBN9641, and the deposit number of the transgenic corn event is CGMCC No.11678.

[0070] To achieve the above objectives, the present invention also provides a method for protecting plants from damage caused by herbicides, comprising applying an effective dose of a glufosinate herbicide to a field planted with at least one transgenic corn plant, wherein the transgenic corn plant comprises in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, and the transgenic corn plant has tolerance to the glufosinate herbicide.

[0071] Preferably, the genome of the transgenic corn plant comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence.

[0072] Preferably, the genome of the transgenic corn plant comprises the sequence shown in SEQ ID NO:5.

[0073] Further preferably, the transgenic corn plant is (or comprises) transgenic corn event DBN9641, whose deposit number is CGMCC No.11678.

[0074] To achieve the above objectives, the present invention also provides a method for controlling field weeds, comprising applying an effective dose of a glufosinate herbicide to a field planted with at least one transgenic corn plant, wherein the transgenic corn plant comprises in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, and the transgenic corn plant has tolerance to the glufosinate herbicide.

[0075] Preferably, the genome of the transgenic corn plant comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence.

[0076] Preferably, the genome of the transgenic corn plant comprises the sequence shown in SEQ ID NO:5.

[0077] Further preferably, the transgenic corn plant is (or comprises) transgenic corn event DBN9641, whose deposit number is CGMCC No.11678.

[0078] To achieve the above-mentioned purpose, the present invention also provides a method for selecting a plant having a target construct, characterized in that it comprises applying an effective dose of a glufosinate herbicide to a field planted with at least one transgenic corn plant, wherein the transgenic corn plant comprises in its genome at least one nucleic acid sequence selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, and the transgenic corn plant has the target construct, and the target construct comprises a nucleic acid sequence encoding a glufosinate tolerance protein.

[0079] Preferably, the genome of the transgenic corn plant comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence.

[0080] Preferably, the genome of the transgenic corn plant comprises the sequence shown in SEQ ID NO:5.

[0081] Further preferably, the transgenic corn plant is (or comprises) transgenic corn event DBN9641, whose deposit number is CGMCC No.11678.

[0082] To achieve the above object, the present invention also provides a method for maintaining the homozygous recessive state of a male sterile plant, comprising:

[0083] (a) providing a first plant, wherein the first plant comprises a homozygous recessive allele of a male sterility gene MS45, and the first plant is male sterile;

[0084] (b) providing a second plant, the second plant comprising a homozygous recessive allele of a male sterility gene that is the same as the homozygous recessive allele of a male sterility gene contained in the first plant; the second plant comprising a hemizygous construct and a nucleic acid sequence in a specific region, the construct comprising a nucleic acid sequence encoding an MS45 protein that restores male fertility, a nucleic acid sequence encoding an α-amylase, and a nucleic acid sequence encoding a glufosinate-tolerant PAT protein, the nucleic acid sequence in the specific region comprising at least one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7;

[0085] Preferably, the genome of the second plant comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence.

[0086] Preferably, the genome of the second plant comprises the sequence shown in SEQ ID NO:5.

[0087] Further preferably, the second plant is (or comprises) transgenic corn plant DBN9641, whose deposit number is CGMCC No.11678.

[0088] (c) fertilizing said first plant with male gametes from said second plant to produce offspring that retain the homozygous recessive state of said first plant.

[0089] To achieve the above object, the present invention also provides a method for producing seeds from a plant having female gametes and male gametes, comprising:

[0090] (a) introducing a construct into a first plant comprising a homozygous recessive allele of a male sterile gene MS45, wherein the first plant is male sterile; the construct comprises a nucleic acid sequence encoding an MS45 protein that restores male fertility, a nucleic acid sequence encoding an α-amylase, and a nucleic acid sequence encoding a glufosinate-tolerant PAT protein, and the first plant into which the construct is introduced further comprises a nucleic acid sequence of a specific region, including at least one of the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7;

[0091] Preferably, the genome of the first plant into which the construct is introduced comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202 to 12274 of SEQ ID NO: 5, and SEQ ID NO: 2 in sequence.

[0092] Preferably, the first plant into which the construct is introduced comprises the sequence shown in SEQ ID NO:5 in its genome.

[0093] Further preferably, the first plant into which the construct is introduced is the transgenic corn plant DBN9641, whose deposit number is CGMCC No.11678.

[0094] On the other hand, step (a) may also be: planting at least one corn seed to grow the corn seed into a first plant; the corn seed is (or contains) transgenic corn plant DBN9641, whose deposit number is CGMCC No.11678.

[0095] (b) self-fertilizing the first plant;

[0096] (c) producing seeds containing the construct.

[0097] Preferably, seeds containing the construct and seeds of a normal sterile line (not containing the construct) are produced.

[0098] Preferably, the method further comprises the step of (d) identifying plants containing the construct;

[0099] More preferably, the identification step is: planting seeds produced after self-fertilization of the first plant, growing the seeds into plants to be identified, spraying the plants to be identified with glufosinate ammonium, and the plants containing the construct have reduced plant damage compared to plants not containing the construct.

[0100] To achieve the above objectives, the present invention also provides an agricultural product or commodity produced from the transgenic corn event DBN9641, wherein the agricultural product or commodity is corn flour, corn meal, corn oil, corn starch, corn gluten, corn tortillas, cosmetics or fillers.

[0101] Preferably, the agricultural product or commodity comprises DNA from transgenic maize event DBN9641.

[0102] More preferably, the agricultural product or commodity comprises the nucleic acid sequence described above.

[0103] Further preferably, the agricultural product or commodity comprises SEQ ID NO:1 and / or SEQ ID NO:2.

[0104] In the nucleic acid sequence and detection method for detecting UHT corn plants of the present invention, the following definitions and methods can better define the present invention and guide ordinary technicians in the field to implement the present invention. Unless otherwise specified, the terms are understood according to the conventional usage of ordinary technicians in the field.

[0105] The term "corn" refers to maize (Zea mays) and includes all plant varieties that can be crossed with maize, including wild maize species.

[0106] The term “including” means “including but not limited to”.

[0107] The term "plant" includes whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stalks, roots, root tips, anthers, etc. It should be understood that the parts of transgenic plants within the scope of the present invention include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves and roots, which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of the present invention and are therefore at least partially composed of transgenic cells.

[0108] The term "cereal" means mature seeds produced by commercial growers for purposes other than planting or breeding species. If these plants include transgenic corn event DBN9641, progeny, variants and mutants of the regenerated plants are also included in the scope of the present invention. The types of plants that can be used in the method of the present invention are generally as extensive as the types of higher plants that are susceptible to transformation techniques, including both monocotyledons and dicotyledons.

[0109] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences before the coding sequence (5' non-coding sequences) and regulatory sequences after the coding sequence (3' non-coding sequences). "Native gene" refers to a gene found in nature with its own regulatory sequences. "Chimeric gene" refers to any gene that is not a natural gene, which contains regulatory and coding sequences that are not found in nature. "Endogenous gene" refers to a natural gene that is located in its natural location in the genome of an organism. "Foreign gene" is a foreign gene that is now present in the genome of an organism and did not exist originally, and also refers to a gene introduced into a recipient cell through a transgenic step. Foreign genes can include natural genes inserted into non-natural organisms or chimeric genes. "Transgene" is a gene that has been introduced into the genome through a transformation procedure. The site in the plant genome where the recombinant DNA has been inserted can be called an "insertion site" or "target site."

[0110] "Flanking DNA" can comprise the exogenous (heterologous) DNA naturally present in the genome of the organism of for example plant or introduced by the transformation process, for example the fragment relevant to the transformation event.Therefore, flanking DNA can comprise the combination of natural and exogenous DNA.In the present invention, "flanking region" or "flanking sequence" or "genome border region" or "genome border sequence" refers to at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 base pairs or longer sequence, which is located at the direct upstream or downstream of the initial exogenous insertion DNA molecule and adjacent to the initial exogenous insertion DNA molecule.When this flanking region is located at downstream, it can also be referred to as "left border flank" or "3' flank" or "3' genome border region" or "genome 3' border sequence" etc. When the flanking region is located upstream, it may also be referred to as the “right border flank” or the “5′ flank” or the “5′ genomic border region” or the “genomic 5′ border sequence” or the like.

[0111] Transformation procedures that cause random integration of foreign DNA can result in transformants containing different flanking regions, which are specifically contained in each transformant. When recombinant DNA is introduced into plants by traditional hybridization, its flanking regions are usually not changed. Transformants will also contain a unique junction between a segment of heterologous insert DNA and genomic DNA or between two segments of genomic DNA or between two segments of heterologous DNA. "Joint" is the point where two specific DNA fragments connect. For example, the junction is present at the position where the insert DNA connects to the flanking DNA. Junction points are also present in transformed organisms, where two DNA fragments are connected together in a manner modified from natural organisms. "Joint DNA" refers to the DNA comprising a junction point.

[0112] The present invention provides a transgenic corn event called DBN9641 and its progeny, wherein the transgenic corn event DBN9641 is the corn plant DBN9641, which includes plants and seeds of the transgenic corn event DBN9641 and plant cells or their regenerable parts, and the plant parts of the transgenic corn event DBN9641 include but are not limited to cells, pollen, ovules, flowers, buds, roots, stems, silks, inflorescences, ears, leaves and products from the corn plant DBN9641, such as corn flour, corn meal, corn oil, corn steep liquor, corn silk, corn starch and biomass remaining in the corn crop field.

[0113] The transgenic corn event DBN9641 of the present invention comprises a DNA construct, and when it is expressed in plant cells, the transgenic corn event DBN9641 is endowed with heritable hybrid seed production technology. The DNA construct comprises three expression cassettes in series, the first expression cassette comprises a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter is operably connected to the MS45 gene for restoring male fertility of corn, and the MS45 gene for restoring male fertility can make male sterile corn plants (ms45) produce fertile pollen. The second expression cassette comprises a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter is operably connected to the gene encoding corn alpha amylase (Amylase), and the nucleic acid sequence of the Amylase protein can prevent the accumulation of starch in the newly grown pollen of cereals, thereby preventing the pollen from developing normally. The third expression cassette comprises a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operably linked to a gene encoding phosphinothricin N-acetyltransferase (PAT), the nucleic acid sequence of the PAT protein being tolerant to glufosinate herbicide, so that seeds containing transgenic corn event DBN9641 can be screened in seed selection. Further, the promoter can be a suitable promoter isolated from plants, including constitutive, inducible and / or tissue-specific promoters, the suitable promoters including but not limited to constitutive promoters, such as cauliflower mosaic virus (CaMV) 35S promoter, ubiquitin promoter, actin promoter, etc.; tissue-specific promoters, in particular male gamete-preferred promoters, such as the male tissue regulatory sequence of 5126, the regulatory sequence of polygalacturonase 47 gene, the regulatory sequence of Zm13 gene, etc. The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants, and the suitable polyadenylation signal sequence includes, but is not limited to, a polyadenylation signal sequence derived from the nopaline synthase (NOS) gene of Agrobacterium tumefaciens, a 35S terminator derived from cauliflower mosaic virus (CaMV), a terminator derived from pea ribulose-1,5-bisphosphate carboxylase / oxygenase E9, a polyadenylation signal sequence derived from a proteinase inhibitor II (PIN II) gene, a terminator derived from the In2-1 gene, a genome-related 3' untranslated region, and the like.

[0114] In addition, the expression cassette may also include other genetic elements, including but not limited to enhancers and signal peptides / transit peptides. The enhancer may enhance the expression level of the gene, including but not limited to tobacco etch virus (TEV) translation activator, CaMV35S enhancer and FMV35S enhancer. For receptor proteins, the signal peptide / transit peptide may be heterologous, including but not limited to, the transit peptide of acyl transporter protein, the small subunit of RUBISCO, plant EPSPS enzyme, corn Brittle-1 transit peptide, etc.; there are many options for expressing products to specific organelles, for example, barley alpha amylase sequences are usually used to guide expression to the endoplasmic reticulum.

[0115] The DNA construct is introduced into the plant using a transformation method, including but not limited to Agrobacterium-mediated transformation, biolistic transformation, and pollen tube pathway transformation.

[0116] The Agrobacterium-mediated transformation method is a common method for plant transformation. The foreign DNA to be introduced into the plant is cloned between the left and right border consensus sequences of the vector, i.e., the T-DNA region. The vector is transformed into Agrobacterium cells, which are then used to infect plant tissues, and the T-DNA region of the vector containing the foreign DNA is inserted into the plant genome.

[0117] The gene gun transformation method is to bombard plant cells with vectors containing foreign DNA (particle-mediated biolistic transformation).

[0118] The pollen tube channel transformation method utilizes the natural pollen tube channel (also known as pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into the embryo sac through the nucellus channel.

[0119] Following transformation, transgenic plants must be regenerated from the transformed plant tissue and progeny harboring the foreign DNA selected using appropriate markers.

[0120] DNA construct is the combination that DNA molecule is connected to each other, and this combination provides one or more expression cassettes.DNA construct is preferably can self-replicate in bacterial cell, and contains the plasmid of different restriction endonuclease sites, and the restriction endonuclease sites contained are used to import the DNA molecule that functional gene element is provided, i.e. promoter, intron, leader sequence, encoding sequence, 3 ' terminator region and other sequences.The expression cassette contained in the DNA construct comprises the necessary gene element that provides the transcription of messenger RNA, and the expression cassette can be designed to express in prokaryotic cell or eukaryotic cell.Expression cassette of the present invention is designed to express in plant cell most preferably.

[0121] Transgenic "events" are obtained by transforming plant cells with heterologous DNA constructs, i.e., comprising at least one nucleic acid expression cassette containing a target gene, inserted into the plant genome by a transgenic method to produce a plant population, regenerating the plant population, and selecting specific plants with the characteristics of insertion at a specific genomic site. The term "event" refers to the original transformant including the heterologous DNA and the offspring of the transformant. The term "event" also refers to the offspring obtained by sexually crossing between the transformant and individuals of other varieties containing heterologous DNA, even after repeated backcrossing with the recurrent parent, the inserted DNA and flanking genomic DNA from the transformant parent are present in the same chromosomal position in the hybrid offspring. The term "event" also refers to a DNA sequence from the original transformant, which contains the inserted DNA and the flanking genomic sequence closely adjacent to the inserted DNA, and the DNA sequence is expected to be transferred to the offspring, which is produced by sexually crossing the parental line containing the inserted DNA (e.g., the original transformant and the offspring produced by its self-pollination) with the parental line that does not contain the inserted DNA, and the offspring receives the inserted DNA containing the target gene.

[0122] As used herein, "recombinant" refers to a form of DNA and / or protein and / or organism that is not normally found in nature and is therefore produced by human intervention. Such human intervention may produce recombinant DNA molecules and / or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two otherwise separate sequence segments, for example by chemical synthesis or by manipulation of separate nucleic acid segments by genetic engineering techniques. Techniques for performing nucleic acid manipulations are well known.

[0123] The term "transgenic" includes any cell, cell line, callus, tissue, plant part or plant, the genotype of which is changed due to the presence of heterologous nucleic acid, including the transgenic body originally changed in this way and the progeny individuals generated by the initial transgenic body through sexual hybridization or asexual reproduction. In the present invention, the term "transgenic" does not include changes in the genome (chromosomal or extrachromosomal) by conventional plant breeding methods or naturally occurring events, such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.

[0124] "Heterologous" in the present invention means that the first molecule is not normally found in nature in combination with the second molecule. For example, a molecule can be derived from a first species and inserted into the genome of a second species. Such a molecule is thus heterologous to the host and is artificially introduced into the genome of the host cell.

[0125] Cultivation of transgenic corn event DBN9641 containing hybrid seed production technology can be carried out by the following steps: first, sexually hybridizing the first parent corn plant and the second parent corn plant, thereby producing a variety of first-generation progeny plants, wherein the first parent corn plant is composed of corn plants cultivated from transgenic corn event DBN9641 and its offspring, i.e., derived from the transformation of the expression cassette of the present invention that grants hybrid seed production technology. The first parent plant is pollinated by the second parent plant, thereby producing a plurality of first progeny plants, and selecting the first progeny plant containing the hybrid seed production technology event. The first progeny plant can be self-pollinated, thereby producing a plurality of second progeny plants; and selecting the plant containing the hybrid seed production technology event from the second progeny plant. These steps can also include backcrossing the progeny plant containing the hybrid seed production technology event with the second parent plant or the third parent plant, thereby producing a plant containing the hybrid seed production technology event. The hybrid seed production technology event is transmitted by female gametes rather than male gametes.

[0126] It should also be understood that two different transgenic plants can also be crossed to produce offspring containing two independent, segregating added exogenous genes. Selfing of appropriate offspring can result in offspring plants that are homozygous for both added exogenous genes. Backcrossing of parental plants and outcrossing with non-transgenic plants as described above are also contemplated, as are asexual reproduction.

[0127] The term "germplasm" refers to an individual, group of individuals, or a clone representing a genotype, variety, species or culture, or its genetic material.

[0128] The term "hybridized" or "crossing" is intended to mean the fusion of gametes, e.g., in plants, by pollination to produce progeny (i.e., cells, seeds, or plants). The term includes sexual crosses (a plant is pollinated by a genetically different plant) and self-pollinations (i.e., pollen and ovules are from the same plant or genetically identical plants).

[0129] The term "introgression" refers to the transmission of a desired allele of a genetic locus from one genetic background to another. In some methods, the desired allele can be introgressed by sexual crosses between two parents, wherein at least one parent has the desired allele in its genome.

[0130] The term "probe" is a separate nucleic acid molecule to which a conventional detectable label or reporter molecule is bound, for example, a radioisotope, a ligand, a chemiluminescent agent or an enzyme. Such a probe is complementary to a strand of a target nucleic acid, and in the present invention, the probe is complementary to a DNA strand from the genome of transgenic corn event DBN9641, whether the genomic DNA is from transgenic corn event DBN9641 or seeds or from plants or seeds or extracts of transgenic corn event DBN9641. The probe of the present invention includes not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of the target DNA sequence.

[0131] The term "primer" is a separate nucleic acid molecule that anneals to a complementary target DNA strand through nucleic acid hybridization, forms a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pair of the present invention relates to its use in amplification of a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0132] The length of the probe and primer is generally 11 polynucleotides or more, preferably 18 polynucleotides or more, more preferably 24 polynucleotides or more, and most preferably 30 polynucleotides or more. Such probes and primers hybridize specifically with the target sequence under highly stringent hybridization conditions. Although probes that are different from the target DNA sequence and that maintain hybridization ability to the target DNA sequence can be designed by conventional methods, preferably, the probes and primers of the present invention have complete DNA sequence identity with the continuous nucleic acids of the target sequence.

[0133] Primers and probes based on the flanking genomic DNA and insertion sequences of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material derived from transgenic corn event DBN9641 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule comprises the transgenic insertion sequence and the flanking regions of the corn genome, and fragments of the DNA molecule can be used as primers or probes.

[0134] The nucleic acid probe and primer of the present invention hybridize with the target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from transgenic corn event DBN9641 in a sample. Nucleic acid molecules or fragments thereof can be specifically hybridized with other nucleic acid molecules under certain circumstances. As used in the present invention, if two nucleic acid molecules can form an antiparallel double-stranded nucleic acid structure, it can be said that the two nucleic acid molecules can be specifically hybridized with each other. If two nucleic acid molecules show complete complementarity, then one of the nucleic acid molecules is said to be the "complement" of another nucleic acid molecule. As used in the present invention, when each nucleotide of a nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, then the two nucleic acid molecules are said to show "complete complementarity". If two nucleic acid molecules can hybridize with sufficient stability so that they anneal and bind to each other under at least conventional "low stringency" conditions, then the two nucleic acid molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with sufficient stability so that they anneal and bind to each other under conventional "high stringency" conditions, then the two nucleic acid molecules are said to have "complementarity". Deviations from complete complementarity are permissible as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to serve as a primer or probe, it is only necessary to ensure that it has sufficient complementarity in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.

[0135] As used in the present invention, a substantially homologous sequence is a nucleic acid molecule that can specifically hybridize with the complementary strand of another matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions that promote DNA hybridization, for example, treatment with 6.0× sodium chloride / sodium citrate (SSC) at about 45°C, followed by washing with 2.0×SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from about 2.0×SSC, 50°C for low stringency conditions to about 0.2×SSC, 50°C for high stringency conditions. In addition, the temperature conditions in the washing step can be increased from about 22°C at room temperature for low stringency conditions to about 65°C for high stringency conditions. Both the temperature conditions and the salt concentration can be changed, or one of them can be kept constant while the other variable is changed. Preferably, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 or their complementary sequences, or any fragments of the above sequences under moderate stringency conditions, such as at about 2.0×SSC and about 65°C. More preferably, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 or their complementary sequences, or any fragments of the above sequences under highly stringent conditions. In the present invention, the preferred marker nucleic acid molecule has SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7 or their complementary sequences, or any fragments of the above sequences. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7 or its complementary sequence, or any fragment of the above sequence. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 7 can be used as markers in plant breeding methods to identify the offspring of genetic crosses. The hybridization of the probe to the target DNA molecule can be detected by any method known to those skilled in the art, including but not limited to fluorescent labels, radioactive labels, antibody-based labels and chemiluminescent labels.

[0136] With respect to amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "stringent conditions" refer to conditions that only allow the primers to hybridize to the target nucleic acid sequence in a DNA thermal amplification reaction, and primers having a wild-type sequence (or its complementary sequence) corresponding to the target nucleic acid sequence are able to bind to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

[0137] The term "specifically binds to (target sequence)" means that under stringent hybridization conditions, the probe or primer hybridizes only to the target sequence in a sample containing the target sequence.

[0138] As used herein, "amplified DNA" or "amplicon" refers to the nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a corn plant is produced by sexual hybridization containing the transgenic corn event DBN9641 of the present invention, or whether a corn sample collected from a field contains the transgenic corn event DBN9641, or whether a corn extract, such as meal, flour or oil, contains the transgenic corn event DBN9641, DNA extracted from a corn plant tissue sample or extract can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that is diagnostic for the presence of DNA of the transgenic corn event DBN9641. The primer pair includes a first primer derived from a flanking sequence in the plant genome adjacent to the inserted exogenous DNA insertion site, and a second primer derived from the inserted exogenous DNA. The amplicon has a certain length and sequence, and the sequence is also diagnostic for the transgenic corn event DBN9641. The length of the amplicon can range from the combined length of the primer pair plus one nucleotide base pair, preferably plus about fifty nucleotide base pairs, more preferably plus about two hundred and fifty nucleotide base pairs, and most preferably plus about four hundred and fifty nucleotide base pairs or more.

[0139] Alternatively, the primer pairs can be derived from flanking genomic sequences on both sides of the inserted DNA to produce an amplicon comprising the entire inserted nucleotide sequence. One of the primer pairs derived from the plant genomic sequence can be located at a distance from the inserted DNA sequence, the distance ranging from one nucleotide base pair to about 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed in a DNA thermal amplification reaction.

[0140] Nucleic acid amplification reaction can be achieved by any nucleic acid amplification reaction method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify up to 22kb of genomic DNA and up to 42kb of phage DNA. These methods and other DNA amplification methods in the art can be used in the present invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic corn event DBN9641 can be amplified by using the provided primer sequences to amplify the genome of the transgenic corn event DBN9641, and after amplification, the PCR amplicon or cloned DNA is subjected to standard DNA sequencing.

[0141] A DNA detection kit based on a DNA amplification method contains DNA primer molecules that specifically hybridize to the target DNA under appropriate reaction conditions and amplify a diagnostic amplicon. The kit can provide an agarose gel-based detection method or many methods known in the art for detecting diagnostic amplicons. A kit containing DNA primers homologous or complementary to any portion of the corn genomic region of SEQ ID NO: 3 or SEQ ID NO: 4, and homologous or complementary to any portion of the transgenic insertion region of SEQ ID NO: 5 is provided by the present invention. A primer pair particularly identified as useful in the DNA amplification method is SEQ ID NO: 8 and SEQ ID NO: 9, which amplifies a diagnostic amplicon homologous to a portion of the 5' transgenic / genomic region of transgenic corn event DBN9641, wherein the amplicon includes SEQ ID NO: 1. Other DNA molecules used as DNA primers can be selected from SEQ ID NO: 5.

[0142] The amplicons generated by these methods can be detected by a variety of techniques. One such method is GeneticBit Analysis, in which a DNA oligonucleotide strand is designed that spans the insert DNA sequence and the adjacent flanking genomic DNA sequence. The oligonucleotide strand is immobilized in a microwell of a microplate, and after PCR amplification of the target region (using one primer each in the insert sequence and the adjacent flanking genomic sequence), the single-stranded PCR product can be hybridized to the immobilized oligonucleotide strand and used as a template for a single-base extension reaction using a DNA polymerase and ddNTPs specifically labeled for the next expected base. The results can be obtained by fluorescence or ELISA-type methods. The signal represents the presence of the insert / flanking sequence, which indicates that the amplification, hybridization, and single-base extension reactions were successful.

[0143] Another method is Pyrosequencing technology. This method designs an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer is used in the inserted sequence and one primer is used in the adjacent flanking genomic sequence), and then incubated with DNA polymerase, ATP, sulfhydryl enzyme, luciferase, apyrase, adenosine-5'-phosphosulfate and luciferin. dNTPs are added separately and the generated light signals are measured. The light signal represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization, and single-base or multi-base extension reaction are successful.

[0144] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9: 492-498, 1999) is also a method that can be used to detect the amplicons of the present invention. Using this method requires designing an oligonucleotide chain that spans the inserted DNA sequence and the adjacent genomic DNA binding site. The oligonucleotide chain is hybridized with the single-stranded PCR product of the target region (one primer is used in the inserted sequence and one primer is used in the adjacent flanking genomic sequence), and then incubated with a DNA polymerase and a fluorescently labeled ddNTP. Single-base extension will result in the insertion of the ddNTP. This insertion can be measured by a change in its polarization using a fluorimeter. The change in polarization represents the presence of the inserted / flanking sequence, which indicates that the amplification, hybridization and single-base extension reactions are successful.

[0145] Taqman is described as a method for detecting and quantifying the presence of a DNA sequence and is described in detail in the instructions provided by the manufacturer. As a brief example, a FRET oligonucleotide probe is designed that spans the insert DNA sequence and the adjacent genomic flanking binding site. The FRET probe and PCR primers (one primer each in the insert sequence and the adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the cleavage of the fluorescent and quenching portions of the FRET probe and the release of the fluorescent portion. The generation of a fluorescent signal represents the presence of the insert / flanking sequence, which indicates that amplification and hybridization were successful.

[0146] Based on the hybridization principle, the applicable technology that is used to detect the plant material that derives from transgenic corn event DBN9641 can also include Southern blot hybridization, Northern blot hybridization and in situ hybridization.Especially, the applicable technology includes incubation probe and sample, washing to remove unbound probe and detection probe whether hybridization.The described detection method depends on the type of probe attached mark, for example, can detect radiolabeled probe by X-ray film exposure and development, or realize color change and can detect enzyme-labeled probe by substrate conversion.

[0147] Tyangi et al. (Nat. Biotech. 14:303-308, 1996) introduced the application of molecular markers in sequence detection. Briefly described as follows, a FRET oligonucleotide probe is designed that spans the inserted DNA sequence and the adjacent genomic flanking binding site. The unique structure of the FRET probe causes it to contain a secondary structure that can maintain the fluorescent part and the quenching part in close proximity. The FRET probe and PCR primers (one primer each is used in the inserted sequence and the adjacent flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. After successful PCR amplification, hybridization of the FRET probe and the target sequence results in the loss of the probe secondary structure, thereby spatially separating the fluorescent part and the quenching part and generating a fluorescent signal. The generation of the fluorescent signal represents the presence of the inserted / flanking sequence, which indicates that the amplification and hybridization are successful.

[0148] Other described methods, such as microfluidics, provide methods and devices for separating and amplifying DNA samples. Optical dyes are used to detect and measure specific DNA molecules. Nanotube devices containing electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and can thus be detected are useful for detecting DNA molecules of the present invention.

[0149] A DNA detection kit can be developed using the compositions of the present invention and methods described or known in the art of DNA detection. The kit is useful for identifying the presence of DNA from transgenic corn event DBN9641 in a sample, and can also be used to grow corn plants containing DNA from transgenic corn event DBN9641. The kit can contain DNA primers or probes that are homologous or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes that are homologous or complementary to DNA contained in transgenic genetic elements of the DNA, and these DNA sequences can be used in DNA amplification reactions or as probes in DNA hybridization methods. Contained in the corn genome and in Figure 1The DNA structure of the transgenic insertion sequence and the maize genome binding site illustrated in Table 1 comprises: the maize DBN9641 flanking genomic region located at the 5' end of the transgenic insertion sequence, a portion of the insertion sequence from the right border region (RB) of Agrobacterium, a first expression cassette consisting of the maize 5126 promoter (prZm5126) operably linked to the maize MS45 gene that restores male fertility, a second expression cassette consisting of the maize polygalacturonase 47 gene promoter (prZmPG47) operably linked to the maize Brittle-1 transit peptide (spZmbt1) operably linked to the maize α The invention relates to a method for amplifying DNA from a plant, wherein the first expression cassette comprises a maize ubiquitin promoter (prZmUbi1), operably linked to a phosphinothricin N-acetyltransferase (cPAT) from Streptomyces that provides glufosinate tolerance, and operably linked to a polyadenylation signal sequence (tNos) from the nopaline synthase gene from Agrobacterium tumefaciens, a portion of the insertion sequence from the left border region (LB) of Agrobacterium tumefaciens, and a flanking genomic region of the maize plant DBN9641 located at the 3' end of the transgenic insertion sequence (SEQ ID NO: 5). In the DNA amplification method, the DNA molecule used as a primer can be any portion of the transgenic insertion sequence in the maize plant DBN9641, or any portion of the DNA region flanking the maize genome in the transgenic maize event DBN9641.

[0150] Transgenic corn event DBN9641 can be combined with at least one other trait to produce plants containing multiple desired trait combinations, including but not limited to: herbicide tolerance traits, such as glyphosate, 2,4-D, dicamba, etc.; or insect resistance traits, such as Cry, Vip genes, etc.; or desirable traits for animal feed, such as high oil content, balanced amino acid content, high lysine in barley, high methionine protein, etc.; or enhanced digestibility, such as modified storage proteins, thioredoxin, etc.; or low linolenic acid content and high oleic acid content; or disease resistance traits and desirable traits for processing / products, such as improved oil, starch, and polymer / bioplastics, etc. Hybrid seed production technology polynucleotides can also be combined with polynucleotides that provide agronomic traits, such as male sterility, increased stalk strength, altered flowering time, or transformation technology traits, such as cell cycle regulation or gene targeting. All of these various combinations of different traits, when bred with the transgenic corn event DBN9641 of the present invention, can provide improved hybrid transgenic corn varieties with multiple desired traits. These varieties can exhibit superior characteristics compared to non-transgenic varieties and transgenic varieties with a single trait.

[0151] The present invention provides a UHT corn plant and a nucleic acid sequence and a detection method for detecting the plant. The present invention introduces a hemizygous construct into a corn plant having a homozygous recessive allele ms45 of male sterility, thereby endowing it with hybrid seed production technology, and obtains a transgenic corn event DBN9641. The construct includes: MS45 protein that restores male fertility, which can make the male sterile corn plant (MS45) produce fertile pollen; and alpha amylase, which can prevent the accumulation of starch in new pollen, so that the pollen cannot develop normally; and phosphinothricin N-acetyltransferase (PAT) protein of Streptomyces for glufosinate resistance, which endows the plant with tolerance to glufosinate.

[0152] The genetically modified corn event DBN9641 has the following advantages:

[0153] 1) The transgenic corn event DBN9641 has a homozygous recessive allele (ms45) for male sterility and a hemizygous construct, which can restore the male sterility trait of the transgenic corn event DBN9641 and enable it to produce fertile pollen; the fertile pollen only contains the homozygous recessive allele (ms45) for male sterility, which is caused by the interference of the α-amylase with the formation or function of pollen; the fertile pollen is used to fertilize the male sterile first plant (having the homozygous recessive allele ms45 for male sterility) to produce offspring that maintain the homozygous recessive state of the first plant; the method omits the step of emasculation in the hybrid seed production process, saves manpower and material resources, has great cost-effectiveness, and is simple to operate;

[0154] 2) The pollen produced by the transgenic corn event DBN9641 does not contain the construct, but 50% of the ovules (female gametes) contain the construct; the transgenic corn event DBN9641 is self-fertilized and the resulting seeds are planted. Since the PAT protein has an inhibitory or neutralizing effect on glufosinate herbicide, the plants containing the construct can be easily identified by spraying the glufosinate herbicide, and the sorting efficiency is high and the effect is good;

[0155] 3) The fertile pollen produced by the transgenic corn event DBN9641 contains only the homozygous recessive allele (ms45) for male sterility, so the fertile pollen is non-transgenic for the construct, and the offspring produced by fertilizing the first plant (having the homozygous recessive allele ms45 for male sterility) with the fertile pollen is still non-transgenic. In addition, the three expression cassettes of the construct are linked to the same DNA segment and exist on a single locus in the genome of the transgenic corn event DBN9641, which provides enhanced breeding efficiency and enables the use of molecular markers to track transgenic inserts in the breeding population and its progeny. At the same time, SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, or SEQ ID NO: 7 or its complementary sequence in the detection method of the present invention can be used as a DNA primer or probe to produce an amplification product diagnosed as the transgenic corn event DBN9641 or its progeny, which can quickly, accurately and stably identify the presence of plant materials derived from the transgenic corn event DBN9641.

[0156] Sequence Description

[0157] SEQ ID NO: 1 The insertion site of the 5' transgenic fragment in transgenic maize event DBN9641 and 11 nucleotides on each side of the maize genomic DNA;

[0158] SEQ ID NO:2 The insertion site of the 3' transgenic fragment in transgenic maize event DBN9641 and 11 nucleotides on each side of the maize genomic DNA;

[0159] SEQ ID NO: 3 A sequence of 2232 nucleotides in length located near the insertion junction at the 5' end of the insertion sequence in transgenic maize event DBN9641;

[0160] SEQ ID NO: 4 a sequence of 1345 nucleotides in length located near the insertion junction at the 3' end of the insertion sequence in transgenic maize event DBN9641;

[0161] SEQ ID NO: 5 entire T-DNA sequence, 5' and 3' flanking maize genomic sequence;

[0162] SEQ ID NO:6 is a sequence located within SEQ ID NO:3, spanning the DBN10242 construct DNA sequence and the prZm5126 promoter sequence;

[0163] SEQ ID NO: 7 is a sequence located on SEQ ID NO: 4, spanning the tNos transcription termination sequence and the DBN10242 construct DNA sequence;

[0164] SEQ ID NO: 8 amplifies the first primer of SEQ ID NO: 3;

[0165] SEQ ID NO: 9 amplifies the second primer of SEQ ID NO: 3;

[0166] SEQ ID NO: 10 amplifies the first primer of SEQ ID NO: 4;

[0167] SEQ ID NO: 11 amplifies the second primer of SEQ ID NO: 4;

[0168] SEQ ID NO: 12 Primer on 5' flanking genomic sequence;

[0169] SEQ ID NO: 13 a primer on T-DNA that pairs with SEQ ID NO: 12;

[0170] Primers on the genomic sequence flanking SEQ ID NO: 143', which when paired with SEQ ID NO: 12 can detect whether the transgene is homozygous or heterozygous;

[0171] SEQ ID NO: 15: a primer on T-DNA that pairs with SEQ ID NO: 14;

[0172] SEQ ID NO: 16 Primer 1 for Taqman detection of MS45;

[0173] SEQ ID NO: 17 Primer 2 for Taqman detection of MS45;

[0174] SEQ ID NO: 18 Taqman probe 1 for detecting MS45;

[0175] SEQ ID NO: 19 Primer 3 for Taqman detection of PAT;

[0176] SEQ ID NO: 20 Primer 4 for Taqman detection of PAT;

[0177] SEQ ID NO: 21Taqman probe 2 for detecting PAT;

[0178] SEQ ID NO: 22 Primer 5 for Taqman detection of Amylase;

[0179] SEQ ID NO: 23 Primer 6 for Taqman detection of Amylase;

[0180] SEQ ID NO: 24 Taqman probe 3 for detecting Amylase;

[0181] SEQ ID NO: 25 The first primer of the endogenous gene Ubiquitin of maize;

[0182] SEQ ID NO: 26 The second primer of the endogenous gene Ubiquitin of maize;

[0183] SEQ ID NO: 27 probe for MS45 in Southern hybridization detection;

[0184] SEQ ID NO: 28 probe for PAT in Southern hybridization detection;

[0185] SEQ ID NO: 29 probe for Amylase in Southern hybridization detection;

[0186] SEQ ID NO:30 is a primer located on the T-DNA, in the opposite direction to SEQ ID NO:13;

[0187] SEQ ID NO:31 is a primer located on the T-DNA, in the same orientation as SEQ ID NO:13, used to obtain flanking sequences;

[0188] SEQ ID NO:32 is a primer located on the T-DNA, in the opposite direction to SEQ ID NO:13, used to obtain flanking sequences;

[0189] SEQ ID NO:33 is a primer located on the T-DNA in the opposite direction to SEQ ID NO:15;

[0190] SEQ ID NO:34 is a primer located on the T-DNA, in the opposite direction to SEQ ID NO:15, used to obtain flanking sequences;

[0191] The primer of SEQ ID NO:35 located on the T-DNA is in the same orientation as SEQ ID NO:15 and is used to obtain the flanking sequence.

[0192] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0193] Figure 1 It is a schematic diagram of the structure of the transgenic insertion sequence and the corn genome binding site for detecting the nucleic acid sequence of UHT corn plant DBN9641 and the detection method thereof of the present invention;

[0194] Figure 2 It is a schematic diagram of the structure of the recombinant expression vector DBN10242 used for detecting the nucleic acid sequence of UHT corn plant DBN9641 and the detection method thereof of the present invention;

[0195] Figure 3 The tassel and pollen staining diagrams are used for detecting the nucleic acid sequence of the UHT corn plant DBN9641 and the detection method thereof according to the present invention. DETAILED DESCRIPTION

[0196] The technical scheme of the present invention for detecting the nucleic acid sequence of UHT corn plant DBN9641 and the detection method thereof is further illustrated by specific examples below.

[0197] First embodiment: cloning and transformation

[0198] 1.1. Vector cloning

[0199] Standard gene cloning techniques were used to construct the recombinant expression vector DBN10242 (eg Figure 2 The vector DBN10242 contains three transgenic expression cassettes in series, the first expression cassette is composed of a maize anther-specific 5126 promoter (prZm5126) operably linked to the maize MS45 genome (gZmMS45, including the MS45 gene and its 3' untranslated region) that restores male fertility; the second expression cassette is composed of a maize pollen-specific polygalacturonase 47 gene promoter (prZmPG47) operably linked to a maize Brittle-1 transit peptide ( spZmbt1), operably linked to maize α-amylase (cZmAmylase), and operably linked to the terminator (tIn2) of the maize In2-1 gene; the third expression cassette consists of a maize ubiquitin protein promoter (prZmUbi1) operably linked to a glufosinate-tolerant phosphinothricin N-acetyltransferase (cPAT) provided by Streptomyces, and operably linked to the polyadenylation signal sequence (tNos) of the nopaline synthase gene of Agrobacterium tumefaciens.

[0200] The vector DBN10242 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) by liquid nitrogen method, and the transformed cells were screened using PAT gene as selection marker.

[0201] 1.2 Plant transformation

[0202] Male sterile female plants homozygous for the MS45 mutant (ms45) were repeatedly crossed with large amounts of pollen from maize plants susceptible to transformation, resulting in the gradual introgression of the ms45 allele into the susceptible maize germplasm over several generations. Transformation was performed using immature embryos obtained by selfing this material, which segregated at the MS45 locus and included embryos of a homozygous ms45 background.

[0203] Conventional Agrobacterium infection method was used for transformation. The sterile cultured maize embryos of the above transformation materials were co-cultured with the Agrobacterium described in Example 1.1, and the T-DNA in the constructed recombinant expression vector DBN10242 was transferred into the maize chromosome set to produce transgenic maize event DBN9641.

[0204] For Agrobacterium-mediated transformation of maize, briefly, immature embryos are separated from maize and contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the nucleotide sequence of the MS45 genome, the nucleotide sequence of α-amylase and the nucleotide sequence of the PAT gene to at least one cell of one of the embryos (step 1: infection step). In this step, the embryos are preferably immersed in the Agrobacterium suspension (OD 660=0.4-0.6, infection medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetosyringone (AS) 40 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3)) to start the inoculation. The young embryos are co-cultivated with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the young embryos are cultured on solid medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8) after the infection step. After this co-cultivation stage, there can be an optional "recovery" step. In the "recovery" step, at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium is present in the recovery medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, phytagel 3 g / L, pH 5.8), and no selection agent for plant transformants is added (step 3: recovery step). The young embryos are cultured on solid medium with antibiotics but no selection agent to eliminate Agrobacterium and provide a recovery period for infected cells and callus formation. Next, the callus is inoculated on a medium containing a selection agent (glufosinate-ammonium) and cultured to select growing transformed callus (step 4: selection step). Preferably, the callus is cultured on a screening solid medium with a selective agent (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, bialaphos 6 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, phytagel 3 g / L, pH 5.8), resulting in selective growth of transformed cells. Then, the callus is regenerated into plants (step 5: regeneration step), preferably, the callus grown on a medium containing a selective agent is cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.

[0205] The resistant callus obtained by screening was transferred to the MS differentiation medium (MS salt 4.3g / L, MS vitamin, casein 300mg / L, sucrose 30g / L, 6-benzyladenine 2mg / L, bialaphos 6mg / L, plant gel 3g / L, pH 5.8), and cultured and differentiated at 25°C. The differentiated seedlings were transferred to the MS rooting medium (MS salt 2.15g / L, MS vitamin, casein 300mg / L, sucrose 30g / L, indole-3-acetic acid 1mg / L, plant gel 3g / L, pH 5.8), cultured at 25°C to a height of about 10cm, and moved to a greenhouse for culture until fruiting. In the greenhouse, culture was carried out at 28°C for 16 hours and then at 20°C for 8 hours every day.

[0206] 1.3 Identification and screening of transgenic events

[0207] A total of 182 independent ms45 gene homozygous transgenic T0 plants were generated.

[0208] By TaqMan TM The regenerated transgenic corn plants were tested for the presence of complete inserts (MS45 genome, α-amylase gene and PAT gene) by analysis and Southern blotting (see the second and fourth examples), and the copy number of the inserts was characterized. Based on the copy number of the target gene, good protein expression identified by Western (see the fifth example), and normal overall plant morphology, complete recovery of MS45 fertility, transgenic pollen lethality, good glufosinate herbicide tolerance and field performance (see the sixth and seventh examples), event DBN9641 was selected as excellent, with a single copy transgenic, complete recovery of MS45 fertility, transgenic pollen lethality, and good glufosinate herbicide tolerance.

[0209] Second Example: Detection of Transgenic Corn Event DBN9641 Using TaqMan

[0210] About 100 mg of leaves of transgenic corn event DBN9641 were taken as samples, and the genomic DNA was extracted using Qiagen's DNeasy PlantMaxi Kit. The copy numbers of MS45 gene, PAT gene and Amylase gene were detected by Taqman probe fluorescence quantitative PCR method. At the same time, wild-type corn plants were used as controls and the detection and analysis were performed according to the above method. The experiment was repeated 3 times and the average value was taken.

[0211] The specific method is as follows:

[0212] Step 1: Take 100 mg of leaves of transgenic corn event DBN9641, grind them into a homogenate in a mortar with liquid nitrogen, and take 3 replicates for each sample;

[0213] Step 2: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to its product manual;

[0214] Step 3, using NanoDrop 2000 (Thermo Scientific) to measure the genomic DNA concentration of the above samples;

[0215] Step 4, adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;

[0216] Step 5: Use Taqman probe fluorescence quantitative PCR method to identify the copy number of the sample, use the sample with known copy number as the standard, and use the sample of wild-type corn plant as the control, and repeat 3 times for each sample to take the average value; the sequences of fluorescence quantitative PCR primers and probes are:

[0217] The following primers and probes were used to detect the nucleic acid sequence of the MS45 gene:

[0218] Primer 1: GACATAGTAGTGACCGACCCGAG as shown in SEQ ID NO: 16 in the sequence listing;

[0219] Primer 2: CGTCCGATAGCTGATCATGG as shown in SEQ ID NO: 17 in the sequence listing;

[0220] Probe 1: CGAGCCAAACCGAGCGGACG as shown in SEQ ID NO: 18 in the sequence listing;

[0221] The following primers and probes were used to detect the nucleic acid sequence of the PAT gene:

[0222] Primer 3: CAGTTGAGATTAGGCCAGCTACAG as shown in SEQ ID NO: 19 in the sequence listing;

[0223] Primer 4: TTCACTGTAGACGTCTCAATGTAATGG as shown in SEQ ID NO: 20 in the sequence listing;

[0224] Probe 2: CAGCTGATATGGCCGCGGTTTGTG as shown in SEQ ID NO: 21 in the sequence listing;

[0225] The following primers and probes were used to detect the nucleic acid sequence of the Amylase gene:

[0226] Primer 5: GTCACGCACGTCTGGCTG as shown in SEQ ID NO: 22 in the sequence listing;

[0227] Primer 6: TGCCGTACTTGGACGCGT as shown in SEQ ID NO: 23 in the sequence listing;

[0228] Probe 3: CGTCTCGCCACAAGGCTACATGCC as shown in SEQ ID NO: 24 in the sequence listing;

[0229] The PCR reaction system is:

[0230]

[0231] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in an amber tube at 4°C.

[0232] The PCR reaction conditions were:

[0233]

[0234] Data were analyzed using SDS2.3 software (Applied Biosystems), and the results showed that the MS45 gene, PAT gene, and Amylase gene of the transgenic corn event DBN9641 were single copies.

[0235] Example 3: Detection and Analysis of the Insertion Site of Transgenic Maize Event DBN9641

[0236] 3.1 Genomic DNA Extraction

[0237] DNA extraction was performed according to the conventional CTAB (cetyltrimethylammonium bromide) method: 2 g of young leaves of transgenic corn event DBN9641 were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB buffer (20 g / L CTAB, 1.4 M NaCl, 100 mM nis-HCl, 20 mM EDTA (ethylenediaminetetraacetic acid), adjust pH to 8.0 with NaOH), mix thoroughly, and extract at 65°C for 90 minutes; add 0.5 times the volume of phenol and 0.5 times the volume of chloroform, mix by inversion; centrifuge at 12000rpm (revolutions per minute) for 10 minutes; aspirate the supernatant, add 2 times the volume of anhydrous ethanol, gently shake the centrifuge tube, and let it stand at 4°C for 30 minutes; centrifuge at 12000rpm for another 10 minutes; collect DNA to the bottom of the tube; discard the supernatant, wash the precipitate with 1mL of 70% ethanol by mass concentration; centrifuge at 12000rpm for 5 minutes; vacuum dry or blow dry in a clean bench; dissolve the DNA precipitate in an appropriate amount of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and store at -20°C.

[0238] 3.2 Analysis of flanking DNA sequences

[0239] The concentration of the extracted DNA samples was measured so that the concentration of the sample to be tested was between 80-100 ng / μL. The genomic DNA was digested with the selected restriction endonucleases SpeI (5' end analysis) and EcoRI (3' end analysis). 26.5 μL of genomic DNA, 0.5 μL of the selected restriction endonuclease, and 3 μμL of digestion buffer were added to each digestion system, and digested for 1 hour. After the digestion was completed, 70 μL of anhydrous ethanol was added to the digestion system, ice bathed for 30 minutes, centrifuged at 12000 rpm for 7 minutes, the supernatant was discarded, and dried, and then 8.5 μL of double distilled water (dd H2O), 1 μL 10X T4Buffer and 0.5 μL T4 ligase were added to connect overnight at a temperature of 4°C. PCR amplification was performed using a series of nested primers to separate 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for separating 5' transgenic / genomic DNA includes SEQ ID NO: 13 and SEQ ID NO: 30 as the first primer, SEQ ID NO: 31 and SEQ ID NO: 32 as the second primer, and SEQ ID NO: 13 as the sequencing primer. The primer combination for separating 3' transgenic / genomic DNA includes SEQ ID NO: 15 and SEQ ID NO: 33 as the first primer, SEQ ID NO: 34 and SEQ ID NO: 35 as the second primer, and SEQ ID NO: 15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.

[0240] The obtained amplicons were electrophoresed on 2.0% agarose gel to separate the PCR reactants, and then the target fragments were isolated from the agarose matrix using the QIAquickGel extraction kit (Catalog # 28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABIPrism™ 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

[0241] Standard PCR methods were used to confirm the 5' and 3' flanking sequences and junction sequences. The 5' flanking sequence and junction sequence can be confirmed using SEQ ID NO: 8 or SEQ ID NO: 12, in combination with SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 31. The 3' flanking sequence and junction sequence can be confirmed using SEQ ID NO: 11 or SEQ ID NO: 14, in combination with SEQ ID NO: 10, SEQ ID NO: 15, or SEQ ID NO: 35. The PCR reaction system and amplification conditions are shown in Tables 2 and 3. One skilled in the art will appreciate that other primer sequences can also be used to confirm the flanking sequence and junction sequence.

[0242] DNA sequencing of the PCR products provides DNA that can be used to design other DNA molecules that serve as primers and probes for identification of corn plants or seeds derived from transgenic corn event DBN9641.

[0243] The maize genomic sequence is found at nucleotides 1-1729 of SEQ ID NO:5, flanking the right border of the insertion sequence of transgenic maize event DBN9641 (5' flanking sequence), and the maize genomic sequence is found at nucleotides 12469-13528 of SEQ ID NO:5, flanking the left border of the insertion sequence of transgenic maize event DBN9641 (3' flanking sequence). The 5' junction sequence is listed in SEQ ID NO:1, and the 3' junction sequence is listed in SEQ ID NO:2.

[0244] 3.3. PCR zygosity assay

[0245] The junction sequence is a relatively short polynucleotide molecule that is a novel DNA sequence that is diagnostic for the DNA of transgenic corn event DBN9641 when detected in a polynucleic acid detection assay. The junction sequences in SEQ ID NO: 1 and SEQ ID NO: 2 are 11 polynucleotides on each side of the insertion site of the transgenic fragment in transgenic corn event DBN9641 and the corn genomic DNA. Longer or shorter polynucleotide junction sequences can be selected from SEQ ID NO: 3 or SEQ ID NO: 4. The junction sequences (5' junction region SEQ ID NO: 1, and 3' junction region SEQ ID NO: 2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The junction sequences SEQ ID NO: 6 and SEQ ID NO: 7 are also novel DNA sequences in transgenic corn event DBN9641, which can also be used as DNA probes or as DNA primer molecules to detect the presence of transgenic corn event DBN9641 DNA. The SEQ ID NO: 6 (nucleotides 1674-2232 of SEQ ID NO: 3) spans the DBN10242 construct DNA sequence and the prZm5126 promoter sequence, and the SEQ ID NO: 7 (nucleotides 1-447 of SEQ ID NO: 4) spans the tNos transcription termination sequence and the DBN10242 construct DNA sequence.

[0246] Additionally, an amplicon was generated by using at least one primer from SEQ ID NO: 3 or SEQ ID NO: 4 that, when used in a PCR method, produced an amplicon diagnostic for transgenic corn event DBN9641.

[0247] Specifically, a PCR product was generated from the 5' end of the transgenic insertion sequence, which was a portion of the genomic DNA flanking the 5' end of the T-DNA insertion sequence in the genome of the plant material derived from the transgenic corn event DBN9641. This PCR product contained SEQ ID NO: 3. For PCR amplification, primer 7 (SEQ ID NO: 8) was designed to hybridize to the genomic DNA sequence flanking the 5' end of the transgenic insertion sequence, and primer 8 (SEQ ID NO: 9) was paired with it and located in the transgenic prZm5126 promoter sequence.

[0248] A PCR product was generated from the 3' end of the transgenic insertion sequence, which PCR product contained a portion of the genomic DNA flanking the 3' end of the T-DNA insertion sequence in the genome of the plant material derived from the transgenic corn event DBN9641. This PCR product contained SEQ ID NO: 4. For PCR amplification, primer 10 (SEQ ID NO: 11) was designed to hybridize to the genomic DNA sequence flanking the 3' end of the transgenic insertion sequence, and primer 9 (SEQ ID NO: 10) was paired with the tNos transcription termination sequence located at the 3' end of the insert.

[0249] The DNA amplification conditions described in Tables 2 and 3 can be used in the above-mentioned PCR zygosity test to generate diagnostic amplicons for transgenic corn event DBN9641. Detection of the amplicons can be performed by using a Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien thermal cycler, etc., as shown in Table 3, or by methods and equipment known to those skilled in the art.

[0250] Table 2. PCR steps and reaction mixture conditions for identification of the 5' transgenic insert / genomic junction region of transgenic maize event DBN9641

[0251]

[0252]

[0253] Table 3. Thermal cycler amplification conditions

[0254]

[0255] Mix gently and add 1-2 drops of mineral oil over each reaction if there is no insulation cap on the thermal cycler. Perform PCR on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler using the cycling parameters in Table 3. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.

[0256] The experimental results show that: primers 7 and 8 (SEQ ID NOs: 8 and 9), when used in the PCR reaction of the genomic DNA of the transgenic corn event DBN9641, produce an amplification product of a 2232bp fragment, and when used in the PCR reaction of the untransformed corn genomic DNA and the non-DBN9641 corn genomic DNA, no fragment is amplified; primer pair 9 and 10 (SEQ ID NOs: 10 and 11), when used in the PCR reaction of the genomic DNA of the transgenic corn event DBN9641, produce an amplification product of a 1345bp fragment, and when used in the PCR reaction of the untransformed corn genomic DNA and the non-DBN9641 corn genomic DNA, no fragment is amplified.

[0257] The PCR zygosity assay can also be used to identify whether material derived from transgenic corn event DBN9641 is homozygous or heterozygous. Primer 11 (SEQ ID NO: 12), Primer 12 (SEQ ID NO: 13) and Primer 13 (SEQ ID NO: 14) were used in the amplification reaction to generate a diagnostic amplicon for transgenic corn event DBN9641. The DNA amplification conditions described in Tables 4 and 5 can be used in the above zygosity assay to generate a diagnostic amplicon for transgenic corn event DBN9641.

[0258] Table 4. Reaction solution for zygosity determination

[0259]

[0260]

[0261] Table 5. Thermal cycler amplification conditions for zygosity assay

[0262]

[0263] PCR was performed on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler using the cycling parameters of Table 5. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The Perkin-Elmer 9700 thermal cycler should be run with the ramp speed set to maximum.

[0264] In the amplification reaction, the biological sample containing the template DNA contains DNA that is diagnostic for the presence of the transgenic corn event DBN9641 in the sample. Alternatively, the reaction will produce two different DNA amplicons from a biological sample containing DNA derived from a corn genome, which is heterozygous for the allele corresponding to the inserted DNA present in the transgenic corn event DBN9641. The two different amplicons will correspond to a first amplicon derived from a wild-type corn genomic locus and a second amplicon that is diagnostic for the presence of the transgenic corn event DBN9641 DNA. A corn DNA sample that only produces a single amplicon corresponding to the second amplicon described for a heterozygous genome can be diagnosed to determine the presence of the transgenic corn event DBN9641 in the sample, and the sample is produced by corn seeds that are homozygous for the allele corresponding to the inserted DNA present in the transgenic corn plant DBN9641.

[0265] It should be noted that the primer pairs of transgenic corn event DBN9641 are used to generate amplicons that are diagnostic for the genomic DNA of transgenic corn event DBN9641. These primer pairs include, but are not limited to, primers 7 and 8 (SEQ ID NOs: 8 and 9), and primers 9 and 10 (SEQ ID NOs: 10 and 11), which are used in the DNA amplification method. In addition, a control primer 14 and 15 (SEQ ID NOs: 25 and 26) for amplifying endogenous genes in corn are included as an internal standard for reaction conditions. Analysis of DNA extract samples of transgenic corn event DBN9641 should include a positive tissue DNA extract control of transgenic corn event DBN9641, a negative DNA extract control from non-transgenic corn event DBN9641, and a negative control of corn DNA extract without template. In addition to these primer pairs, any primer pair from SEQ ID NO: 3 or SEQ ID NO: 4, or their complements, which when used in a DNA amplification reaction produce an amplicon comprising SEQ ID NO: 1 or SEQ ID NO: 2, respectively, that is diagnostic for tissue derived from transgenic event corn plant DBN9641 can be used. The DNA amplification conditions described in Tables 2-5 can be used to produce a diagnostic amplicon for transgenic corn event DBN9641 using the appropriate primer pairs. Extracts presumed to contain corn plant or seed DNA comprising transgenic corn event DBN9641, or products derived from transgenic corn event DBN9641, that produce an amplicon that is diagnostic for transgenic corn event DBN9641 when tested in a DNA amplification method can be used as a template for amplification to determine the presence of transgenic corn event DBN9641.

[0266] Example 4: Detection of transgenic corn event DBN9641 by Southern blot hybridization

[0267] 4.1. DNA extraction for Southern blot hybridization

[0268] Southern blot analysis was performed using T4 and T5 generation homozygous transformation events. Approximately 5 to 10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. The plant tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl-pyrrolidone) and centrifuged at 4000 rpm for 10 min (2755 g). After discarding the supernatant, the pellet was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinyl-pyrrolidone, 3% sarkosyl, 20% ethanol) and incubated at 37° C. for 30 min. During the incubation period, the sample was mixed once with a sterile loop. After incubation, an equal volume of chloroform / isoamyl alcohol (24:1) was added, gently mixed by inversion, and centrifuged at 4000 rpm for 20 min. The aqueous layer was collected and centrifuged at 4000 rpm for 5 min after adding 0.54 volumes of isopropanol to precipitate the DNA. The supernatant was discarded and the DNA pellet was resuspended in 500 μ TE. In order to degrade any RNA present, the DNA was incubated with 1 μL 30 mg / mL RNAase A at 37°C for 30 min, centrifuged at 4000 rpm for 5 min, and precipitated by centrifugation at 14000 rpm for 10 min in the presence of 0.5 volumes of 7.5 M ammonium acetate and 0.54 volumes of isopropanol. After discarding the supernatant, the pellet was washed with 500 μL of 70% ethanol by mass, dried and resuspended in 100 μL TE.

[0269] 4.2 Restriction enzyme digestion

[0270] DNA concentration was quantified using a spectrophotometer or fluorometer (using 1× TNE and Hoechst dye).

[0271] In a total volume of 100 μL reaction system, 5 μg DNA was digested each time to prepare appropriate enzyme digestion products. NheI and SphI were digested to detect the MS45 gene, NdeI and NheI were digested to detect the PAT gene, and NdeI and SphI were digested to detect the copy number of the Amylase gene. For each enzyme, the digest was incubated overnight at an appropriate temperature. The sample was rotated using a speed vacuum to reduce the volume to 30 μL.

[0272] 4.3 Gel electrophoresis

[0273] Bromophenol blue loading dye was added to each sample from Example 4.2 and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide and separated by electrophoresis in TBE running buffer. The gel was run at 20 volts overnight.

[0274] Wash the gel for 15 minutes in 0.25M HCl to depurinate the DNA, then wash with water. Set up Southern blot hybridization as follows: place 20 thick dry blotting papers in a dish, and place 4 thin dry blotting papers on it. Pre-wet 1 thin blotting paper in 0.4M NaOH and place it on the paper stack, then place 1 Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4M NaOH. The gel is placed on the top to ensure that there are no bubbles between the gel and the membrane. 3 additional pre-soaked blotting papers are placed on the top of the gel, and the buffer tray is filled with 0.4M NaOH. Connect the gel stack and the buffer tray with a wick pre-soaked in 0.4M NaOH, and transfer the DNA to the membrane. Perform DNA transfer for about 4 hours at room temperature. After the transfer, rinse the Hybond membrane for 10 seconds in 2×SSC, and the DNA is bound to the membrane by UV cross-linking.

[0275] 4.4 Hybridization

[0276] Use PCR to amplify a suitable DNA sequence for probe preparation. The DNA probe is SEQ ID NO: 27, SEQ ID NO: 28 or SEQ ID NO: 29, or a portion homologous or complementary to the above sequence. Boil 25 ng of probe DNA in 45 μL TE for 5 min, place on ice for 7 min, and then transfer to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. Add 5 μL of 32 After dCTP labeled with P, the probe was incubated at 37°C for 15 min. The probe was purified by centrifugation through a microcentrifuge G-50 column (Amersham Pharmacia Biotech, #27-5330-01) according to the manufacturer's instructions to remove unincorporated dNTPs. The probe activity was measured using a scintillation counter.

[0277] Prehybridize the Hybond membrane by wetting it with 20 ml pre-warmed Church prehybridization solution (500 mM Na3PO4, 1 mM EDTA, 7% SDS, 1% BSA) at 65°C for 30 min. Boil the labeled probe for 5 min and place on ice for 10 min. Add an appropriate amount of probe to the prehybridization buffer (1 million counts per 1 ml prehybridization buffer) and hybridize overnight at 65°C. The next day, discard the hybridization buffer, rinse with 20 ml Church wash solution 1 (40 mM Na3PO4, 1 mM EDTA, 5% SDS, 0.5% BSA), and then wash the membrane in 150 ml Church wash solution 1 at 65°C for 20 min. Repeat this process twice with Church wash solution 2 (40 mM Na3PO4, 1 mM EDTA, 1% SDS). Expose the membrane to a phosphor screen or X-ray film to detect the location of probe binding.

[0278] Three control samples were included on each Southern: (1) DNA from a negative (untransformed) segregant to identify any endogenous maize sequences that hybridized to the element-specific probe; (2) DNA from a negative segregant into which Hind III-digested DBN10242 was introduced in an amount equivalent to one copy number based on probe length to demonstrate the sensitivity of the assay in detecting a single gene copy within the maize genome; and (3) Hind III-digested DBN10242 plasmid equivalent to one copy number based on probe length to serve as a positive control for hybridization and to demonstrate the sensitivity of the assay.

[0279] Hybridization data provided conclusive evidence supporting TaqMan TM pCR analysis showed that the corn plant DBN9641 contained a single copy of the MS45 gene, the α-amylase gene, and the PAT gene, and that the corn plant DBN9641 did not contain any vector backbone sequences present in the DBNBC1 0242 plasmid. As expected for the MS45, PAT, and Amylase probes, the NdeI, NheI, and SphI digests all gave single hybridization bands of the correct size: using the MS45 probe, NheI and SphI digestions produced single bands of approximately 13 kb and 14 kb, respectively; using the α-amylase gene probe, NdeI and SphI digestions produced single bands of approximately 10 kb and 8 kb, respectively; using the PAT probe, NdeI and NheI digestions both produced single bands of approximately 7 kb and 16 kb. This indicates that one copy of each gene is present in the corn plant DBN9641. Additionally, for the backbone probe, there was no hybridization, indicating that no DBN1 0242 vector backbone sequence was incorporated into the maize plant DBN9641 during the transformation process.

[0280] The sequence of the Amylase probe used in the present invention is consistent with the endogenous Amylase sequence of the corn genome. As a result, Southern blotting using the probe shows a band due to hybridization with the endogenous sequence in addition to the band of the insert.

[0281] Example 5: Detection of transgenic corn event DBN9641 by Western blotting

[0282] The expression of MS45, PAT and Amylase proteins in transgenic corn event DBN9641 can be detected by Western blotting.

[0283] 5.1. Sample electrophoresis

[0284] Dilute the sample to be tested with 5×SDS loading buffer (with β-mercaptoethanol added), boil for 5 minutes, and centrifuge at 12000rpm for 5 minutes to remove insoluble matter that interferes with electrophoresis. Add 10μL of supernatant protein sample to the sample well and 3-5μL of protein molecular weight standard to the control well. Perform electrophoresis at 120V for about 1.5h until bromophenol blue migrates to the bottom of the separation gel, then stop electrophoresis. Remove the gel glass plate and separate it, and cut off the concentrated gel and the separation gel at the front end of the bromophenol blue.

[0285] 5.2. Sample color development

[0286] Place the gel in Coomassie Brilliant Blue staining solution for staining and incubate in a shaker at room temperature for 1-2 hours. Discard the staining solution, add destaining solution, and incubate in a shaker at room temperature for 1-2 hours, changing the destaining solution 2-3 times during the process, until a clear blue band and a clean background are obtained.

[0287] 5.3. Sample transfer (semi-dry electrotransfer)

[0288] Use Bio-rad semi-dry electroporator for membrane transfer. Cut a PVDF membrane slightly larger than the gel and two layers of filter paper that are exactly the same size as the gel. Soak the PVDF membrane in 100% methanol for 15 seconds, then soak it in ddH2O for 2 minutes, then soak it in pre-cooled transfer buffer for 5 minutes, and soak the gel and filter paper in pre-cooled transfer buffer for 15 minutes. Assemble the filter paper and PVDF membrane in order, and remove the bubbles between each layer. Place the top electrode (cathode) on the transfer sandwich and transfer at 10V for 20-30 minutes. After the transfer is completed, turn off the power, remove the transfer device, and take out the PVDF membrane.

[0289] 5.4 Hybridization

[0290] Wash the membrane twice in TBST solution for 2 minutes each time, discard the washing solution, place the membrane in 20mL blocking solution, and block at 37°C for 2 hours. After blocking, discard the blocking solution, place the membrane in a heat-sealable plastic bag, add the primary antibody solution diluted with the blocking solution, and shake at room temperature for 1-2 hours. Take out the membrane and wash it 3 times in TBST washing solution for 10 minutes each time. Put the membrane in a heat-sealable plastic bag, add the enzyme-labeled secondary antibody solution (HRP labeled) diluted with the blocking solution, and incubate at 37°C for 1 hour. After taking out the membrane, wash it 3 times with TBST for 10 minutes each time.

[0291] 5.5. Development and testing

[0292] Use Pro-light HRP chemiluminescent development for detection. Prepare substrate working solution by mixing equal volumes of substrate reagent A (mainly Luminol and special luminescence enhancer) and reagent B (mainly H2O2 and special stabilizer). Place the washed membrane on plastic wrap, wrap it with plastic wrap immediately after adding the substrate working solution to the membrane, and quickly put it into a dark box for exposure. Carefully press Kodak X-ray film onto the membrane in a darkroom and change the exposure time to achieve the best effect.

[0293] Perform development and fixing operations under red light (light should not be too strong), wash the film immediately after fixing, and then dry it. Take a photo or scan to save the results, use absorbent paper to absorb the liquid on the film, and store it away from light after drying.

[0294] 5.6 Western test results

[0295] Hybridization data showed that MS45 protein was only expressed in unripe tassels, but not in any tissues and organs during the pollen shedding and milky stages; Amylase protein was expressed in pollen, but not in other stages and organs; PAT protein was expressed in all tissues and organs.

[0296] Example 6: Analysis of transgenic corn plant DBN9641

[0297] Transgenic maize plant DBN9641 was evaluated for overall plant morphology and analyzed for the spread of the transgene in pollen and embryo sac. No other morphological differences were observed between the transgenic maize plant DBN9641 and the non-transgenic maize control plant-ms45 (ms45 homozygous recessive male sterile maize plant) except for the degree of male fertility, and the pollen of the transgenic maize plant DBN9641 was partially fertile, while the non-transgenic maize control plant-ms45 failed to produce fertile pollen, indicating that the expression of the MS45 gene that restores male fertility complements the homozygous recessive ms45 male sterile phenotype, while the expression of the alpha amylase gene causes partial male sterility by removing pollen grains carrying the transgene, as shown in Figure 2. Figure 3 shown.

[0298] The correct function of the alpha amylase gene and the homozygous recessive state of maintaining male sterile plants was further confirmed by controlled pollination between the transgenic corn plant DBN9641 and the non-transgenic corn plant-ms45. The non-transgenic corn control plant-ms45 was pollinated one-to-one with pollen grains from 20 transgenic corn plants DBN9641, and then seeds were harvested from the pollinated non-transgenic corn control plant-ms45, 10 ears were taken, 200 seeds were taken from each ear, and divided into 2 equal parts for planting, grown to the V3 stage, one part was not sprayed, and the other part was sprayed with glufosinate ammonium, and whether the plant was damaged was determined based on the leaf damage observed on the 10th day after the herbicide treatment at the V3 leaf stage. As a result, 100% of the seedlings that were not sprayed with glufosinate showed no leaf damage, while 98%±2% of the seedlings that were sprayed with glufosinate showed leaf damage, indicating that the construct (including the MS45 genome, α-amylase gene and PAT gene) was not passed to the offspring through pollen, and the offspring were non-transgenic. The results are shown in Table 6.

[0299] Seeds were harvested from the non-transgenic corn control plant-ms45 after pollination, and 10 ears were taken. 200 seeds were planted in each ear until the plants grew into plants. 100% of the plants could not produce pollen and could not bear fruit after self-pollination, that is, they were completely male sterile plants. This shows that the transgenic corn plant DBN9641 containing the construct (including the MS45 genome, α-amylase gene and PAT gene) can be used to maintain the homozygous recessive state of male sterile plants. The results are shown in Table 7.

[0300] In addition, the transgenic corn plant DBN9641 was pollinated with pollen from a wild-type corn control plant. Seeds were harvested from the pollinated transgenic corn plant DBN9641, 10 ears were taken, 200 seeds were taken from each ear, and the seeds were divided into 2 equal parts for planting, grown to the V3 stage, one part was not sprayed, and the other part was sprayed with glufosinate-ammonium. Whether the plant was damaged was determined based on the leaf damage observed on the 10th day after the herbicide treatment at the V3 leaf stage. As a result, 100% of the seedlings that were not sprayed with glufosinate-ammonium showed no leaf damage, but only 50%±2% of the seedlings that were sprayed with glufosinate-ammonium showed leaf damage, indicating that the construct (including the MS45 genome, α-amylase gene and PAT gene) was transmitted to the offspring at an expected frequency through the egg cell, as shown in Table 8.

[0301] Table 6 Transmission of transgenes via pollen in seedlings

[0302]

[0303]

[0304] Table 7 Transmission of transgenes in seeds via pollen

[0305]

[0306] Table 8 Transgene transmission in seedlings via eggs

[0307]

[0308]

[0309] Example 7: Propagation of transgenic corn plant DBN9641

[0310] The transgenic corn plant DBN9641 was self-fertilized, and the self-pollinated T1 seed-ms45 was harvested. 50 seeds of the self-pollinated T1 seed-ms45 were planted until they grew into self-pollinated T1 plants-ms45 (V3 leaf stage). The self-pollinated T1 plants-ms45 were sprayed with glufosinate ammonium, and whether the plants were damaged was determined based on the leaf damage observed on the 10th day after the herbicide treatment at the V3 leaf stage. As shown in Table 9, 50%±1.5% of the self-pollinated T1 plants-ms45 showed essentially no leaf damage, indicating that the construct (including the MS45 genome, α-amylase gene and PAT gene) was transmitted to the offspring at the expected frequency through the egg cells, i.e., the transgenic corn plant-ms45 (maintainer plant) containing the transgenic event DBN9641 was identified. Seeds were harvested from the transgenic corn plant-ms45 containing the transgenic event DBN9641 and used to propagate the maintainer plant.

[0311] Table 9. Results of self-pollination of transgenic plants treated with herbicides in T1 plants

[0312]

[0313] Eighth embodiment

[0314] Agricultural products or commodities such as can be produced from transgenic corn event DBN9641. If sufficient expression is detected in the agricultural product or commodity, the agricultural product or commodity is expected to contain a nucleotide sequence that can diagnose the presence of transgenic corn event DBN9641 material in the agricultural product or commodity. The agricultural product or commodity includes, but is not limited to, corn oil, corn meal, corn flour, corn gluten, corn tortillas, corn starch, and any other food to be consumed by animals as a food source, or otherwise used as a bulking agent or ingredient in a cosmetic composition for cosmetic purposes, etc. Nucleic acid detection methods and / or kits based on probe or primer pairs can be developed to detect transgenic corn event DBN9641 nucleotide sequences such as those shown in SEQ ID NO: 1 or SEQ ID NO: 2 in biological samples, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5, to diagnose the presence of transgenic corn event DBN9641.

[0315] In summary, the transgenic corn event DBN9641 of the present invention is endowed with hybrid seed production technology. The method omits the step of emasculation in the hybrid seed production process, saves manpower and material resources, is simple to operate, has high sorting efficiency and good effect, does not require seed screening through sorting equipment, and improves the screening accuracy. At the same time, the offspring produced by it is still non-transgenic, and the detection method can accurately and quickly identify whether the biological sample contains the DNA molecule of the transgenic corn event DBN9641.

[0316] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A nucleic acid molecule having the following nucleic acid sequence, characterized in that: The nucleic acid sequence comprises at least 11 consecutive nucleotides from positions 1 to 1673 of SEQ ID NO: 3 or its complementary sequence and at least 11 consecutive nucleotides from positions 1674 to 2232 of SEQ ID NO: 3 or its complementary sequence, and / or at least 11 consecutive nucleotides from positions 1 to 447 of SEQ ID NO: 4 or its complementary sequence and at least 11 consecutive nucleotides from positions 448 to 1345 of SEQ ID NO: 4 or its complementary sequence; Preferably, the nucleic acid sequence comprises 22-25 consecutive nucleotides from positions 1-1673 of SEQ ID NO: 3 or its complementary sequence and 22-25 consecutive nucleotides from positions 1674-2232 of SEQ ID NO: 3 or its complementary sequence, and / or 22-25 consecutive nucleotides from positions 1-447 of SEQ ID NO: 4 or its complementary sequence and 22-25 consecutive nucleotides from positions 448-1345 of SEQ ID NO: 4 or its complementary sequence; Preferably, the nucleic acid sequence comprises SEQ ID NO: 1 or its complementary sequence, and / or SEQ ID NO: 2 or its complementary sequence; Preferably, the nucleic acid sequence comprises SEQ ID NO: 3 or its complementary sequence, and / or SEQ ID NO: 4 or its complementary sequence.

2. The nucleic acid molecule according to claim 1, characterized in that The nucleic acid sequence includes SEQ ID NO: 5 or its complementary sequence.

3. A method for detecting the presence of DNA of transgenic corn event DBN9641 in a sample, characterized in that: include: contacting the sample to be tested with at least two primers for amplifying a target amplification product in a nucleic acid amplification reaction; performing nucleic acid amplification reactions; and detecting the presence of a target amplification product; The target amplification product comprises the nucleic acid molecule according to claim 1 or 2; Preferably, the target amplification product comprises SEQ ID NO: 1 or a complementary sequence thereof, SEQ ID NO: 2 or a complementary sequence thereof, SEQ ID NO: 6 or a complementary sequence thereof, and / or SEQ ID NO: 7 or a complementary sequence thereof.

4. The method for detecting the presence of DNA of transgenic corn event DBN9641 in a sample according to claim 3, characterized in that: The two primers include complementary sequences of SEQ ID NO:1 and SEQ ID NO:9, SEQ ID NO:8 and SEQ ID NO:9, SEQ ID NO:2 and SEQ ID NO:11, SEQ ID NO:10 and SEQ ID NO:11, or SEQ ID NO:1 and SEQ ID NO:

2.

5. A method for detecting the presence of DNA of transgenic corn event DBN9641 in a sample, characterized in that: include: Contacting the sample to be detected with a probe, wherein the probe comprises the nucleic acid molecule of claim 1; preferably, the probe comprises SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, and / or SEQ ID NO: 7 or its complementary sequence; Hybridizing the sample to be detected and the probe under stringent hybridization conditions; and Detect the hybridization between the sample to be detected and the probe.

6. The method for detecting the presence of DNA of transgenic corn event DBN9641 in a sample according to claim 5, characterized in that: At least one of the probes is labeled with at least one fluorescent group.

7. A method for detecting the presence of DNA of transgenic corn event DBN9641 in a sample, characterized in that: include: Contacting the sample to be detected with a marker nucleic acid molecule, wherein the marker nucleic acid molecule comprises the nucleic acid sequence of claim 1; preferably, the marker nucleic acid molecule comprises at least one of the following: SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, and / or SEQ ID NO: 6-11 or its complementary sequence; Hybridizing the sample to be detected and the marker nucleic acid molecule under stringent hybridization conditions; The hybridization between the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is performed to determine whether glufosinate tolerance is genetically linked to the marker nucleic acid molecule.

8. A DNA detection kit, characterized in that: The method comprises at least one DNA molecule, wherein the DNA molecule comprises the nucleic acid molecule according to claim 1, which can be used as one of the DNA primers or probes specific to the transgenic corn event DBN9641 or its progeny; Preferably, the DNA molecule comprises SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence, and / or SEQ ID NO: 7 or its complementary sequence.

9. A plant or plant part, characterized in that The invention comprises a nucleic acid sequence encoding an MS45 protein for restoring male fertility, a nucleic acid sequence encoding an α-amylase, a nucleic acid sequence encoding a glufosinate-tolerant PAT protein, and a nucleic acid sequence in a specific region, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; Preferably, the genome of the plant or plant part comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence; Preferably, the genome of the plant or plant part comprises the sequence shown in SEQ ID NO: 5: Preferably, the plant or plant part comprises transgenic maize event DBN9641.

10. A method for restoring male fertility of corn plants, characterized in that: The method comprises introducing a nucleic acid sequence encoding an MS45 protein for restoring male fertility and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7; Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO:

5.

11. A method for inhibiting the formation or function of fertile male gametes in a corn plant, characterized in that: The method comprises introducing a nucleic acid sequence encoding alpha amylase and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7; Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO:

5.

12. A method for disrupting pollen development in corn plants, characterized in that: The method comprises introducing a nucleic acid sequence encoding alpha amylase and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7; Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO:

5.

13. A method for degrading starch in corn plant pollen, characterized in that: The method comprises introducing a nucleic acid sequence encoding alpha amylase and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7; Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO:

5.

14. A method for reducing the spread of exogenous genes in corn plant pollen, characterized in that: The method comprises introducing a nucleic acid sequence encoding alpha amylase and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7; Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO:

5.

15. A method for producing corn plants tolerant to glufosinate herbicide, characterized in that: The method comprises introducing a nucleic acid sequence encoding a glufosinate-tolerant PAT protein and a nucleic acid sequence in a specific region into the genome of the corn plant, wherein the nucleic acid sequence in the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7; Preferably, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 is introduced into the genome of the corn plant, so that the genome of the corn plant contains SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence, or the genome of the corn plant contains SEQ ID NO:

5.

16. The method of producing corn plants tolerant to glufosinate-ammonium herbicides according to claim 15, characterized in that: include: sexually crossing a first parent corn plant of transgenic corn event DBN9641 that is tolerant to glufosinate herbicide with a second parent corn plant that lacks glufosinate tolerance, thereby producing a plurality of progeny plants; treating the progeny plants with a glufosinate-ammonium herbicide; The progeny plants are selected to be tolerant to glufosinate-ammonium.

17. A method for growing corn plants tolerant to glufosinate herbicide, characterized in that: include: Planting at least one corn seed, wherein the genome of the corn seed includes a nucleic acid sequence encoding a glufosinate-tolerant PAT protein and a nucleic acid sequence of a specific region; allowing the corn seeds to grow into corn plants; Spraying the corn plants with an effective amount of glufosinate-ammonium herbicide, and harvesting the plants having reduced plant damage compared to other plants not having the nucleic acid sequence of the specific region; The nucleic acid sequence of the specific region comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7; Preferably, the genome of the corn seed comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence; Preferably, the genome of the corn seed comprises the sequence shown in SEQ ID NO:

5.

18. A method for protecting plants from damage caused by herbicides, characterized in that The method comprises applying an effective dose of a glufosinate herbicide to a field planted with at least one transgenic corn plant, wherein the transgenic corn plant comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 in its genome, and the transgenic corn plant is tolerant to the glufosinate herbicide; Preferably, the genome of the transgenic corn plant comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5, and SEQ ID NO: 2 in sequence; Preferably, the genome of the transgenic corn plant comprises the sequence shown in SEQ ID NO:

5.

19. A method for controlling weeds in a field, characterized in that: The method comprises applying an effective dose of a glufosinate herbicide to a field planted with at least one transgenic corn plant, wherein the transgenic corn plant comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 in its genome, and the transgenic corn plant is tolerant to the glufosinate herbicide; Preferably, the genome of the transgenic corn plant comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5, and SEQ ID NO: 2 in sequence; Preferably, the genome of the transgenic corn plant comprises the sequence shown in SEQ ID NO:

5.

20. A method for selecting a construct having a purpose, characterized in that The method comprises applying an effective dose of a glufosinate herbicide to a field planted with at least one transgenic corn plant, wherein the transgenic corn plant comprises in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, and the transgenic corn plant has the target construct, wherein the target construct comprises a nucleic acid sequence encoding a glufosinate tolerance protein; Preferably, the genome of the transgenic corn plant comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5, and SEQ ID NO: 2 in sequence; Preferably, the genome of the transgenic corn plant comprises the sequence shown in SEQ ID NO:

5.

21. A method for maintaining a homozygous recessive state in a male sterile plant, characterized in that: Include: (a) providing a first plant, wherein the first plant comprises a homozygous recessive allele of a male sterility gene MS45, and the first plant is male sterile; (b) providing a second plant, the second plant comprising a homozygous recessive allele of a male sterility gene that is the same as the homozygous recessive allele of a male sterility gene contained in the first plant; the second plant comprising a hemizygous construct and a nucleic acid sequence of a specific region, the construct comprising a nucleic acid sequence encoding an MS45 protein that restores male fertility, a nucleic acid sequence encoding an α-amylase, and a nucleic acid sequence encoding a glufosinate-tolerant PAT protein, the nucleic acid sequence of the specific region comprising a sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7; Preferably, the genome of the second plant sequentially comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5, and SEQ ID NO: 2; Preferably, the genome of the second plant contains the sequence shown in SEQ ID NO: 5; (c) fertilizing said first plant with male gametes from said second plant to produce offspring that retain the homozygous recessive state of said first plant.

22. A method for producing seeds from a plant having female gametes and male gametes, characterized in that Include: (a) introducing a construct into a first plant comprising a homozygous recessive allele of a male sterile gene MS45, wherein the first plant is male sterile: the construct comprises a nucleic acid sequence encoding an MS45 protein for restoring male fertility, a nucleic acid sequence encoding an α-amylase, and a nucleic acid sequence encoding a glufosinate-tolerant PAT protein, and the nucleic acid sequence comprising a specific region in the first plant into which the construct is introduced comprises a sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7; Preferably, the genome of the first plant into which the construct is introduced comprises SEQ ID NO: 1, the nucleic acid sequence at positions 2202-12274 of SEQ ID NO: 5, and SEQ ID NO: 2 in sequence; Preferably, the genome of the first plant into which the construct is introduced comprises the sequence shown in SEQ ID NO: 5; (b) self-fertilizing the first plant; (c) producing seeds containing the construct.

23. An agricultural product or commodity produced from transgenic corn event DBN9641, characterized in that: The agricultural product or commodity is corn flour, corn meal, corn oil, corn starch, corn gluten, corn tortillas, cosmetics or fillers: Preferably, the agricultural product or commodity comprises DNA of transgenic corn event DBN9641; More preferably, the agricultural product or commodity comprises the nucleic acid molecule of claim 1.

Images